A 4-(p-iodophenyl)butyl-modified long-circulating itaconic acid derivative, its preparation method, and its medical use

Abstract

The present invention provides a method for preparing a long-circulating itaconic acid derivative modified with 4-(p-iodophenyl)butyl. It also discloses the medical use of the long-circulating itaconic acid derivative in preventing and treating sepsis, belonging to the field of pharmaceutical technology. The invention has excellent biosafety. Compared with itaconic acid (ITA), the long-circulating itaconic acid derivative modified with 4-(p-iodophenyl)butyl (ITA-I) significantly improves its efficacy in preventing and treating sepsis, solving the problem of low clinical treatment efficiency caused by rapid itaconic acid metabolism. It has promising application in the prevention and treatment of sepsis and provides a novel material for the treatment of sepsis.

Description

Technical Field

[0001] The present invention provides a 4-(p-iodophenyl)butyl-modified long-circulating itaconic acid derivative and a preparation method thereof, and also discloses the medical use of the long-circulating itaconic acid derivative in preventing and treating sepsis, belonging to the field of medical technology. Background Art

[0002] Sepsis is a systemic inflammatory response syndrome caused by the invasion of pathogenic microorganisms into the body. Literature reports indicate that the incidence of sepsis ranges from 300 to 1,031 cases per 100,000 people, and approximately 14,000 people die from its complications each day worldwide. It has become the leading cause of death among non-cardiac patients in intensive care units. Despite progress in anti-infective treatment and organ function support technologies, the mortality rate remains as high as 14.7% to 29.9%. This not only poses a serious threat to human health but also imposes a significant economic burden on healthcare.

[0003] Itaconate (ITA) is a small molecule metabolite with anti-inflammatory properties that accumulates in macrophage mitochondria. It participates in immune metabolism and has great potential in the treatment of inflammation. Previous studies have demonstrated that itaconate significantly reduces inflammatory factors and oxidative stress in septic mice, protecting tissue and organ function. However, its short circulation time limits its clinical application. This study constructed a long-circulating itaconate derivative with excellent biosafety and low manufacturing cost, which is expected to improve the pharmacokinetics and pharmacodynamics of itaconate and holds great promise for the treatment of sepsis. Summary of the Invention

[0004] The purpose of the present invention is to provide a 4-(p-iodophenyl)butyl modified long-circulation itaconic acid derivative and a preparation method thereof, which is a new compound.

[0005] The present invention further provides a medical use of a 4-(p-iodophenyl)butyl-modified long-circulating itaconic acid derivative, which can be used for preventing and treating sepsis.

[0006] The present invention discloses a 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative having the following structural formula:

[0007]

[0008] Molecular formula: C 22 H 29 IN2O6 molecular weight: 544.

[0009] The preparation method of a 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative of the present invention comprises the following steps:

[0010] 1. Add 1.45 g of 4-(p-iodophenyl)butyric acid (MW = 290.10 g / mol), 1.9 g of 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (MW = 380.24 g / mol) and 5 ml of dichloromethane and react at room temperature under nitrogen for 1 h.

[0011] 2. Dissolve 1.2 g of Fmoc-Lys-OMe.HCl (MW = 418.91 g / mol) and 1.29 g of N,N-diisopropylethylamine (MW = 129.24 g / mol) in 5 ml of dichloromethane. Add dropwise to the liquid obtained in step 1) and allow to react overnight with constant stirring. Rotary evaporate the resulting yellow oil to obtain the product.

[0012] 3. Take 100 mg of the product from step 2) and add 40 μl of piperidine and 1.5 ml of methanol. Heat at 40°C under nitrogen for 6-8 hours. The resulting yellow oil is dried, extracted, and passed through a column chromatography column. Confirm the product by spotting. Dissolve in ether and dry to obtain a white solid.

[0013] 4. Dissolve 6.5 mg of itaconic anhydride (MW = 112 g / mol) and 20 mg of the product obtained in step 3) in 1 mL of dichloromethane. Heat at 45°C for about 6 h, filter, and evaporate to obtain a brown oil.

[0014] The long-circulating itaconic acid derivative (ITA-I) of the present invention is prepared using itaconic anhydride as a precursor, and a long-acting itaconic acid derivative is obtained by modifying itaconic anhydride.

[0015] The long-circulating itaconic acid derivative (ITA-I) described in the present invention has been shown to have excellent inhibitory effects on macrophage inflammatory responses through experiments on the inhibition of pro-inflammatory factors in macrophages. A sepsis mouse model has been used to confirm that the long-circulating itaconic acid derivative (ITA-I) has better therapeutic effects than ITA, solving the problem of low clinical efficiency of ITA.

[0016] The long-circulating itaconic acid derivative (ITA-I) of the present invention can be prepared into pharmaceutical preparations such as powders, oral liquids, granules, tablets, capsules, and pills.

[0017] The long-circulating itaconic acid derivative (ITA-I) of the present invention may further be added with conventional pharmaceutically acceptable excipients.

[0018] The positive effects of the present invention are:

[0019] Provided are a long-circulating itaconic acid derivative (ITA-I) and its preparation method. This novel compound exhibits a longer circulation time than ITA and excellent biosafety, addressing the issue of rapid itaconic acid metabolism leading to low clinical treatment efficiency. It has promising applications in the prevention and treatment of sepsis, providing a novel material for the treatment of sepsis. The ITA-I of the present invention effectively inhibits inflammatory cell infiltration in sepsis models, addressing the issue of low clinical treatment efficiency of ITA. It has promising applications in sepsis treatment, providing a novel drug for the treatment of sepsis. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 , is the nuclear magnetic resonance hydrogen spectrum of the long-circulation itaconic acid derivative (ITA-I) of the present invention

[0021] Figure 2 , is a carbon NMR spectrum diagram of the long-circulating itaconic acid derivative (ITA-I) of the present invention;

[0022] Figure 3 , is the blood drug concentration-time curve of the drug injected into the tail vein of mice of the present invention;

[0023] Figure 4 , is a schematic diagram showing the effect of ITA-I of the present invention on the survival of RAW264.7 cells at different concentrations;

[0024] Figure 5 , is a schematic diagram of the inhibitory effects of ITA and ITA-I of the present invention on activated macrophage inflammation in vitro;

[0025] Figure 6 , are the effects of ITA and ITA-I of the present invention on the survival rate of sepsis model mice;

[0026] Figure 7 , are the biochemical test results of the anti-inflammatory effects of ITA and ITA-I of the present invention in a mouse sepsis model;

[0027] Figure 8 , are the histological section results of the anti-inflammatory effects of ITA and ITA-I of the present invention in a mouse sepsis model. DETAILED DESCRIPTION

[0028] The present invention is further described by way of examples through the following embodiments, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any changes or modifications to the present invention that are easily implemented by a person of ordinary skill in the art will fall within the scope of the claims of the present invention.

[0029] Example 1

[0030] 1. Add 1.45 g of 4-(p-iodophenyl)butyric acid (MW = 290.10 g / mol), 1.9 g of 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (MW = 380.24 g / mol) and 5 ml of dichloromethane and react at room temperature under nitrogen for 1 h.

[0031] 2. Dissolve 1.2 g of Fmoc-Lys-OMe.HCl (MW = 418.91 g / mol) and 1.29 g of N,N-diisopropylethylamine (MW = 129.24 g / mol) in 5 ml of dichloromethane and add dropwise to the liquid obtained in step 1) with constant stirring overnight. Rotary evaporate the resulting yellow oil to obtain the product.

[0032] 3. Take 100 mg of the product from step 2), add 40 μl of piperidine and 1.5 ml of methanol, and heat at 40°C under nitrogen for 6-8 h. The resulting yellow oily product is dried, extracted, and passed through a column chromatography column. Confirm the product by spotting. Dissolve in ether and dry to obtain a white solid.

[0033] 4. Dissolve 6.5 mg of itaconic anhydride (MW = 112 g / mol) and 20 mg of the product obtained in step 3) in 1 mL of dichloromethane. Heat at 45°C for about 6 h, filter, and evaporate to obtain a brown oily liquid, named: long-circulating itaconic acid derivative (ITA-I). Its H NMR spectrum is as follows: Figure 1~Figure 2 As shown: 1 H NMR (400 MHz, CDCl3) δ 7.62 – 7.56 (m, 2H), 6.95 – 6.90 (m, 2H), 6.64 – 6.33 (m, 2H), 5.98 – 5.80 (m, 2H), 3.76 – 3.70(m, 3H), 3.39 – 3.11 (m, 4H), 2.64 – 2.57 (m, 2H), 2.24 – 2.18 (m, 2H), 1.97 – 1.93 (m, 2H), 1.87 – 1.65 (m, 2H), 1.53 – 1.39 (m, 2H), 1.36 – 1.20 (m,2H). 13 C NMR (100 MHz, CDCl3) δ8. The 24-hour mark is 174.24, 172.90, 170.50, 169.41, 141.38, 137.64,134.67, 130.87, 130.49 , 91.26, 52.72, 52.09, 40.50, 39.50, 35.89, 34.91,31.83, 28.99, 27.18, 22.36.

[0034] Reaction formula of the present invention is:

[0035]

[0036]

[0037] ;

[0038] The structural formula of the long-circulating itaconic acid derivative (ITA-I) of the present invention is:

[0039] ;

[0040] Molecular formula: C 22 H 29 IN2O6 molecular weight: 544.

[0041] The medical application of the present invention is demonstrated by the following experimental examples:

[0042] Experimental Example 1 Blood concentration-time curve of the drug of the present invention

[0043] After the mice were injected with itaconic acid (ITA-I) via tail vein, blood samples were collected at 1h, 2h, 4h, 8h, 12h, 18h, 24h, and 36h, and the drug concentration in plasma was determined by high performance liquid chromatography. The blood drug concentration-time curve was drawn (see Figure 3 ).

[0044] Experimental Example 2, Biosafety Evaluation of ITA-I of the Present Invention

[0045] In vitro cytotoxicity assessment was performed by culturing Raw264.7 macrophages in DMEM high-glucose medium supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere containing 5% CO₂. Raw264.7 cells were seeded at a density of 5,000 cells per well in 96-well cell culture plates for 24 hours. They were then exposed to various concentrations of ITA-I solution. After 24 and 48 hours of incubation, the cells were gently rinsed with phosphate-buffered saline (PBS), and 110 μL of a solution of fresh culture medium mixed with CCK-8 (NCMBiotech, China) at a 10:1 (v / v) ratio was carefully dispensed into each well. After an additional 2-hour incubation period, the absorbance of each well at a wavelength of 450 nm was recorded using an enzyme-linked immunosorbent assay (ELISA).

[0046] The results of CCK-8 assay showed that 5mM ITA-I did not affect the viability of RAW264.7 cells within 24 hours. As time went on, the biosafety concentration decreased to 3mM, which showed better biocompatibility. The safe concentration range of ITA-I (0-3mM) was screened out, which was helpful for the subsequent biological performance testing (see Figure 4 ).

[0047] Experimental Example 3, Inhibitory Effect of ITA-I on Proinflammatory Factors in Macrophages

[0048] Test 1: Effects of ITA-I and ITA on the gene expression of proinflammatory factors IL-6, IL-1β, and TNF-α in RAW264.7 cells.

[0049] Raw264.7 cells were cultured at 2×10 5 Each well was seeded with 5% FBS conditioned medium and incubated for 24 hours at 37°C in a humidified atmosphere containing 5% CO₂. ITA-I medium and 2mM ITA medium were prepared using 10% FBS high-glucose medium. The medium in the 6-well plates was replaced with the conditioned medium from each group and then cultured for an additional 2 hours. RAW264.7 cells were then stimulated with LPS (10 μg / mL) for 24 hours.

[0050] RNA extraction and detection: Wash the six-well plates with pre-chilled PBS. Then, add 1 mL of Trizol per 1 mL of the six-well plate. Collect the cells into 1.5 mL enzyme-free centrifuge tubes. Add 200 μL of chloroform to each tube, mix by inversion for 15 seconds, and centrifuge at 12,000 g for 15 minutes at 4°C. Carefully transfer the supernatant to another enzyme-free centrifuge tube, add 0.5 mL of isopropanol, shake, and incubate at room temperature for 10 minutes. Centrifuge at 12,000 g for 10 minutes at 4°C until a white precipitate is visible at the bottom of the EP tube. Discard the supernatant, add 1 mL of absolute ethanol, shake, and thoroughly wash the precipitate. Centrifuge at 7,500 g for 5 minutes at 4°C. Aspirate the ethanol, air-dry until the RNA becomes translucent, add 30 μL of enzyme-free water, and mix thoroughly by pipetting. The extracted total RNA was assayed for RNA content and purity using a Nanodrop. The absorbance ratio at 260 / 280 nm for all samples should be between 1.8 and 2.0. The total amount of RNA was 1000 ng and reverse transcribed according to the instructions.

[0051] Primer sequences:

[0052] IL-1β F TGAATTGGTCATAGCCCGCA;

[0053] IL-1β RTCCTCCTTCCTGTGCAAACTCT;

[0054] IL-6 F TCCTACCCCAATTTCCAATGCT;

[0055] IL-6 R AACGCACTAGGTTTGCCGAG;

[0056] β-actin F CATCCGTAAGACCTCTAGCCAAC;

[0057] β-actin R ATGGAGCCACCGATCCACA;

[0058] TNF-α F ACTCCAGGCGGTGCCTATGT;

[0059] TNF-α R GTGAGGGTCTGGGCCATAGAA.

[0060] Prepare primers: Prepare forward and reverse primers separately in TE buffer to a 100 μM stock solution. Dilute to a 5 μM working solution in RNase-free water at the start of PCR. Detect RNA levels according to the Roche SYBR GREEN kit instructions.

[0061] The results are as follows Figure 5As shown, LPS (10 μg / mL) successfully activated RAW264.7 cells, significantly upregulating the expression of pro-inflammatory genes IL-6, IL-1β, and TNF-α (P<0.05). Within a safe concentration, ITA-I significantly downregulated the gene expression of pro-inflammatory factors IL-6, IL-1β, and TNF-α in activated RAW264.7 cells in a concentration-dependent manner.

[0062] Experimental Example 4 Effect of ITA-I in Treating Sepsis in Vivo

[0063] C57 mice (8-11 weeks old) were randomly divided into four groups, 10 in each: ① control group, ② sepsis + PBS group, ③ sepsis + ITA group, and ④ sepsis + ITA-I group. A sepsis model was established by intraperitoneal injection of LPS, followed by tail vein injection of the respective drugs. Survival rates were calculated at 12, 48, 36, and 48 hours, and clinical indices were assessed. After 48 hours, eyeballs were bled, and the mice were euthanized by overdose of anesthesia for specimen collection.

[0064] Whole blood was stored at room temperature for 2 hours and incubated at 4°C overnight to shrink the blood clots and increase serum precipitation. The supernatant was collected and centrifuged at 3000 rpm for 15 minutes at 4°C to obtain plasma samples. The activity of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) was measured by biochemical methods to quantify the degree of liver damage, and the expression of inflammatory factors such as IL-6 and IL-1β in serum was measured by cell biological methods. The results are shown in Figure 2. Figure 6 、 7 As shown in the data, the release of proinflammatory cytokines IL-1β and IFN-α in the LPS group was significantly increased, and the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher than those in the blank control group. However, the levels of IL-1β and IFN-α in the ITA-I treatment group were significantly lower than those in the LPS group, and even lower than those in the ITA group. AST showed similar change trends as AST.

[0065] Results: ITA-I has significant anti-inflammatory properties and has a significant therapeutic effect on sepsis in mice.

[0066] The tissues and organs were fixed with 4% paraformaldehyde, dehydrated step by step, and histologically stained to evaluate the pathological damage of the important organs of the rats. Figure 8As shown, the control group showed normal cell behavior and no inflammatory cell infiltration. In contrast, the hepatocytes in the LPS group displayed significant vesicular and fatty degeneration, with enlarged nuclei, darker staining, shrunken cytoplasm, nuclear and cytoplasmic separation, and infiltration by numerous inflammatory cells. There was also glomerular pyknosis, thickened alveolar walls, and blurred splenic cortical and medullary boundaries, with numerous apoptotic cells. In contrast, the ITA-I-treated group significantly ameliorated these pathological changes, resembling those in the blank control group. The pathological findings of these major organs provide sufficient support for the structural and functional recovery of organs after ITA-I treatment for sepsis.

[0067] Please refer to the attached Figure 1-8 The present invention successfully synthesized ITA-I, a long-circulating itaconic acid derivative modified with 4-(p-iodophenyl)butyl, with good in vitro cellular biosafety within the range of 0-3 mM. In an in vitro inflammatory cell model, ITA-I exhibited similar inhibitory effects on IL-1β, IL-6, and TNF-α as ITA at the same concentration, demonstrating its potent anti-inflammatory properties. In a mouse model of sepsis induced by intraperitoneal injection of LPS, ITA-I significantly reduced tissue inflammatory cell infiltration and serum levels of inflammatory factors, demonstrating superior therapeutic efficacy compared to ITA. This addresses the low clinical efficacy of ITA and provides a new drug for the prevention and treatment of sepsis.

Claims

1. A 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative, characterized in that It has the following structural formula: ； Molecular formula: C 22 H 29 IN2O6 molecular weight:

544.

2. A method for preparing a 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative as claimed in claim 1, comprising the following steps: ① Combine 1.45 g of 4-(p-iodophenyl)butyric acid (290.10 g / mol), 1.9 g of 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (380.24 g / mol), and 5 ml of dichloromethane and react at room temperature under nitrogen for 1 hour. ② Dissolve 1.2 g of Fmoc-Lys-OMe.HCl (418.91 g / mol) and 1.29 g of N,N-diisopropylethylamine (129.24 g / mol) in 5 ml of dichloromethane. Add the resulting mixture dropwise to the liquid obtained in step 1. Stir continuously overnight to obtain the product by rotary evaporation. ③ Take 100 mg of product ②, add 40 μl of piperidine and 1.5 ml of methanol, and heat at 40°C under nitrogen for 6-8 h. The resulting yellow oily product is dried, extracted, and passed through a column. Confirm the product by spotting. Dissolve in ether and dry to obtain a white solid. ④ Dissolve 6.5 mg of itaconic anhydride (112 g / mol) and 20 mg of the product obtained in ③ in 1 mL of dichloromethane. Heat at 45°C for 6 h, filter, and evaporate to obtain a brown oil.

3. Medical use of a long-circulating itaconic acid derivative modified with a 4-(p-iodophenyl)butyl group as claimed in claim 1 in the preparation of drugs for preventing and treating infections.

Images