A Bifidobacterium adolescentis, its cultivation method and its identification method

Abstract

The present invention discloses a Bifidobacterium adolescentis, its cultivation method and its identification method. Specifically, the present invention provides a Bifidobacterium adolescentis GSB03505 with a preservation number of CGMCC No. 32483, and the present invention provides a method for identifying the Bifidobacterium adolescentis. The GABA production of the Bifidobacterium adolescentis of the present invention is as high as 3200 mg / L, significantly higher than that of existing strains; and it has the potential to be applied to live bacterial foods, health products or drugs for improving sleep, regulating or treating mental diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a Bifidobacterium adolescentis, a culture method thereof, and an identification method thereof. Background Art

[0002] γ-aminobutyric acid (GABA) is an inhibitory neurotransmitter and plays an important role in the regulation of the central nervous system. The imbalance of GABA is related to many neurological and mental diseases, such as anxiety, depression, Alzheimer's disease, Parkinson's disease, etc. More and more evidence has proved that the GABA levels in the peripheral system and the brain are affected by the gut microbiota. The GABA concentration in the gut of germ-free mice is 1.3 times lower than that of mice with normal microbiota, and the GABA concentration in the brain is 3.7 times lower than that of normal mice. After treatment with vancomycin, the concentration and abundance of the gut microbiota in mice decreased, leading to a significant decrease in GABA levels. Administering GABA-producing strains to mice will cause an increase in colonic GABA levels, affect the nervous system, and further affect the pain sensation of mice. Therefore, the change in GABA levels caused by the change in the gut microbiota is considered to play an important role in regulating neuropsychiatric diseases. GABA produced by the gut microbiota, as a molecule regulating the gut-brain axis, has attracted more and more attention.

[0003] Due to the research on the improvement effect of GABA production by the gut microbiota on various neurological disorders, more and more studies have been conducted on the species / strains that can produce GABA. The main species that can produce GABA in the human gut include Bifidobacterium, Lactobacillus, and Bacteroides. Among them, Bifidobacterium and Lactobacillus that produce GABA have been widely developed due to their health effects and safety. Regarding the research on GABA production by Bifidobacterium, it mainly focuses on Bifidobacterium adolescentis at present. Two strains of Bifidobacterium adolescentis 95 and 150 are disclosed in CN113773978B. Under the condition of adding 3% (i.e., 30 g / L) monosodium glutamate (MSG), the amount of GABA produced after culturing at 37°C for 36 h is 100 - 250 mg / L. Multiple strains of Bifidobacterium adolescentis MN-84, cb7y2, and Cb7y3 are disclosed in CN114181868A. Their GABA yield is 7 - 18 mg / L after culturing for 24 h under the condition of 1% (i.e., 10 g / L) glutamate.

[0004] However, the yield that can be achieved by the currently known strains that can be used to produce GABA still has room for improvement. To obtain a method for producing higher-yield GABA, there is an urgent need in the art to develop a strain with high GABA production. Summary of the Invention

[0005] The object of the present invention is to provide a Bifidobacterium adolescentis, a culture method thereof and an identification method thereof. The Bifidobacterium adolescentis of the present invention can highly produce γ-aminobutyric acid.

[0006] In one aspect, the present invention provides a Bifidobacterium adolescentis, which contains a molecular marker fragment that can be amplified by primer pair 1, primer pair 2 and / or primer pair 3,

[0007] wherein,

[0008] the primer pair 1 includes a forward primer sequence 1 with the sequence CGGTAATCAATGCCTTCGCG (SEQ ID NO: 1) and a reverse primer sequence 1 with the sequence AACAAGGCGCCTAAGAACGA (SEQ ID NO: 2),

[0009] the primer pair 2 includes a forward primer sequence 2 with the sequence GACGGGTCTTCCTTCTGGTG (SEQ ID NO: 3) and a reverse primer sequence 2 with the sequence AGGCGTTGTCCAACATCTGT (SEQ ID NO: 4), or

[0010] the primer pair 3 includes a forward primer sequence 3 with the sequence TTTCACGGCACCCATGTCAT (SEQ ID NO: 5) and a reverse primer sequence 3 with the sequence ACTTCCAACAGAGCAAGCGA (SEQ ID NO: 6).

[0011] In one embodiment, the amplification is carried out by a nucleic acid amplification reaction (such as a PCR reaction).

[0012] In one embodiment, the Bifidobacterium adolescentis can produce γ-aminobutyric acid, and its yield in 24 hours is not less than 1500 mg / L; preferably, its yield in 24 hours is not less than 2400 mg / L; more preferably, its yield in 24 hours is not less than 3200 mg / L.

[0013] In one embodiment, the culture medium of the Bifidobacterium adolescentis is an RCM medium with a pH of 6.8 - 7.2 (preferably 7.0), and MSG with a concentration of 20 - 80 g / L (preferably 30 - 60 g / L; more preferably 50 g / L) and lactose with a concentration of 4 - 10 g / L (preferably 5 g / L) are added to the culture medium.

[0014] In one embodiment, the molecular marker fragment has a characteristic sequence as shown in SEQ ID NO: 7, 8 or 9, or has a characteristic sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with any of the characteristic sequences shown in SEQ ID NO: 7, 8 or 9.

[0015] In one aspect, the present invention provides a Bifidobacterium adolescentis, which is Bifidobacterium adolescentis GSB03505, and the deposit number is CGMCC No. 32483.

[0016] In one embodiment, the Bifidobacterium adolescentis is in the form of live cells, non-live cells, bacterial culture solution, freeze-dried powder, or postbiotics.

[0017] In one aspect, the present invention provides a culture containing the Bifidobacterium adolescentis of the present invention.

[0018] In one embodiment, the culture is obtained by culturing the Bifidobacterium adolescentis of the present invention. In one embodiment, the culture is a biologically pure culture.

[0019] In one aspect, the present invention provides a composition, which comprises the Bifidobacterium adolescentis of the present invention or the culture of the present invention.

[0020] In one embodiment, the composition further comprises additional probiotic materials.

[0021] In one embodiment, the composition further comprises prebiotic materials.

[0022] In one embodiment, the composition further comprises an ingestible carrier.

[0023] In one embodiment, the composition further includes a pharmaceutically acceptable carrier and / or excipient.

[0024] In one aspect, the present invention provides a method for culturing a strain, comprising the step of culturing the Bifidobacterium adolescentis of the present invention under suitable conditions.

[0025] In one embodiment, the suitable conditions include: the culture temperature is 25 - 40 °C; preferably 37 °C.

[0026] In one embodiment, the suitable conditions include: the culture environment is anaerobic culture.

[0027] In one embodiment, the suitable conditions include: the culture medium is a culture medium containing MSG; preferably, the concentration of MSG in the culture medium is 5 - 80 g / L; more preferably 20 - 60 g / L; more preferably 30 - 60 g / L; even more preferably 50 g / L.

[0028] In one embodiment, the suitable conditions include: the pH of the culture medium is 5.5 - 7.5; preferably 6.8 - 7.2; more preferably 7.0; for example, the culture medium is RCM medium with a pH of 6.8 - 7.2.

[0029] In one embodiment, the suitable conditions include: lactose with a concentration of 4 - 10 g / L (preferably 5 g / L) is added to the culture medium.

[0030] In one embodiment, the suitable conditions include: the culture time is 0 - 100 h; preferably 4 - 80 h; more preferably 20 - 80 h, more preferably 22 - 72 h, even more preferably 24 - 48 h.

[0031] In one aspect, the present invention provides a method for producing γ-aminobutyric acid, comprising the step of culturing Bifidobacterium adolescentis as described in the present invention under suitable conditions.

[0032] In one embodiment, the suitable conditions include: the culture temperature is 25 - 40 °C; preferably 37 °C.

[0033] In one embodiment, the suitable conditions include: the culture environment is anaerobic culture.

[0034] In one embodiment, the suitable conditions include: the culture medium is a culture medium containing MSG; preferably, the concentration of MSG in the culture medium is 5 - 80 g / L; more preferably 20 - 60 g / L; more preferably 30 - 60 g / L; even more preferably 50 g / L.

[0035] In one embodiment, the suitable conditions include: the pH of the culture medium is 5.5 - 7.5; preferably 6.8 - 7.2; more preferably 7.0; for example, the culture medium is RCM medium with a pH of 6.8 - 7.2.

[0036] In one embodiment, the suitable conditions include: lactose with a concentration of 4 - 10 g / L (preferably 5 g / L) is added to the culture medium.

[0037] In one embodiment, the suitable conditions include: the culture time is 0 - 100 h; preferably 4 - 80 h; more preferably 20 - 80 h, more preferably 22 - 72 h, even more preferably 24 - 48 h.

[0038] In one aspect, the present invention provides the use of the Bifidobacterium adolescentis, the culture or the composition of the present invention in the preparation of a live bacterial agent or food for improving sleep, regulating or treating mental diseases in a subject.

[0039] In one embodiment, the improvement of sleep includes improving sleep quality and / or increasing sleep duration.

[0040] In one embodiment, the mental diseases are mental diseases with sleep disorders, such as autism spectrum disorder (ASD), depression, anxiety disorder, bipolar disorder, post-traumatic stress disorder, schizophrenia, attention deficit hyperactivity disorder, obsessive-compulsive disorder, or sleep disorders caused by alcohol, smoking cessation and / or stimulant abuse.

[0041] In one aspect, the present invention provides a pair of specific primers, which includes:

[0042] Primer pair 1, which includes a forward primer sequence 1 with the sequence CGGTAATCAATGCCTTCGCG (SEQ ID NO: 1) and a reverse primer sequence 1 with the sequence AACAAGGCGCCTAAGAACGA (SEQ ID NO: 2),

[0043] Primer pair 2, which includes a forward primer sequence 2 with the sequence GACGGGTCTTCCTTCTGGTG (SEQ ID NO: 3) and a reverse primer sequence 2 with the sequence AGGCGTTGTCCAACATCTGT (SEQ ID NO: 4), and / or

[0044] Primer pair 3, which includes a forward primer sequence 3 with the sequence TTTCACGGCACCCATGTCAT (SEQ ID NO: 5) and a reverse primer sequence 3 with the sequence ACTTCCAACAGAGCAAGCGA (SEQ ID NO: 6).

[0045] In one aspect, the present invention provides a kit, which includes the pair of specific primers as described in the present invention.

[0046] In one aspect, the present invention provides a specific molecular marker for identifying Bifidobacterium adolescentis, and the molecular marker has a characteristic sequence as shown in SEQ ID NO: 7, 8 or 9; the Bifidobacterium adolescentis is the Bifidobacterium adolescentis as described in the present invention.

[0047] In one aspect, the present invention provides the use of the primer pair as described in the present invention, the kit as described in the present invention, or the specific molecular marker as described in the present invention in detecting or identifying Bifidobacterium adolescentis, wherein the Bifidobacterium adolescentis is the Bifidobacterium adolescentis as described in the present invention.

[0048] In one aspect, the present invention provides a method for detecting or identifying Bifidobacterium adolescentis, wherein the method comprises the following steps:

[0049] (1) performing PCR amplification on a sample containing a genome using the primer pair as described in the present invention or the kit as described in the present invention, and detecting the amplification result, and

[0050] (2) identifying whether the sample contains Bifidobacterium adolescentis as described in the present invention according to the amplification result, including:

[0051] After performing PCR amplification with primer pair 1 in step (1), if a target band appears at approximately 220 bp in the electrophoresis band of the amplification result, then the sample contains Bifidobacterium adolescentis as described in the present invention;

[0052] After performing PCR amplification with primer pair 2 in step (1), if a target band appears at approximately 256 bp in the electrophoresis band of the amplification result, then the sample contains Bifidobacterium adolescentis as described in the present invention; and / or

[0053] After performing PCR amplification with primer pair 3 in step (1), if a target band appears at approximately 595 bp in the electrophoresis band of the amplification result, then the sample contains Bifidobacterium adolescentis as described in the present invention.

[0054] In one embodiment, the method further comprises: extracting nucleic acid from the sample before detection.

[0055] In one embodiment, the amplification result is detected by gel electrophoresis.

[0056] In one embodiment, the method further comprises the step of sequencing the target band fragment obtained by amplification.

[0057] In one embodiment, the nucleotide sequence of the target band at 220 bp obtained by sequencing is as shown in SEQ ID NO: 7, or has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 7.

[0058] In one embodiment, the nucleotide sequence of the target band at 256 bp obtained by sequencing is as shown in SEQ ID NO: 8, or has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 8.

[0059] In one embodiment, the nucleotide sequence of the target band at 595 bp obtained by sequencing is as shown in SEQ ID NO: 9, or has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 9.

[0060] In one aspect, the present invention provides a method for detecting or identifying Bifidobacterium adolescentis, wherein the method comprises the following steps:

[0061] (1) performing genome sequencing on a sample containing a genome, and

[0062] (2) identifying whether the sample contains Bifidobacterium adolescentis as described in the present invention according to the sequencing results; if the measured sequence contains the specific molecular marker described in the present invention, or contains a characteristic sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the specific molecular marker, then the sample contains Bifidobacterium adolescentis as described in any one of the present invention.

[0063] In a specific embodiment of the present invention, in order to obtain a higher GABA-producing Bifidobacterium adolescentis, the inventor isolated 8 strains of Bifidobacterium adolescentis from the human intestine, and through the evaluation of GABA production ability, strain GSB 03505 was screened out. The GABA production of this strain is as high as 3200 mg / L, which is significantly higher than the existing strains. In another specific embodiment, the inventor also developed a strain-specific identification method and preliminarily evaluated the acid tolerance, adhesion characteristics and safety of the strain, all of which showed high application performance. The Bifidobacterium adolescentis GSB03505 of the present invention has the potential to be used in live bacterial foods, health products or drugs for improving sleep, regulating or treating mental diseases.

[0064] Based on the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain the preferred examples of the present invention.

[0065] The reagents and raw materials used in the present invention are all commercially available.

[0066] The positive and progressive effects of the present invention are as follows:

[0067] (1) The high-yield GABA-producing Bifidobacterium adolescentis GSB 03505 (CGMCC No. 32483) provided by the present invention has a yield as high as 3200 mg / L, which is significantly higher than other Bifidobacterium adolescentis strains reported in known literature and patents.

[0068] (2) At the same time, metabolomic studies found that GSB03505 produces a series of neuromodulatory substances related to GABA metabolism and function; animal experiments found that gavage with the GSB03505 strain can effectively extend the sleep time of mice and improve their sleep.

[0069] (3) In order to better determine the specificity of the strain, comparative genomic analysis was used to discover the strain-specific sequence of GSB 03505. Three pairs of strain-specific primers were successfully designed for the specific sequence, and a strain characteristic detection method was developed, which can identify the strain specificity of this strain under single-strain and mixed-strain conditions.

[0070] (4) In addition, the genome of this strain does not contain virulence factors and has high safety; its adhesion ability to Caco-2 monolayer cells is as high as 80.75%, showing high intestinal adhesion potential; after being treated in simulated gastric juice at pH 3.0 for 3 h, the viable cell count decreases by about one order of magnitude, indicating high tolerance to gastric acid.

[0071] In summary, the high-yield GABA-producing Bifidobacterium adolescentis GSB03505 has the potential to be used in live bacterial foods, health products or drugs for improving sleep, regulating or treating mental diseases.

[0072] Biological Material Deposit Information

[0073] The Bifidobacterium adolescentis GSB03505 of the present invention was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 04, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101. The deposit number is: CGMCC No. 32483. The name of the culture is GSB03505, and the taxonomic name is Bifidobacterium adolescentis. Description of the Drawings

[0074] Figure 1 Results of GABA production by Bifidobacterium adolescentis strains.

[0075] Figure 2 Shows the GABA production characteristics of Bifidobacterium adolescentis GSB03505.

[0076] Figure 3 showed the adhesion ability of the strain to Caco-2 monolayer cells.

[0077] Figure 4 showed the acid tolerance characteristics of the experimental strains.

[0078] Figure 5 was the phylogenetic tree of Bifidobacterium adolescentis.

[0079] Figure 6 was the amplification result of the specific primers in Example 8.

[0080] Figure 7 was the verification result of the effect of the specific primers in fecal samples.

[0081] Figure 8 was the verification result of the test effect of the specific primers in the mixed sample containing GSB03505.

[0082] Figure 9 showed the experimental design and animal grouping in Example 9.

[0083] Figure 10 showed the effect of gavage with different strains on the sleep time of mice. Detailed implementation mode

[0084] To make the present disclosure easier to understand, certain terms are first defined. As used in this application, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0085] The term "about" may refer to a value or a component within an acceptable error range of a specific value or a component determined by a person of ordinary skill in the art, which will depend in part on how the value or the component is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0086] As used herein, the terms "comprising" or "including" may be open-ended, semi-closed, and closed. In other words, the terms also include "consisting essentially of...", or "consisting of...".

[0087] The term "sequence identity" refers to the identity or homology between biological sequences, which is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein), and determining the number of positions where the same residues occur. Generally, this is expressed as a percentage. Methods for measuring the sequence identity of nucleotide sequences are well known to those skilled in the art.

[0088] As used herein, the term "molecular marker fragment" or "characteristic sequence" refers to a nucleic acid fragment that specifically exists in a specific strain and can be used to distinguish the strain from other different strains. In a specific embodiment of the present invention, the strain GSB 03505 of the present invention has molecular marker fragments SEQ ID NO: 7, 8, and 9 that can be detected by primer pairs 1, 2, and / or 3. The specific sequence information is as follows:

[0089] SEQ ID NO: 7

[0090] CGGTAATCAATGCCTTCGCGACCCTGAGTCCGAGGACATCGACCTCCGACTTGTCGGGCATCGAGCGCTTGGGGACCGATTTCTTCATCGCCTCAAGGTGCTTTGAATACAGCTCACGCTCTTCCGCCGTGAGCGTCCCATCGCTCGCATGAGTGCGAAGCAACGCGACCTCGTCGGGCGTCAAGATGTCCGCGTCCTTGTCGTTCTTAGGCGCCTTGTT

[0091] SEQ ID NO: 8

[0092] GACGGGTCTTCCTTCTGGTGCAAATAAACCCCGAAGTTCCACATCGCCTCGTCGCTCCAAATATGTCGGCGCACCTCGGTCATATCGGACGTGCCCCGAAGACCGCTCACCACCTCGTCGAAGAAGCATTGGCCGGGAAACCTCCCCGATTCGGGTTCCGCGGCTAAAGAGCGCATGTTTTGATAAAAGCTCCCCAAGTCAAAAGCTCTGCCGCCAGACAGCAATTTCGCCATGCTACAGATGTTGGACAACGCCT

[0093] SEQ ID NO: 9

[0094] TTTCACGGCACCCATGTCATGCGTCACTAAAATAACGGTCTTCGTCGGATCTTTTTTCACCTTCGCGAAATAGTTATCGCACTTACGCTGGAATGCTTCATCACCGACAGCAAGAACCTCATCCAGAACCAGAATGTCACCCTTAGCTTGGATAGCCACAGAAAACGCTAAACGAACTTGCATACCAGATGAATAGTTCTTTAGCTTCTGATCCATGAATTCTTCAAGCTCAGCAAACTCGACGATGTCGTCGTACATGTCCTCGATTTCTTCACGGGTAAAACCAAGCAAAGCTCCGTTGAGGAAAACATTCTCTCGACCGGTCAGTTCAGGATTAAAGCCGACACCAAGCTCGATGAAAGGAACGAGCTTACCCTTTACCTCAATCCTTCCGGAATCCGGAACATATATGCCGGAAATCAGTTTCAACAACGTTGACTTGCCACTGCCGTTACGGCCTACAATTCCAAAGAAGTCACCTTGGTGGACTTCAAAATTGATGTCTCGAAGCACATGCTGTTCTTTGTAGCCTTTGATGCCTTTAGTCCAATTAATGAAGGCCTGCTTCAAACCGCTCGCTTGCTCTGTTGGAAGT

[0095] The term "probiotic" refers to a class of beneficial active microorganisms that colonize the host and change the composition of the microbiota in a certain part of the host. Probiotics play a role in promoting nutrient absorption and maintaining intestinal health by regulating the host mucosal and systemic immune functions or by regulating the balance of the intestinal microbiota, thereby producing beneficial effects on health, either as single microorganisms or as well-defined mixed microorganisms. The beneficial bacteria or fungi in the human and animal bodies mainly include yeasts, probiotic bacilli, Clostridium butyricum, Lactobacillus, Bifidobacterium, Actinomyces, etc.

[0096] The term "prebiotic" refers to organic substances that are not digested and absorbed by the host but can selectively promote the metabolism and proliferation of beneficial bacteria in the body, thereby improving the health of the host. Commonly used prebiotics include oligosaccharides, such as fructooligosaccharide, galactooligosaccharide, xylooligosaccharide, isomaltooligosaccharide, soybean oligosaccharide, inulin, etc. Some microalgae can also be used as prebiotics, such as Spirulina platensis and Arthrospira platensis. In addition, polysaccharides (such as Coriolus versicolor polysaccharide and nitrogen-containing polysaccharide in carrots), protein hydrolysates (such as hydrolysates of casein, α-lactalbumin, lactoferrin, etc.), and vegetables, Chinese herbal medicines, wild plants, etc. in natural plants can also be used as prebiotics.

[0097] The term "postbiotic" is a general term for the metabolite components of probiotics after processing, including bacterial cells and metabolites. The postbiotic form is an inactive form of bacteria. Existing studies have confirmed that screened postbiotics have better immune-enhancing ability than the original live bacteria and still retain high physiological activity even after being treated by high temperature or gastrointestinal digestive juices. Probiotic metabolites belonging to postbiotics include vitamins, lipids, enzymes, proteins, polypeptides, organic acids, short-chain fatty acids, intracellular polysaccharides, etc. Bacterial cell components belonging to postbiotics include lipoteichoic acid, teichoic acid, peptidoglycan, cell surface proteins, polysaccharides, cell membrane proteins, extracellular polysaccharides, etc.

[0098] The term "biologically pure grade" or "biologically pure" means that in biological experiments, the content of a specific component in a certain substance reaches a certain standard under specific conditions, while the content of other components is relatively low to meet the purity requirements for experiments. In the specific embodiments of the present invention, in the culture described in the present invention, compared with other strains, the Bifidobacterium adolescentis of the present invention is biologically pure. Preferably, the content of the Bifidobacterium adolescentis of the present invention among all strains in the culture is not less than 85%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98%, or not less than 99%.

[0099] The present invention will be further illustrated by the following examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0100] Example 1 Isolation and Identification of Bifidobacterium adolescentis

[0101] (1) Collection of fecal samples: Dig about 5 g of fecal samples from the middle part (the center of the strip-shaped feces) into a 50 mL centrifuge tube and transport it to the laboratory at low temperature using an anaerobic box;

[0102] (2) Sample dilution: After weighing the sample and transferring it into the anaerobic chamber, dilute the fecal sample 10-fold with physiological saline and label it as 10-1 , Take 1 mL of 10 -1 diluent and add it to 9 mL of physiological saline to make 10 -2 , and so on, serially dilute to 10 -9 . During the dilution process, the centrifuge tube needs to be shaken up and down, and the pipette needs to be used to blow and beat several times until it is evenly mixed;

[0103] (3) Plate coating: Take 200 μl and coat it on MRS (Oxoid, CM1163) plates with dilution factors of 10 -7 、10 -8 、10 -9 . The culture conditions are 37°C, relative humidity 70%, anaerobic;

[0104] (4) Enrichment culture: Select plates with a moderate number of bacteria (10 -7 、10 -8 、10 -9 ), observe the colony morphology, look at the colony color, size, and whether the surface is moist or dry, and use an inoculation loop to pick monoclonal colonies with different morphologies into 3 ml of the corresponding liquid medium for enrichment culture;

[0105] (5) When visible turbidity appears, take 200 μl for 16S DNA full-length PCR amplification and sequencing. Use a pipette to aspirate 700 μl of the remaining bacterial liquid into a 2 ml preservation tube (previously added with 300 μl of glycerol preservation solution), and save 2 copies of each strain. Store at -80°C.

[0106] (6) Strain identification: The 16s sequence is aligned through NCBI blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and the experimental strain is identified as Bifidobacterium adolescentis, and its number is shown in Table 1. Strain GSB03505 was deposited at the China General Microbiological Culture Collection Center on November 04, 2024, with the deposit number: CGMCC 32483.

[0107] The gene sequence of 16s RNA is as follows (SEQ ID NO: 10, shown as DNA sequence):

[0108]

[0109] Table 1 List of successfully isolated Bifidobacterium adolescentis

[0110]

[0111] Example 2 Screening of Bifidobacterium adolescentis strains with high γ-aminobutyric acid production

[0112] (1) Preparation of culture medium

[0113] Prepare the culture medium according to the following ratio, add monosodium glutamate (MSG), and adjust the pH of the culture medium to about 7.0. Sterilize at 115°C for 15 minutes under high pressure.

[0114] Table 2 Culture medium formula for screening GABA-producing strains

[0115]

[0116] (2) Culture of GABA-producing strains and sample preparation

[0117] Take the glycerol strains preserved in Table 1 and anaerobically culture them on RCM plates at 37°C for 72 h; pick monoclonal colonies into liquid RCM medium (Reinforced Clostridium Medium), continue to activate for 24 h. After confirming the correct strain by mass spectrometry identification, use it as P2 seeds for subsequent passages and subsequent experiments.

[0118] The qualified P2 strains were transferred to 20 mL of RCM + lactose medium containing different concentrations of MSG (Table 2) at an inoculation amount of 5%, with three replicates for each strain, and cultured for 24 h to obtain P3 strains; the P3 strains were inoculated into the corresponding RCM + lactose medium with different concentrations of MSG (Table 2) at an inoculation amount of 5%, anaerobically cultured at 37°C for 4 h. After 8 h, 1 mL of the bacterial solution was taken for OD600 measurement. At the same time, 1.5 mL of the bacterial solution was taken into a 2 mL centrifuge tube, centrifuged at 10,000 rpm for 5 min, the supernatant was taken and stored at -80°C for GABA detection.

[0119] (3) Study on the GABA production characteristics of Bifidobacterium adolescentis GSB 03505

[0120] Take the GSB 03505 glycerol strain, and the strain culture method refers to the above-mentioned part 2(2), with the difference that the P3 strains are anaerobically cultured for 4 h, 8 h, and 24 h.

[0121] (4) Sample detection

[0122] Sample preparation: Add 50 µL of the sample to 50 µL of the internal standard (GABA-d6, 1000 ng / mL in 50% acetonitrile); add 100 µL of acetonitrile and vortex for 5 min to mix evenly; add 100 µL of borate buffer at pH 8.6 and vortex for 2 min to mix evenly; add 100 µL of the derivatization solution (5 mg / mL Fmoc-chloride derivative solution), after mixing, transfer to a centrifuge tube or 96-well plate, vortex for 5 min to mix evenly, centrifuge at 15 °C and 5800 rpm for 10 min; take 20 µL of the supernatant, add 180 µL of 50% acetonitrile and vortex for 2 min; take 1 µL for LC-MS determination.

[0123] Mass spectrometry conditions: Instrument, LC-MS / MS-42 (Triple Quad 6500+), SCIEX, USA;

[0124] Internal standard: GABA-d6;

[0125] HPLC conditions: The instrument includes an LC (Liquid chromatography) system with dual pumps (LC-30AD), an autosampler (SIL-30AC), a column oven (CTO-20A), a system controller (CBM-20A) and a degasser (DGU-20A), purchased from Shimadzu Corporation (Shimadzu Co., Japan)

[0126] Chromatographic column: Column - Synergi Max-RP, 2.0 mm / 50 mm / 2.5 µm;

[0127] Phase A: Water - 10 mM ammonium formate; Phase B: Acetonitrile / water (98 / 2 v / v) - 10 mM ammonium formate; Flow rate: 0.4 mL / min; Column temperature: 40 °C; Separation program is as follows:

[0128] Table 3 Liquid phase separation conditions for GABA determination

[0129]

[0130] Detection parameters: GABA, retention time 1.39 min, Q1 / Q3 Masses: 324.20 / 102.00 Da; GABA-d6 retention time 1.39 min, Q1 / Q3 Masses: 330.10 / 108.00 Da;

[0131] (5) Screening results of high-yield GABA strains

[0132] From Figure 1It can be seen that under the conditions of MSG concentrations of 5 g / L, 20 g / L, and 50 g / L, after culturing for 4 h and 8 h, strain GSB03505 showed relatively high GABA production, significantly higher than that of the other seven experimental strains. After culturing for 8 h, under the condition of 20 g / L MSG, the GABA production of GSB 03505 reached 783 mg / L; under the condition of 50 g / L MSG, the GABA production of GSB 03505 reached 1100 mg / L, both being 10 - 20 times that of the other experimental strains.

[0133] (6)Study on the characteristics of GABA production by strain GSB03505

[0134] Since the ability of strain GSB03505 to produce GABA is significantly higher than that of other strains, next, taking strain GSB03505 as the research object, the characteristics of GABA production by this strain were further explored to increase the GABA production of the strain. The bacterial culture conditions were the same as those in part (2) of Example 2, and the culture times were 4 h, 8 h, and 24 h respectively. Figure 2 It can be seen that when cultured for 24 h under the condition of 20 g / L MSG, the GABA production of GSB03505 reached 2400 mg / L; when cultured for 24 h under the condition of 50 g / L MSG, the production was as high as 3200 mg / L.

[0135] The efficiency of GSB03505 to produce GABA is significantly higher than that of the patented strains Bifidobacterium adolescentis 95 (CN113773978B) and Bifidobacterium adolescentis MN - 84 (CN114181868A). The amount of GABA produced by Bifidobacterium adolescentis 95 was 200 - 250 mg / L in 36 h under the condition of 30 g / L MSG; the amount of GABA produced by MN - 84 was 10 - 18 mg / L in 24 h under the condition of 10 g / L MSG.

[0136] Example 3 Metabolomics analysis of the high - GABA - producing strain GSB03505

[0137] (1)Sample preparation

[0138] Take the glycerol strains of the preserved Bifidobacterium adolescentis GSB03505 and F35 - 07. The strain culture method refers to part (2) of the above 2. The difference is that the P3 strain is inoculated into the RCM + lactose medium with 50 g / L MSG at an inoculation amount of 5%, anaerobically cultured at 37℃ for 24 h. Take 1.5 mL of the bacterial liquid into a 2 mL centrifuge tube, centrifuge at 10000 rpm for 5 min, take the supernatant, and store it at - 80℃ for metabolome determination.

[0139] (2)Metabolite extraction

[0140] After the sample was slowly thawed at 4 °C, an appropriate amount of the sample was added to pre-cooled methanol / acetonitrile / water solution (2:2:1, v / v), vortex-mixed, ultrasonically treated at low temperature for 30 min, allowed to stand at -20 °C for 10 min, centrifuged at 14000 g at 4 °C for 20 min, the supernatant was taken and dried in vacuo. When performing mass spectrometry analysis, 100 μL of acetonitrile aqueous solution (acetonitrile: water = 1:1, v / v) was added for reconstitution, vortexed, centrifuged at 14000 g at 4 °C for 15 min, and the supernatant was taken for injection analysis.

[0141] (3)Chromatography-mass spectrometry analysis

[0142] The sample was separated using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography system (UHPLC) HILIC chromatographic column; the column temperature was 25 °C; the flow rate was 0.5 mL / min; the injection volume was 2 μL; the mobile phase composition was A: water + 25 mM ammonium acetate + 25 mM ammonia, B: acetonitrile; the gradient elution program was as follows: 0 - 0.5 min, 95% B; 0.5 - 7 min, B linearly changed from 95% to 65%; 7 - 8 min, B linearly changed from 65% to 40%; 8 - 9 min, B was maintained at 40%; 9 - 9.1 min, B linearly changed from 40% to 95%; 9.1 - 12 min, B was maintained at 95%; during the whole analysis process, the sample was placed in a 4 °C autosampler. To avoid the influence caused by the fluctuation of the instrument detection signal, the samples were analyzed continuously in a random order. QC samples were inserted into the sample queue to monitor and evaluate the stability of the system and the reliability of the experimental data.

[0143] The AB Triple TOF 6600 mass spectrometer was used to collect the first-level and second-level spectra of the samples. After the samples were separated by the Agilent 1290 Infinity LC ultra-high performance liquid chromatography system (UHPLC), mass spectrometry analysis was performed using the Triple TOF 6600 mass spectrometer (AB SCIEX), and electrospray ionization (ESI) positive and negative ion modes were used for detection respectively. The ESI source setting parameters are as follows: Nebulizing gas auxiliary heating gas 1 (Gas1): 60, Auxiliary heating gas 2 (Gas2): 60, Curtain gas (CUR): 30 psi, Ion source temperature: 600 °C, Spray voltage (ISVF) ±5500 V (both positive and negative modes); First-level mass-to-charge ratio detection range: 60 - 1000 Da, Second-level daughter ion mass-to-charge ratio detection range: 25 - 1000 Da, First-level mass spectrometry scan accumulation time: 0.20 s / spectra, Second-level mass spectrometry scan accumulation time 0.05 s / spectra; The second-level mass spectrometry was obtained using the data-dependent acquisition mode (IDA), and the peak intensity value screening mode was used, Declustering potential (DP): ±60 V (both positive and negative modes), Collision energy: 35 ± 15 eV, IDA settings are as follows: Dynamic exclusion isotope ion range: 4 Da, 10 fragment spectra were collected per scan.

[0144] (4) Data analysis process

[0145] The raw data was converted into the.mzXML format by ProteoWizard, and then the XCMS software was used for peak alignment, retention time correction, and extraction of peak areas. The data extracted by XCMS was first subjected to metabolite structure identification and data preprocessing (Missing value filtering: deleting ion peaks with missing values > 50%; Missing value filling: KNN filling; Data filtering: filtering features with RSD > 50%), then the experimental data quality evaluation (6 major quality controls) was carried out, and finally the data analysis was performed.

[0146] (5) Experimental results

[0147] In order to clarify the mechanism of high GABA production by GSB03505 and its effects, the metabolomes of the high GABA-producing strain GSB03505 and the low GABA-producing strain F35-017 were compared in this study. A total of 2343 metabolites were successfully identified in the experiment, and 184 differential metabolites between the GSB03505 strain and the F35-017 strain, among which 13 metabolites related to GABA metabolism or mental regulation functions were significantly increased in abundance in the high GABA-producing strain GSB03505 (Table 4).

[0148] Some of these metabolites are produced in the GABA metabolic pathway, indicating that the GABA metabolic pathway is activated, such as 4-aminobutyric acid, L-2,3-diaminopropionic acid, N-carboxyethyl-γ-aminobutyric acid, and glutaric acid. Several other metabolites can enhance the effect of GABA. For example, vigabatrin can inhibit the degradation of GABA by GABA transaminase, increase the concentration of GABA in the brain, and thus enhance the effect of GABA; thiamine monophosphate can participate in the production of GABA in the nervous system, improve sleep quality, and prolong sleep duration; 1,4-butyne diol, as a precursor of GABA, can cross the blood-brain barrier and has the effects of inducing sleep and causing central nervous system depression. The third type of metabolites participate in neuroregulation and complement GABA, such as indolelactic acid, hesperetin, 3,4-dihydroxymandelic acid, propionic acid, etc., which can all participate in the regulation of mental nerves or sleep. The fourth type of metabolites participate in the regulation of intestinal flora, increase the abundance of Bifidobacterium in the intestine, and are also important substances for the regulation of the gut-brain axis, such as raffinose.

[0149] It can be seen from the metabolome data that Bifidobacterium adolescentis GSB03505 not only has the ability to produce high levels of GABA, but also can produce a series of metabolites related to GABA metabolism, or related to sleep regulation, mental regulation, etc., and has the potential to be applied to the regulation of sleep and the alleviation of mental diseases.

[0150] Table 4 Differential metabolites related to GABA metabolism and function

[0151]

[0152]

[0153]

[0154] Example 4 Adhesion experiment of GSB03505 strain

[0155] (1)Strain culture and bacterial liquid treatment

[0156] Take the glycerol bacteria preserved in Table 1. The strain culture method refers to the above-mentioned part 2(2), with the difference that the P3 strain is inoculated into fresh RCM medium at an inoculation amount of 5%, anaerobically cultured at 37 °C until the late logarithmic phase, and 1 mL of the bacterial liquid is taken for bacterial count determination.

[0157] The remaining bacterial liquid is centrifuged at 12000 rpm for 2 min to collect the bacterial cells; the bacterial cells are resuspended with PBS, and according to the bacterial count determination results, the bacterial liquid is adjusted to 2*10 8 / 600 µL, repeat centrifugation at 12000 rpm for 2 min; the bacterial cells are resuspended with the same volume of DMEM-H (Gibco, 11995065) medium and used as cell interaction samples.

[0158] (2)Caco-2 cell culture (Beijing NaBio Technology Co., Ltd., BNCC350769)

[0159] Caco-2 cells were cultured in complete medium (90% DMEM-H + 10% fetal bovine serum FBS (Gibco, 10099141C) + 1% penicillin-streptomycin double antibody + 1% non-essential amino acids NEAA (Gibco, 11140050)) in an incubator at 37 °C with 5% CO2. Subculture was performed every 2 - 3 days, and cells in the logarithmic growth phase were used for experiments.

[0160] Caco-2 cells cultured to the logarithmic growth phase were seeded in a Transwell 24-well culture plate. 0.4 mL of cell suspension (cell count: e5) was added to the apical side (AP) of the filter membrane, and 0.6 mL of cell culture medium was added to the basolateral side (BL). Do not shake, let it stand directly for 2 min. After observing the cells under a microscope, place them in the incubator for culture.

[0161] The culture medium was changed 48 h after inoculation, and then changed every 24 h. Observe the cell growth situation every day. Culture for 14 ± 2 days without serum to differentiate into mature intestinal cells. Measure the cell resistance value with a resistance meter at 7, 10, 12, and 14 days of cell culture. Wait until the cell resistance value stabilizes at a certain value and no longer rises, then subsequent experiments can be carried out. (Generally, the TEER value is between 200 - 1000 Ω·cm 2 , the larger the value, the denser and more complete the cell monolayer is considered).

[0162] (3)Co-culture and counting of cells and bacteria

[0163] Caco-2 cells were infected with the strain (Caco2: test strain) at a ratio of approximately 1:1000 in DMEM-H medium, that is, 300 µl of bacterial suspension was added, and incubated at 37 °C for 45 min. After incubation, gently wash the wells with 1xPBS (pH 7.4), and collect the bacterial supernatant and remaining non-adherent bacteria (a total of 600 µl). Perform plate counting on the initial and collected non-adherent bacterial suspensions, and calculate the cell adhesion rate.

[0164] (4)Adhesion ability of the strain to Caco-2 monolayer cells

[0165] As Figure 3 shown, the adhesion rate of the GABA-producing strain GSB 03505 to human intestinal epithelial cells CaCo-2 was 80.75%, showing a relatively high adhesion ability.

[0166] Example 5 Acid resistance performance of GSB03505 strain

[0167] (1) Preparation of main reagents

[0168] Weigh 0.9 g of sodium chloride and dissolve it in 100 mL of pure water to obtain 0.9% normal saline. Then adjust the pH to 3.0 with 0.1 mol / L hydrochloric acid solution, sterilize it at 115 °C for 15 min by high-pressure steam sterilization. After sterilization and cooling to room temperature, add 0.3 g of pepsin, mix well, filter and sterilize it with a 0.22 µm filter membrane, and it should be prepared and used immediately.

[0169] (2) Strain preparation

[0170] Strain resuscitation: Take out the strain from the -80 °C refrigerator, and inoculate the strain onto the RCM solid medium plate by the method of streaking on the plate, and culture it in a 37 °C anaerobic workstation for 24 - 48 h.

[0171] Inoculation of resuscitated strain: Observe the resuscitation plate, pick a single colony grown from a single bacterium on the plate with a pipette tip, place it in a 5 mL centrifuge tube containing 3 mL of RCM + 0.5% lactose liquid medium, and culture it in a 37 °C anaerobic workstation for 24 h.

[0172] Identification and amplification culture of the strain: After confirming that the strain is correct according to the mass spectrometry results, aspirate 500 μL of the bacterial liquid and transfer it to a 15 mL centrifuge tube containing 9.5 mL of liquid medium, culture it in a 37 °C anaerobic workstation, and take the bacteria in the early stage of the plateau for experiments.

[0173] (3) In vitro simulation of the acid resistance of the strain to gastric juice

[0174] Take 1 mL of the prepared experimental bacterial liquid to measure the OD value of the bacterial liquid, measure the particle number by flow cytometry, and adjust the bacterial concentration to 1.0×10 8 CFU / mL. Aspirate 1 mL of the adjusted bacterial liquid for serial dilution, dilute it successively to 10 -6 , take 100 μL of 10 -4 , 10 -5 , 10 -6 serial dilution solutions and spread them on the RCM plate, then place them in a 37 °C anaerobic workstation for 24 - 48 h for viable count (three replicates for each strain), which serves as the number of bacteria at 0 h. Aspirate 1 mL of the adjusted bacterial liquid and mix it with 9 mL of simulated gastric juice, place it in a 37 °C anaerobic workstation (cultured at 100 rpm), incubate for 1 h and 3 h respectively, take 1 mL of the bacterial liquid for serial dilution, dilute it successively to 10 -6 , take 100 μL of 10 -4 , 10 -5 , 10 -6The gradient dilution solution was spread on an RCM plate and cultured in an anaerobic workstation at 37°C for 24 - 48 h, followed by viable cell counting, which served as the number of bacteria at 1 h and 3 h.

[0175] (4)Acid tolerance characteristics of the strain

[0176] The results are as Figure 4 shown. After treatment with simulated gastric juice at pH 3.0 for 1 h, the viable cell count of the experimental strain decreased by 0.69 logs compared to the initial cell count, and decreased by 1.96 log orders after 3 h, indicating that Bifidobacterium adolescentis GSB03505 exhibits strong acid tolerance.

[0177] Example 6 Detection of virulence factors of strain GSB03505

[0178] Virulence factors refer to molecules with virulence components such as invasiveness and toxins produced by bacteria, viruses, fungi, etc. They are mainly used when microorganisms infect hosts to enter and exit host cells by inhibiting or evading the host's immune response, etc., and to obtain nutrients from the host and for their own reproduction and growth. Virulence factors can be encoded on mobile genetic elements (such as plasmids, genomic islands, phages, etc.) and undergo horizontal gene transfer, turning harmless bacteria into dangerous pathogens. Therefore, when identifying virulence factors, genomic islands, secreted proteins, etc. are generally considered. The virulence factor database VFDB was developed by the Chinese Academy of Medical Sciences and has collected and organized information on the composition, structure, function, pathogenic mechanism, virulence islands, sequences, and genomic information of known virulence factors of various important medical pathogens, and is widely used in the identification of virulence factor genes.

[0179] According to the identification and comparison results, a similarity (identity) > 80% between all genes in the bacterial genome and known virulence factors is considered to have a relatively high possibility and is determined to be positive. In the comparison of GSB03505 in the VFDB database, there are no genes with a similarity greater than > 80%, so it is considered that there are no virulence factors in the genome.

[0180] Example 7 Evolutionary relationship of GSB03505 among Bifidobacterium adolescentis

[0181] To study the evolutionary relationship between strain GSB03505 and other Bifidobacterium adolescentis, genomic data of 18 Bifidobacterium adolescentis strains were obtained from public databases. Additionally, genomic data of low-GABA-producing strain F35-017 and GSB03505 in this study were determined, and a phylogenetic tree was constructed. The specific method is as follows: Comparative genomic analysis was performed using orthofinder v2.5.5 (Genome Biol. 20,(2019)) to obtain core gene sequences; then the core gene sequences in all strains were directly concatenated together, and multiple sequence alignment was performed using mafft v7.525 (Brief. Bioinform. 20, 1160–1166 (2017)), and a phylogenetic tree was constructed for the alignment results using FastTree v2.1 (PLOS ONE 5, e9490 (2010)). The results are as Figure 5 shown. On the phylogenetic tree, strain GSB03505 has an independent branch and has a relatively distant evolutionary distance from other Bifidobacterium strains, indicating that GSB03505 has a high specificity at the strain level and is a new Bifidobacterium adolescentis strain with unique gene evolution characteristics.

[0182] Example 8 Identification of strain specificity of GSB03505

[0183] (1) Design of strain-specific detection primers for GSB 03505

[0184] Through comparative genomics analysis, five specific sequences of Bifidobacterium adolescentis GSB03505 were determined: 803-2, 804-3, 99-5, 99-6, 975-2; five pairs of primers were designed based on the specific sequences, as shown in Table 5.

[0185] To ensure the accuracy of the experiment, in addition to the five pairs of strain-specific primers, this study also selected the bacterial universal primer V4, the Bifidobacterium genus-specific primer Bifi662, and the Bifidobacterium adolescentis species-specific primer BiA-2 as experimental controls.

[0186] Table 5 Primer sequences for strain-specific detection

[0187]

[0188]

[0189] (2) Strains for strain-specific detection

[0190] As shown in Table 5, the Bifidobacterium adolescentis strains F54-016, F35-017, and F33-008 sourced from the intestinal flora, as well as the standard strain Bifidobacterium adolescentis ATCC15703, were selected as strain-specific verification strains; Bifidobacterium bifidum ATCC29521 and Bifidobacterium longum subsp. longum ATCC 15707 were selected as genus-specific control strains for experimental verification.

[0191] Table 6 Verification Strains for Strain-Specific Identification

[0192]

[0193] (3)Strain-Specific Detection and Verification

[0194] Strain resuscitation: Take 40 μL of the strain preservation bacterial liquid and inoculate it into 3 mL of RCM + 0.5% lactose medium for liquid resuscitation culture, and at the same time perform streak plating on the corresponding solid plate;

[0195] Strain expansion culture: Pick a monoclonal colony from the resuscitation plate and culture it in the corresponding 3 mL liquid medium. Identify the bacterial liquid of the strain by mass spectrometry. After confirming the correct strain, it is used for genomic DNA extraction;

[0196] DNA extraction: Use the TIANGEN bacterial DNA extraction kit (DP302) for genomic DNA extraction.

[0197] PCR system:

[0198] Table 7 PCR System for Strain-Specific Detection

[0199]

[0200] PCR program: Pre-denaturation: 94°C for 3 min; Denaturation: 94°C for 30 s; Annealing: 55°C for 30 s; Extension: 72°C for 40 s; Number of cycles: 30; Final extension: 72°C for 5 min

[0201] Electrophoresis conditions: Prepare a 2% agarose gel: Weigh 1.8 g of agarose powder, add 90 mL of 1X TAE solution, heat and dissolve it in a microwave oven, add 9 μL of 4S GREEN nucleic acid stain, and then prepare the gel for use; Loading: Mix 2 μL of the PCR amplification product evenly with 1 μL of 10X loading buffer and load it into the agarose gel sample well; Running the gel: Run at 120 V for 30 - 40 min; Gel imaging: Place the agarose gel in a gel imager for imaging.

[0202] (4)Verification Results of Strain-Specific Detection Methods

[0203] It can be seen from Figure 6 that when using the universal bacterial primer V4, obvious bands were amplified from all 7 experimental strains, indicating that the genome and PCR program were effective. When using the Bifidobacterium-specific primer Bifi662, all Bifidobacterium strains had target bands. When using the species-specific primer BiA-2 for Bifidobacterium adolescentis, only 5 strains of Bifidobacterium adolescentis amplified the target bands, and no target bands were found in the control strains Bifidobacterium bifidum ATCC29521 and Bifidobacterium longum ATCC15707, indicating that the species-specific primer was effective.

[0204] Among the 5 pairs of alternative strain-specific primers for GBS03505, only the target strains successfully amplified the target bands with primers 803-2, 804-3, and 975-2, and the band sizes were consistent with the expected values, so they can be used as strain-specific identification primers. Non-target bands were amplified with primers 99-5 and 99-6 in non-target strains, so they are not suitable as strain-specific identification primers.

[0205] (5)Verification of Strain-Specific Primers in Fecal Samples

[0206] To verify the effectiveness of the strain-specific primers 803-2, 804-3, and 975-2 in complex samples, fecal DNA from 8 healthy individuals was randomly extracted and amplified using the strain-specific primers 803-2, 804-3, 975-2, the species-specific primer BiA-2 for Bifidobacterium adolescentis, the genus-specific primer Bifi662 for Bifidobacterium, and the universal bacterial primer V4. The amplification results are as Figure 7 shown. No amplification bands were found in the negative controls. All 6 pairs of primers using GSB03505 genomic DNA as the template amplified bands of the target size, indicating that the PCR reaction system was normal. In the 8 healthy individual samples, samples No. 01, 02, 03, 04, 06, 07, and 08 all had target bands for the bacterial V4, the genus Bifidobacterium Bifi662, and Bifidobacterium adolescentis BiA-2, indicating that Bifidobacterium adolescentis was present in the samples. However, although some primer pairs of the 3 pairs of specific primers showed relatively weak non-specific amplification bands in some samples (such as samples No. 01, 03, 04, 07, and 08), no molecular marker fragment bands of the target size were amplified, suggesting that the GSB03505 strain of Bifidobacterium adolescentis was not present in all samples.

[0207] To further determine the effectiveness of the primers, 10%, 1%, and 0.5% GSB03505 DNA were added to 2 fecal samples (samples No. 01 and 07) respectively, and together with the GSB03505 pure product control, the above 5 pairs of primers were used for amplification (the GSB03505 pure product was additionally amplified with the V4 primer). The amplification results are asFigure 8 As shown in the figure, target bands were amplified in fecal samples containing different concentrations of GSB03505 DNA by 3 pairs of strain-specific primers, and no non-specific amplification bands appeared, indicating that 803-2, 804-3, and 975-2 could effectively amplify the target strain Bifidobacterium adolescentis GSB03505 in the mixed samples.

[0208] Example 9 Improvement of sleep in mice by GSB03505

[0209] (1) Experimental animals

[0210] ICR mice, male, 7-8 weeks old, 125 mice, SPF grade, purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd., production license number of experimental animals: SCXK(Zhe)2019-0001, arrived at the facility before the experiment.

[0211] (2) Feeding of experimental animals

[0212] The animals were housed in Hanshu Biomedical Co., Ltd. (license for the use of experimental animals: SYXK(Shanghai)2022-0021).

[0213] After all animals arrived at the animal facility, they entered a 5-7-day adaptation feeding period. At the end of the feeding period, animals that passed the health check were selected for the experiment and recorded. And the experiment was carried out as Figure 9 shown in the figure.

[0214] (3) Pentobarbital sodium experiment

[0215] Pentobarbital sodium was injected intraperitoneally, and the loss of righting reflex (LORR) was used as an index. After intraperitoneal injection of pentobarbital sodium, the animals were placed in the supine position. If the mice could not right themselves within 30 s, it was considered that the righting reflex disappeared and the sleep state began; if the righting reflex of the mice recovered, the sleep state ended. After administration of pentobarbital sodium to the animals, whether there was LORR, the LORR latency, and the LORR duration were recorded.

[0216] Experiment on prolonging the sleep time of pentobarbital sodium: Before the formal experiment, a preliminary experiment was carried out to determine the intraperitoneal injection dose of pentobarbital sodium. The dose at which all mice fell asleep and the sleep duration was moderate after intraperitoneal injection was used as the standard, and the formal experiment was carried out at this dose (30-60 mg / kg).

[0217] According to the pentobarbital sodium dose determined by the preliminary experiment, pentobarbital sodium was administered intraperitoneally 30 min after the last gavage on D28 and D42, and the time from the disappearance of the righting reflex to its reappearance was recorded as the sleep time.

[0218] (4) Influence of Bifidobacterium adolescentis GSB03505 on improving sleep

[0219] From Figure 10 It can be seen that after 28 days of drug administration to experimental animals, the sleep time of mice in the group of Bifidobacterium adolescentis GSB03505 with high GABA production was prolonged. After 42 days of drug administration, compared with the PBS group and the control strain group of F35-017 with low GABA production, the sleep time of mice in the GSB03505 group was significantly prolonged. Intragastric administration of Bifidobacterium adolescentis GSB03505 can prolong the sleep time of mice and effectively improve the sleep of mice.

Claims

1. A Bifidobacterium adolescentis ( Bifidobacterium adolescentis ), characterized in that, The Bifidobacterium adolescentis is Bifidobacterium adolescentis GSB03505, with the deposit number being CGMCC No. 32483.

2. A culture, characterized in that The culture contains the Bifidobacterium adolescentis according to claim 1.

3. A composition, characterized in that The composition comprises the Bifidobacterium adolescentis according to claim 1 or the culture according to claim 2 .

4. The composition according to claim 3, characterized in that The Bifidobacterium adolescentis in the composition is in the form of living cells, non-living cells, bacterial culture solution or freeze-dried powder.

5. The composition according to claim 3, characterized in that The Bifidobacterium adolescentis in the composition is in the form of a postbiotic.

6. A method for culturing a strain, characterized in that: The method comprises the steps of: culturing the Bifidobacterium adolescentis as claimed in claim 1 under suitable conditions.

7. A method for producing γ-aminobutyric acid, characterized in that: The method comprises the steps of: culturing the Bifidobacterium adolescentis as claimed in claim 1 under suitable conditions.

8. Use of the Bifidobacterium adolescentis according to claim 1, the culture according to claim 2, or the composition according to any one of claims 3 to 5 in the preparation of a live bacteria-based medicament or food for improving sleep, regulating or treating sleep disorders in a subject.

9. The use according to claim 8, wherein The sleep disorder includes autism spectrum disorder, depression, anxiety, bipolar disorder, post-traumatic stress disorder, schizophrenia, attention deficit hyperactivity disorder, obsessive-compulsive disorder, or sleep disorders caused by alcohol, smoking cessation, and / or stimulant abuse.

10. A specific primer pair, characterized in that: The specific primer pair comprises: Primer pair 1, comprising a forward primer sequence 1 and a reverse primer sequence 1, wherein the sequence of the forward primer sequence 1 is shown in SEQ ID NO: 1, and the sequence of the reverse primer sequence 1 is shown in SEQ ID NO: 2, Primer pair 2, comprising a forward primer sequence 2 and a reverse primer sequence 2, wherein the sequence of the forward primer sequence 2 is shown in SEQ ID NO: 3, the sequence of the reverse primer sequence 2 is shown in SEQ ID NO: 4, and / or Primer pair 3, comprising a forward primer sequence 3 and a reverse primer sequence 3, wherein the sequence of the forward primer sequence 3 is shown in SEQ ID NO: 5, and the sequence of the reverse primer sequence 3 is shown in SEQ ID NO:

6.

11. A kit, characterized in that: The kit comprises the specific primer pair as claimed in claim 10.

12. A specific molecular marker for identifying Bifidobacterium adolescentis, characterized in that: The molecular marker has a characteristic sequence as shown in SEQ ID NO: 7, 8 or 9; the Bifidobacterium adolescentis is the Bifidobacterium adolescentis as described in claim 1.

13. Use of the primer pair according to claim 10 or the kit according to claim 11 in detecting or identifying Bifidobacterium adolescentis, characterized in that: The Bifidobacterium adolescentis is the Bifidobacterium adolescentis according to claim 1.

14. A method for detecting or identifying Bifidobacterium adolescentis, characterized in that: The method comprises the following steps: (1) using the primer pair of claim 10 or the kit of claim 11 to perform PCR amplification on a sample containing a genome, and detecting the amplification result, and (2) Identifying whether the sample contains the Bifidobacterium adolescentis according to claim 1 based on the amplification results, comprising: After PCR amplification using primer pair 1 in step (1), if a target band at 220 bp appears in the electrophoresis band of the amplification result, the sample contains the Bifidobacterium adolescentis as described in claim 1; After PCR amplification using primer pair 2 in step (1), if a target band at 256 bp appears in the electrophoresis band of the amplification result, the sample contains the Bifidobacterium adolescentis according to claim 1; and / or After PCR amplification using primer pair 3 in step (1), if a target band at 595 bp appears in the electrophoresis band of the amplification result, the sample contains the Bifidobacterium adolescentis as described in claim 1.

15. The method for detecting or identifying Bifidobacterium adolescentis according to claim 14, characterized in that: The method also includes the step of sequencing the target band fragments obtained by amplification.

16. A method for detecting or identifying Bifidobacterium adolescentis, characterized in that: The method comprises the following steps: (1) performing genome sequencing on samples containing genomes, and (2) Identifying whether the sample contains the Bifidobacterium adolescentis as described in claim 1 based on the sequencing results; if the measured sequence contains the specific molecular marker as described in claim 12, then the sample contains the Bifidobacterium adolescentis as described in claim 1.

Images