Preparation method of anti-human TNF (Tumor Necrosis Factor) alpha egg yolk antibody

Abstract

The invention discloses a preparation method of an anti-human TNF (Tumor Necrosis Factor) alpha egg yolk antibody. Relates to the technical field of biomedicine. The invention provides a sequence of the fusion protein, an egg yolk antibody and application. The fusion protein provided by the invention is constructed by combining a human TNF alpha sequence and an IgY Fc fragment, and efficient production is realized through a pichia pastoris expression system. The specific egg yolk antibody aiming at the human TNF alpha protein is generated by adopting an immune laying hen technology. The anti-TNF alpha egg yolk antibody prepared by the invention is expected to be converted into various clinical application forms by virtue of an innovative preparation process and excellent affinity, occurrence and development of inflammatory diseases are effectively inhibited and relieved, and a new biomedical solution is provided for diagnosis and treatment of the inflammatory diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and more particularly to a method for preparing an anti-human TNFα egg yolk antibody. Background Art

[0002] In the complex network of inflammatory diseases, tumor necrosis factor α (TNFα) plays a key regulatory role as a core mediator, especially in pathological processes such as autoimmune diseases, rheumatoid arthritis and inflammatory bowel disease. TNFα plays an important role in local and systemic inflammatory responses by upregulating the expression of adhesion molecules on the surface of leukocytes, promoting the migration and infiltration of immune cells to the site of inflammation, and activating vascular endothelial cells. At present, inflammation is mainly suppressed by antibiotic therapy, but long-term or improper use of antibiotics can cause bacteria to develop drug resistance, making the originally effective antibiotics ineffective, and antibiotics not only kill harmful bacteria, but may also destroy the normal flora of the corresponding parts, leading to dysbiosis. Therefore, it is possible to consider using antibody therapy to accurately act on diseased cells, reduce damage to normal cells, and reduce side effects.

[0003] The preparation of antibodies needs to consider the titer of antibodies. In order to obtain high-affinity antibodies, the current method of immunizing with Fc fusion antigens as vaccines can be used. Fc fusion protein refers to a new type of protein produced by fusing a functional protein molecule with biological activity with an Fc fragment using genetic engineering technology, wherein the functional protein can be a soluble ligand (or receptor) molecule that can bind to an endogenous receptor (or ligand), or other active substances that need to extend the half-life. Through this fusion strategy, the affinity and stability of antibodies can be significantly improved, thereby enhancing their application potential in immunotherapy and vaccine development. This type of fusion protein not only retains the biological activity of the functional protein molecule, but also has some properties of antibodies. Fc fusion protein significantly extends the half-life of the protein in the body by binding to its receptor in the Fc region. In an acidic environment, Fc interacts with the receptor to form a stable complex, which delays the degradation of the protein by the lysosome. Fc fusion protein can also be used as a new vaccine form to fuse part of the antigenic peptide of the pathogen with the Fc fragment to induce the body to produce an antigen-specific immune response.

[0004] In addition, the technology for preparing yolk antibodies has developed rapidly and has shown great potential for application in the medical field. Compared with conventional mammalian IgG antibody preparation methods, IgY technology not only has obvious advantages in animal rights protection, but also performs well in terms of economy and feasibility of large-scale application. The technology for preparing yolk antibodies has also shown great potential in the development of new drugs.

[0005] At present, there is no strategy of fusing IgY Fc with antigen protein or peptide as a highly immune antigen and applying it to the preparation of egg yolk antibodies.

[0006] Therefore, whether it is possible to provide a method for preparing anti-human TNFα egg yolk antibody is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0007] In view of this, the present invention provides a method for preparing an anti-human TNFα yolk antibody, including the design and construction of TNFα-IgY Fc antigen and the preparation method of its specific yolk antibody. The antigen protein fused with Fc can enhance the efficiency of antigen presentation in vivo, promote the activation and proliferation of immune cells, and thus induce a stronger humoral immune response.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] A method for preparing a fusion protein TNFα-IgY-Fc comprises: fusing and expressing the C-terminus of a TNFα fragment with an IgY-Fc gene fragment;

[0010] The nucleotide sequence of the TNFα fragment is shown in SEQ ID No.2; the nucleotide sequence of the IgY Fc fragment is shown in SEQ ID No.3.

[0011] The present invention also provides a recombinant plasmid, comprising the C-terminus of the TNFα fragment fused with the IgY-Fc gene fragment and the tag gene in sequence.

[0012] Preferably: the recombinant plasmid is pPICZαA-TNFα-IgY-Fc-Flag-6×His;

[0013] The nucleotide sequence of TNFα-IgY-Fc-Flag-6×His fragment is shown in SEQ ID No. 1;

[0014] The nucleotide sequence of the TNFα fragment is shown in SEQ ID No. 2;

[0015] The nucleotide sequence of IgY Fc fragment is shown in SEQ ID No. 3;

[0016] The nucleotide sequence of the Flag tag gene is shown in SEQ ID No. 4;

[0017] The nucleotide sequence of the His gene is shown in SEQ ID No.5.

[0018] The present invention also provides a recombinant bacterium prepared by using the recombinant plasmid.

[0019] The present invention also provides a method for preparing an anti-human TNFα egg yolk antibody, comprising the following steps:

[0020] (1) Expression of TNFα-IgY Fc protein: The above recombinant plasmid was used as a PCR template, and the linear plasmid was recovered by PCR reaction, transformed into Pichia pastoris competent cells, and cultured until the OD was 10. 1% methanol was added to induce protein expression, and cultured for 48 to 96 hours, wherein methanol was added every 24 hours for induction; the bacterial solution was centrifuged and the supernatant was collected;

[0021] (2) Purification of TNFα-IgY Fc protein: The supernatant was passed through a column, and impurities were first removed with an equilibration buffer, and then the TNFα-IgY Fc protein was eluted with an elution buffer, concentrated, and sieved to obtain the TNFα-IgY Fc protein;

[0022] (3) Antigen vaccination: TNFα protein and adjuvant are mixed in a volume ratio to prepare an oil-in-water emulsified antigen; laying hens are immunized and immune eggs are collected;

[0023] (4) Extraction and purification of anti-TNFα egg yolk antibodies: prepare egg yolk dilution from immune eggs, centrifuge the egg yolk dilution to obtain the supernatant, extract and purify the egg yolk antibodies using a saturated ammonium sulfate precipitation method, dissolve the obtained egg yolk antibodies in a buffer solution, dialyze, and filter to obtain anti-TNFα egg yolk antibodies.

[0024] Preferably, step (1) is specifically:

[0025] The recombinant plasmid pPICZαA-TNFα-IgY-Fc-Flag-6×His was used as a PCR template, and the linear plasmid was recovered by PCR reaction, transformed into Pichia pastoris competent cells, and spread on a plate containing bleomycin resistance, cultured, and after a single colony grew out, a qualified single colony was picked and inoculated into BMGY medium, and then transferred to BMMY medium, cultured until OD was 10, and 1% methanol was added to induce protein expression, cultured for 72 hours, and methanol was added every 24 hours for induction;

[0026] PCR primers: F1 sequence is CGCTCATTCCAATTCCTTCTATTAGGCTAC, as shown in SEQ ID No. 6;

[0027] The sequence of R1 is AGCTCCAATCAAGCCCAATAACTGGGCTGG, as shown in SEQ ID No. 7;

[0028] Step (2) is specifically: passing the supernatant through Ni +The column was firstly treated with an equilibration buffer, which consisted of 20 mM Tirs, 300 mM NaCl, 40 mM imidazole, pH = 8.0, to remove foreign proteins, and then eluted with an elution buffer, which consisted of 20 mM Tirs, 300 mM NaCl, 400 mM imidazole, pH = 8.0, to elute and collect the TNFα-IgY Fc protein, and the TNFα-IgY Fc protein was concentrated with a 0.22 μM ultrafiltration tube, and filtered through a Superdex 200 Increase 10 / 300 GL molecular sieve to obtain the TNFα-IgY Fc protein;

[0029] Step (3) mixing the obtained TNFa-IgY Fc protein with MONTANIDE TM ISA 71VG adjuvant was mixed at a volume ratio of 3:7, and stirred at high speed on ice by a stirrer until fully emulsified. The emulsified TNFa-IgY Fc antigen in the form of oil-in-water was injected into the subthorax muscle of laying hens. The immunization was performed three times in total, with an interval of two weeks between each immunization and the same immunization dose. After the first immunization, immune eggs were collected, and the antigen inoculation dose was 100-400 μg / hen.

[0030] Step (4) is specifically as follows: preparing an egg yolk dilution from immune eggs, centrifuging the egg yolk dilution at 8000 rpm for 10 minutes, discarding the precipitate, slowly adding an equal volume of saturated ammonium sulfate solution to the supernatant, stirring continuously during the addition process, continuing to stir and mix for 10 minutes after all the solution is added, leaving it at 4°C overnight, centrifuging the mixture, discarding the supernatant, resuspending the precipitate with 33% ammonium sulfate of half the volume of the supernatant, stirring for 10 minutes, leaving it at 4°C overnight for 30 minutes, then centrifuging at 8000 rpm for 10 minutes, discarding the supernatant, resuspending the precipitate with PBS to obtain an egg yolk antibody suspension, dialyzing the antibody at 4°C for 48 hours, filtering with a filter membrane, and obtaining an anti-TNFα egg yolk antibody.

[0031] The present invention also provides the use of the above preparation method, the above recombinant plasmid or the above recombinant bacteria in preparing egg yolk antibodies.

[0032] The present invention also provides the use of the anti-human TNFα yolk antibody prepared by the above preparation method in pharmaceuticals or medical supplies.

[0033] It can be seen from the above technical scheme that, compared with the prior art, the present invention discloses a method for preparing an anti-human TNFα egg yolk antibody, and the technical effects achieved are:

[0034] The fusion protein is constructed by combining the human TNFα sequence with the IgY Fc fragment, that is, by genetically fusing the C-terminus of TNFα with the Fc region of IgY, a recombinant TNFα-IgY Fc protein is obtained through a yeast expression system, and it is used as an immune antigen. The specific egg yolk antibody against the human TNFα protein is generated by immunizing laying hens. With its unique biological characteristics and economic advantages, it is expected to play a role in the prevention and treatment of TNFα-mediated inflammatory diseases and significantly improve the titer of the egg yolk antibody. Among them, the method of preparing egg yolk antibodies by using Fc fusion human TNFα protein as an antigen is developed. The Fc fusion protein can form a stable dimer or even a hexameric complex through the disulfide bond of the Fc hinge region, which increases the stability of the molecule; the Fc region can be folded independently, further ensuring the stability of the molecule; at the same time, the present invention adopts the method of fusing IgY Fc to human TNFα protein to obtain an effective antigen protein, which helps to increase the half-life of the antigen protein in the body, and also provides an innovative means for preparing high-titer egg yolk antibodies. Through the immune enhancement characteristics of the IgY Fc region, a stronger specific antibody response can be induced in animals.

[0035] Pichia pastoris was selected as the expression system for preparing TNFα-IgY Fc protein, mainly based on its simple genetic manipulation and excellent characteristics of the expression vector; Pichia pastoris has the ability to efficiently secrete exogenous proteins, and the proportion of exogenous proteins secreted to the extracellular space can account for about 80% of the total protein in the culture medium; in addition, Pichia pastoris secretes less endogenous protein, which significantly simplifies the separation and purification process of the target protein and provides greater operational convenience for subsequent preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0037] Figure 1 The accompanying drawings are SDS-PAGE results of the TNFα-IgY Fc protein provided by the present invention, wherein 1 is a marker, 2 is the TNFα-IgY Fc protein purified by induction for 24 hours in Comparative Example 1, 3 is the TNFα-IgY Fc protein purified by induction for 48 hours in Example 1, 4 is the TNFα-IgY Fc protein purified by induction for 72 hours in Example 2, and 5 is the TNFα-IgY Fc protein purified by induction for 96 hours in Example 3.

[0038] Figure 2The accompanying drawing is a diagram showing the SDS-PAGE results of the anti-TNFα egg yolk antibody provided by the present invention, wherein 1 is a marker, and 2 is an SDS-PAGE band of the egg yolk antibody extracted after immunization with TNFα-IgY Fc protein.

[0039] Figure 3 The accompanying drawing is a graph showing the titer results of the ELISA assay of the egg yolk antibody provided by the present invention. DETAILED DESCRIPTION

[0040] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] The embodiment of the present invention discloses a method for preparing an anti-human TNFα egg yolk antibody.

[0042] Example 1

[0043] TNFα-IgY Fc protein preparation:

[0044] The pPICZαA-TNFα-IgY-Fc-Flag-6×His recombinant plasmid was synthesized and constructed by Suzhou Junji Biotechnology Co., Ltd. TNFα-IgY-Fc-Flag-6×His fragment (nucleotide sequence: GTGCGTAGCAGCAGCG T GCG T AGCAGCAGCCGCACCCCGAGCGA T AAACCGG T GGCGCACG T GG T GGCGAAC

[0045] ) and 6×His gene (nucleotide sequence: CATCATCATCATCATCATCAT, as shown in SEQ ID No.5), with two restriction sites KpnI and NotI at both ends of the fragment, and the sequence GGAAGTGGCTCA as the linker.

[0046] Expression of TNFα-IgY Fc Protein:

[0047] The recombinant plasmid pPICZαA-TNFα-IgY-Fc-Flag-6×His was used as a PCR template. The PCR reaction system and reaction procedure are shown in Tables 1-2. The sequence of the primer F1 used in PCR is

[0048] CGCTCATTCCAATTCCTTCTATTAGGCTAC, as shown in SEQ ID No.6, and primer R1 is AGCTCCAATCAAGCCCAATAACTGGGCTGG, as shown in SEQ ID No.7; Recover the linear plasmid, transform the Pichia pastoris competent state, spread it on a plate containing bleomycin resistance, and place it in a 30°C incubator for 24 hours. After a single colony grows out, pick a single colony for colony PCR to verify whether the gene is introduced into the yeast cell genome. The specific PCR reaction system and reaction procedure are shown in Tables 3-4 below. The primer F2 sequence used in PCR is AGCGATAGCGAAGTGAACCAAGAA, and the primer R2 is CCTGCAGAAGCAAGCCGGTAAA. The single colony with the correct PCR verification result is inoculated into 10mL of BMGY medium, and after culturing overnight, it is transferred to 1L of BMMY medium, cultured at 30°C until the OD is 10, and 1% methanol is added to induce protein expression, cultured for 48 hours, and methanol is added every 24 hours for induction;

[0049] Table 1. PCR reaction system

[0050]

[0051] Table 2. PCR reaction program

[0052]

[0053] Table 3. PCR reaction system

[0054]

[0055] Table 4. PCR reaction program

[0056]

[0057] The bacterial solution was centrifuged at 8000 rpm for 10 minutes and the supernatant was collected;

[0058] Purification of TNFα-IgY Fc protein:

[0059] The supernatant was passed through Ni + The column was firstly used to remove impurities with an equilibrium buffer (20mM Tirs, 300mM NaCl, 40mM imidazole, pH=8.0), and then the TNFα-IgY Fc protein was eluted and collected with an elution buffer (20mM Tirs, 300mM NaCl, 400mM imidazole, pH=8.0). The TNFα-IgY Fc protein was concentrated with a 0.22μM ultrafiltration tube and passed through a Superdex 200Increase10 / 300GL molecular sieve to finally obtain a high-purity TNFα-IgY Fc protein. SDS-PAGE was performed. The final SDS-PAGE gel results are attached. Figure 1 Lane 3, the results showed that the theoretical molecular weight of TNFa-IgY Fc protein was about 75KDa, which was consistent with the SDS-PAGE gel band, proving that TNFα-IgY Fc protein was expressed after 48h of induction in the yeast system.

[0060] Example 2

[0061] The same as Example 1, except that in the expression step of TNFα-IgY Fc protein, 1% methanol was added for induction when the OD was 10, and the induction was performed every 24 hours. After culturing for 72 hours, the supernatant was collected by centrifugation.

[0062] The final SDS-PAGE gel results are attached. Figure 1 Lane 4, the results showed that the theoretical molecular weight of TNFa-IgY Fc protein was about 75KDa, which was consistent with the SDS-PAGE gel band, proving that the content of TNFα-IgY Fc protein expressed in the supernatant after 72h of induction with the yeast system was higher than that after 48h of induction.

[0063] Example 3

[0064] The same as Example 1, except that in the expression step of TNFα-IgY Fc protein, 1% methanol was added for induction when the OD was 10, and the induction was performed every 24 hours. After 96 hours of culture, the supernatant was collected by centrifugation.

[0065] The final SDS-PAGE gel results are attached. Figure 1 Lane 5, the results showed that the theoretical molecular weight of TNFa-IgY Fc protein was about 75KDa, which was consistent with the SDS-PAGE gel band, proving that the content of TNFα-IgY Fc protein expressed in the supernatant after 96h of induction in the yeast system was lower than that after 72h of induction.

[0066] Comparative experiment

[0067] To investigate the effect of culture time on the expression and purification of TNFα-IgY Fc protein

[0068] Comparative Example 1: The only difference from Example 1 is that in the expression step of TNFα-IgY Fc protein, 1% methanol was added for induction when the OD was 10, and after 24 hours of induction, the supernatant was collected by centrifugation.

[0069] The final SDS-PAGE gel results are attached. Figure 1 Lane 2: The results show that TNFa-IgY Fc did not begin to be expressed in large quantities at 24 h of induction in the yeast expression system.

[0070] Example 4

[0071] The obtained 200 μg TNFa-IgY Fc protein (prepared in Example 2) was mixed with MONTANIDE TM ISA 71VG adjuvant was mixed in a volume ratio of 3:7 and stirred at high speed on ice by a stirrer until fully emulsified. The emulsified TNFa-IgY Fc antigen (in oil-in-water form) was inoculated into the subthorax muscle of laying hens for three immunizations, each with a two-week interval and a consistent immunization dose. After the first immunization, immune eggs were collected and stored in a 4°C refrigerator.

[0072] Extraction of anti-TNFα egg yolk antibody

[0073] First, wipe and disinfect the surface of the egg with 75% alcohol, crack the egg gently, discard the egg white with an egg yolk separator, pierce the yolk membrane with tweezers, collect the egg yolk, add ten times the volume of distilled water to dilute the egg yolk, stir with a magnetic stirrer for 10 minutes, then adjust the pH to 5.2, place at 4°C overnight, centrifuge the egg yolk dilution at 8000 rpm for 10 minutes, discard the precipitate, and slowly add an equal volume of saturated ammonium sulfate solution to the supernatant, stirring continuously during the addition process, and continuing to stir and mix for 10 minutes after all the addition is completed, place at 4°C overnight, centrifuge the mixture, discard the supernatant, resuspend the precipitate with 33% ammonium sulfate of half the volume of the supernatant, stir for 10 minutes, place at 4°C overnight for 30 minutes, then centrifuge at 8000 rpm for 10 minutes, discard the supernatant, resuspend the precipitate with PBS to obtain an egg yolk antibody suspension, dialyze the antibody at 4°C for 48 hours, filter with a filter membrane, and determine the antibody concentration by the BCA method.

[0074] See attached Figure 2The SDS PAGE results of the extracted anti-TNFa egg yolk antibody showed that the theoretical molecular weight of the heavy chain of the egg yolk antibody was 60-70KDa, and the theoretical molecular weight of the light chain was 20-30KDa, which was consistent with the band size of SDS PAGE, proving that the anti-TNFa egg yolk antibody (egg yolk antibody immune to TNFα-IgY Fc) was successfully obtained.

[0075] Example 5

[0076] Detection of Anti-TNFα Yolk Antibody Titer

[0077] Divided into 3 groups:

[0078] Yolk antibody for TNFα-IgY Fc immunity (group): TNFα protein (induction culture parameters are the same as those in Example 2) was added to a 96-well plate at 200 μg / well and coated at 4°C overnight;

[0079] The TNFα protein mixture in the 96-well plate was discarded, and the plate was washed three times with PBS for 5 minutes each time. 100 μl of BSA blocking solution was added to each well of the 96-well plate and incubated at 37°C for 1 hour;

[0080] Discard the blocking solution and add the diluted anti-TNFα egg yolk antibody (primary antibody): dilute the anti-TNFα egg yolk antibody to an initial concentration of 10 mg / mL, and dilute the egg yolk antibody with the blocking solution in a 4-fold ratio, namely 1:1; 1:4; 1:16; 1:64; 1:256; 1:1024; 1:4096; 1:16384; 1:65536 and 1:262144, with a total of 10 dilutions. Add the diluted primary antibody to a 96-well plate and incubate at 37°C for 1 hour;

[0081] The primary antibody was discarded, the plate was washed three times with PBST, each wash was 5 min, HRP-Anti IgY secondary antibody (1:10000) was added, and incubated at 37°C for 1 h;

[0082] The plate was washed three times with PBST, each time for 5 minutes, and then 50 μl of TMB single-component colorimetric solution was added to each well, followed by 50 μl of stop solution to terminate the reaction, and the plate was read with an enzyme-labeled instrument to analyze the titer of the egg yolk antibody.

[0083] Yolk antibody for TNFα immunity (group): TNFα protein (induction culture parameters are the same as those in Example 2) was added into a 96-well plate at 200 μg / well and coated at 4°C overnight;

[0084] The TNFα protein mixture in the 96-well plate was discarded, and the plate was washed three times with PBS for 5 minutes each time. 100 μl of BSA blocking solution was added to each well of the 96-well plate and incubated at 37°C for 1 hour;

[0085] Discard the blocking solution and dilute the egg yolk antibody (primary antibody) obtained by immunizing TNFα protein: dilute the egg yolk antibody of immunizing TNFα to an initial concentration of 10 mg / mL, and dilute the egg yolk antibody with blocking solution in a 4-fold ratio, namely 1:1; 1:4; 1:16; 1:64; 1:256; 1:1024; 1:4096; 1:16384; 1:65536 and 1:262144, with a total of 10 dilutions. Add the diluted primary antibody to a 96-well plate and incubate at 37°C for 1 hour;

[0086] The primary antibody was discarded, the plate was washed three times with PBST, each time for 5 minutes, HRP-Anti IgY secondary antibody (1:10000) was added, and incubated at 37°C for 1 hour; the plate was washed three times with PBST, each time for 5 minutes, and then 50 μl of TMB single-component colorimetric solution was added to each well, and then 50 μL of stop solution was added to terminate the reaction, and the titer of the yolk antibody was analyzed by reading with an enzyme-labeled instrument.

[0087] Control group: TNFα protein (induction culture parameters are the same as those in Example 2) was added to a 96-well plate at 200 μg / well and coated at 4°C overnight;

[0088] The TNFα protein mixture in the 96-well plate was discarded, and the plate was washed three times with PBS for 5 minutes each time. 100 μl of BSA blocking solution was added to each well of the 96-well plate and incubated at 37°C for 1 hour;

[0089] Discard the blocking solution and dilute the egg yolk antibody (primary antibody) obtained from the non-immune antigen: dilute the anti-TNFα egg yolk antibody to an initial concentration of 10 mg / mL, and dilute the egg yolk antibody with the blocking solution in a 4-fold ratio, namely 1:1; 1:4; 1:16; 1:64; 1:256; 1:1024; 1:4096; 1:16384; 1:65536 and 1:262144, with a total of 10 dilutions. Add the diluted primary antibody to a 96-well plate and incubate at 37°C for 1 hour;

[0090] The primary antibody was discarded, the plate was washed three times with PBST, each wash was 5 min, HRP-Anti IgY secondary antibody (1:10000) was added, and incubated at 37°C for 1 h;

[0091] The plate was washed three times with PBST, each time for 5 minutes, and then 50 μl of TMB single-component colorimetric solution was added to each well, followed by 50 μl of stop solution to terminate the reaction, and the plate was read with an enzyme-labeled instrument to analyze the titer of the egg yolk antibody.

[0092] The results of ELISA testing for anti-TNFα egg yolk antibody titer are shown in the attached Figure 3The results showed that the titer of egg yolk antibodies in laying hens immunized with TNFα-IgY Fc was 1:1024, the titer of egg yolk antibodies in laying hens immunized with TNFα was 1:256, and the titer of egg yolk antibodies in the control group was 1:64, proving that the titer of egg yolk antibodies produced by laying hens immunized with TNFα-IgY Fc protein was higher than that produced by TNFα protein alone.

[0093] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0094] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for preparing a fusion protein TNFα-IgY-Fc, characterized in that: include: The C-terminus of the TNFα fragment was fused with the IgY-Fc gene fragment for expression; The nucleotide sequence of the TNFα fragment is shown in SEQ ID No.2; the nucleotide sequence of the IgY Fc fragment is shown in SEQ ID No.

3.

2. A recombinant plasmid, characterized in that: The C-terminus of the TNFα fragment is sequentially fused with the IgY-Fc gene fragment and the tag gene.

3. The recombinant plasmid according to claim 2, characterized in that: The recombinant plasmid is pPICZαA-TNFα-IgY-Fc-Flag-6×His; The nucleotide sequence of TNFα-IgY-Fc-Flag-6×His fragment is shown in SEQ ID No. 1; The nucleotide sequence of the TNFα fragment is shown in SEQ ID No. 2; The nucleotide sequence of IgY Fc fragment is shown in SEQ ID No. 3; The nucleotide sequence of the Flag tag gene is shown in SEQ ID No. 4; The nucleotide sequence of the His gene is shown in SEQ ID No.

5.

4. A recombinant bacterium prepared using the recombinant plasmid according to claim 2 or 3.

5. A method for preparing an anti-human TNFα egg yolk antibody, characterized in that: The following steps are involved: (1) Expression of TNFα-IgY Fc protein: The recombinant plasmid of claim 2 or 3 is used as a PCR template, the linear plasmid is recovered by PCR reaction, and the competent Pichia pastoris is transformed and cultured until the OD is 10, and 1% methanol is added to induce protein expression, and the culture is carried out for 48 to 96 hours, wherein methanol is added every 24 hours for induction; the bacterial solution is centrifuged and the supernatant is collected; (2) Purification of TNFα-IgY Fc protein: The supernatant was passed through a column, and impurities were first removed with an equilibration buffer, and then the TNFα-IgY Fc protein was eluted with an elution buffer, concentrated, and sieved to obtain the TNFα-IgY Fc protein; (3) Antigen vaccination: TNFα protein and adjuvant are mixed in a volume ratio to prepare an oil-in-water emulsified antigen; laying hens are immunized and immune eggs are collected; (4) Extraction and purification of anti-TNFα egg yolk antibodies: prepare egg yolk dilution from immune eggs, centrifuge the egg yolk dilution to obtain the supernatant, extract and purify the egg yolk antibodies using a saturated ammonium sulfate precipitation method, dissolve the obtained egg yolk antibodies in a buffer solution, dialyze, and filter to obtain anti-TNFα egg yolk antibodies.

6. The preparation method according to claim 5, characterized in that: Step (1) is specifically as follows: The recombinant plasmid pPICZαA-TNFα-IgY-Fc-Flag-6×His was used as a PCR template, and the linear plasmid was recovered by PCR reaction, transformed into Pichia pastoris competent cells, and spread on a plate containing bleomycin resistance, cultured, and after a single colony grew out, a qualified single colony was picked and inoculated into BMGY medium, and then transferred to BMMY medium, cultured until OD was 10, and 1% methanol was added to induce protein expression, cultured for 72 hours, and methanol was added every 24 hours for induction; The PCR primer: F1 sequence is CGCTCATTCCAATTCCTTCTATTAGGCTAC, as shown in SEQ ID No.6; The sequence of R1 is AGCTCCAATCAAGCCCAATAACTGGGCTGG, as shown in SEQ ID No. 7; Step (2) is specifically: passing the supernatant through Ni + The column was firstly treated with an equilibration buffer, which consisted of 20 mM Tirs, 300 mM NaCl, 40 mM imidazole, pH = 8.0, to remove foreign proteins, and then eluted with an elution buffer, which consisted of 20 mM Tirs, 300 mM NaCl, 400 mM imidazole, pH = 8.0, to elute and collect the TNFα-IgY Fc protein, and the TNFα-IgY Fc protein was concentrated with a 0.22 μM ultrafiltration tube, and passed through a Superdex 200Increase 10 / 300GL molecular sieve to obtain the TNFα-IgY Fc protein; Step (3) mixing the obtained TNFa-IgY Fc protein with MONTANIDE TM ISA 71VG adjuvant was mixed at a volume ratio of 3:7, and stirred at high speed on ice by a stirrer until fully emulsified. The emulsified TNFa-IgY Fc antigen in the form of oil-in-water was injected into the subthorax muscle of laying hens. The immunization was performed three times in total, with an interval of two weeks between each immunization and the same immunization dose. After the first immunization, immune eggs were collected, and the antigen inoculation dose was 100-400 μg / hen. Step (4) is specifically as follows: preparing an egg yolk dilution from immune eggs, centrifuging the egg yolk dilution at 8000 rpm for 10 minutes, discarding the precipitate, slowly adding an equal volume of saturated ammonium sulfate solution to the supernatant, stirring continuously during the addition process, continuing to stir and mix for 10 minutes after all the solution is added, leaving it at 4°C overnight, centrifuging the mixture, discarding the supernatant, resuspending the precipitate with 33% ammonium sulfate of half the volume of the supernatant, stirring for 10 minutes, leaving it at 4°C overnight for 30 minutes, then centrifuging at 8000 rpm for 10 minutes, discarding the supernatant, resuspending the precipitate with PBS to obtain an egg yolk antibody suspension, dialyzing the antibody at 4°C for 48 hours, filtering with a filter membrane, and obtaining an anti-TNFα egg yolk antibody.

7. Use of the preparation method according to claim 1, the recombinant plasmid according to claims 2 and 3, or the recombinant bacteria according to claim 4 in the preparation of egg yolk antibodies.

8. Use of the anti-human TNFα yolk antibody prepared by the preparation method of claim 5 or 6 in pharmaceuticals or medical supplies.

Images