Tyrosinase mutant, preparation and application

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to an activity-improved tyrosinase mutant obtained by site-directed mutagenesis through an overlapping PCR technology, and preparation and application thereof. The tyrosinase mutant is obtained by mutation containing F337I / F352I on the basis of wild type tyrosinase as shown in SEQ ID NO.1, the enzyme activity of the tyrosinase mutant is obviously improved compared with that of the wild type tyrosinase, the F337I / F352I mutant gene is used for constructing a recombinant vector, and the recombinant vector is successfully expressed in bacillus subtilis WB600, bacillus amyloliquefaciens CGMCC No.11218 and bacillus licheniformis 2709, so that the tyrosinase mutant is obtained. The recombinant strain with improved enzyme production activity is further optimized through a fermentation process to obtain the novel tyrosinase.

Description

Technical field:

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a tyrosinase mutant with improved enzyme activity obtained through molecular modification and application thereof. Background technology:

[0002] Tyrosinase (EC 1.14.18.1, tyrosinase, TYR), also known as polyphenol oxidase and catechol oxidase, is a binuclear copper-containing oxidoreductase. Tyrosinase is generally a copper-dependent enzyme, and its activity requires copper ions. Tyrosinase is an important bifunctional enzyme that catalyzes the production of diphenol from monophenol (monophenolase activity); catalyzes the production of the corresponding quinone from diphenol (diphenolase activity), which ultimately produces melanin in a non-enzymatic redox reaction. The sources of tyrosinase range from bacteria to mammals, and tyrosinase is found in large quantities in all areas of life. These sources allow the isolation and purification of tyrosinase, which can then be used in a variety of applications. Bacterial tyrosinase was first identified in the genus Streptomyces, followed by several members of other bacteria, such as Thermomicrobium, Marinomonas, Rhizobium, Bacillus, and Pseudomonas. Fungi as a source Fungal tyrosinase was first characterized from Agaricus bisporus. Further research has been conducted on tyrosinase from other fungi, such as Neurospora crassa, Lentinula edodes, Aspergillus, and Amanita. Plants as source plants are good sources of tyrosinase. Through the study of tyrosinase in various fruits and vegetables, it was found that Portulaca oleracea is a strong source of tyrosinase. Some scholars have further studied tyrosinase in eggplant, sunflower seeds, apples, and grapes.

[0003] As a precursor of dopamine, L-dopa is an effective and well-tolerated dopamine replacement drug for the treatment of Parkinson's disease (PD). As a precursor of the neurotransmitter dopamine in the human brain, L-dopa can cross the blood-brain barrier in the brain and be converted into dopamine, so it has become the most effective drug for the treatment of Parkinson's disease. At the same time, L-dopa can also treat other diseases. For example, L-dopa and related compounds can be used as effective inhibitors in therapeutic development to combat systemic amyloidosis. The market size of L-dopa is huge, with an annual world market demand of about 250 tons and a total market capacity of about 101 billion per year. L-dopa currently includes plant extraction, chemical synthesis and biosynthesis. L-dopa is naturally present in plants such as broad beans, cat beans, Mucuna oleifera, but the content of L-dopa in plants is low. At the same time, plant extraction methods usually use minerals or organic concentrated acids, which are prone to environmental pollution. At the same time, in the plant extraction method, strong acid is required, and the extraction time is long and the downstream processing is complicated, which greatly increases the extraction cost of L-DOPA, and the energy consumption is huge, which seriously limits its industrial application. At present, the chemical synthesis of L-DOPA is mostly based on hydantoin and vanillin as starting materials. However, the chemical synthesis of L-DOPA has key limitations, such as low conversion rate and low enantioselectivity. Chemical synthesis usually adopts complex reaction steps and requires expensive metal catalysts (e.g., Rb-complex), which work under harsh operating conditions and have substrate specificity, so it gradually withdraws from the industrial market. Compared with chemical synthesis, the enzymatic catalytic synthesis of L-DOPA has the advantages of high yield, high conversion rate, simple reaction steps, mild conditions, etc. At present, tyrosinase can catalyze the synthesis of L-DOPA with tyrosine as substrate.

[0004] Irrational protein molecular design is to make a large number of gene mutations under certain conditions without knowing the three-dimensional structure information and mechanism of action of the protein, and then select the desired characteristic mutants through multiple rounds of high-throughput screening methods. Rational molecular design is to carry out targeted mutations on a gene sequence that is most likely to affect the function and properties of the protein on the basis of the known three-dimensional structure and function of the protein, and purposefully change one or two amino acid residues or modules of the protein to construct a new protein molecule. Compared with irrational design, rational design has the advantages of less workload and easier to obtain effective mutants.

[0005] As a safe, efficient, multifunctional and highly potential microbial strain, the Bacillus expression system has been widely used in industry, agriculture, medicine, health, food, animal husbandry, aquatic products and scientific research. Compared with the commonly used Escherichia coli expression system, it has a unique advantage in that the product of the target gene expression can be secreted outside the cell, thereby reducing the cost and workload of further collecting, separating and purifying the gene expression product. Among the Bacillus, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus megaterium and the like can be used as expression host bacteria. With the development of molecular biology technology and the in-depth study of Bacillus, a large number of genes have been cloned and expressed using the Bacillus expression system, some of which have been put into large-scale industrial production. A variety of enzymes and clinically required chemical drugs or industrial products are expressed and produced by Bacillus.

[0006] In the present invention, a tyrosinase mutant gene with improved activity is obtained by directed evolution of a wild-type tyrosinase gene, and efficient expression of tyrosinase is achieved in a Bacillus expression system to obtain a tyrosinase mutant strain with improved activity. Summary of the invention:

[0007] Based on the application scenario of tyrosinase, in order to obtain tyrosinase with improved activity, the existing properties of tyrosinase need to be further modified. The purpose of the present invention is to provide a tyrosinase mutant with improved activity. The tyrosinase gene (tyr) from Bacillus wiedmannii is expressed in Escherichia coli BL21; the gene tyr is mutated using overlapping PCR technology to obtain a mutant with improved activity.

[0008] The technical route for achieving the purpose of the present invention is summarized as follows:

[0009] The tyrosinase TYR from Bacillus wiedmannii was subjected to site-directed mutagenesis to obtain the mutant F337I / F352I and the encoding gene tyrmF337I / F352I. The enzyme activity was increased to 153% of the wild-type tyrosinase (TYR). The mutant F337I / F352I was efficiently prepared using Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No.11218 and Bacillus licheniformis 2709.

[0010] One of the technical solutions provided by the present invention is a tyrosinase mutant, which is obtained by adding F337I and F352I to the wild-type tyrosinase shown in SEQ ID NO.1;

[0011] Furthermore, the tyrosinase mutant is a F337I / F352I mutant, and the amino acid sequence is shown in SEQ ID NO.3;

[0012] Furthermore, the nucleotide sequence of the gene encoding the F337I / F352I mutant, tyrmF337I / F352I, is shown in SEQ ID NO.4;

[0013] The second technical solution provided by the present invention is a recombinant plasmid or recombinant strain containing the above mutant encoding gene;

[0014] Furthermore, the expression vector used was pET-22b(+), and the host was Escherichia coli;

[0015] Furthermore, the host cell is Escherichia coli BL21;

[0016] Preferably, the recombinant strain is obtained by connecting the mutant encoding gene to the expression vector pET-22b(+) and expressing it in the host Escherichia coli.

[0017] Furthermore, in the Bacillus, the expression vector used by the recombinant plasmid is pBSA43, and the host cell is Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No.11218 or Bacillus licheniformis 2709.

[0018] The third technical solution provided by the present invention is the use of the above-mentioned recombinant plasmid or recombinant strain in producing the tyrosinase mutant described in the first technical solution.

[0019] The following definitions are used in the present invention:

[0020] 1. Nomenclature of amino acid and DNA sequences

[0021] The generally accepted IUPAC nomenclature for amino acid residues is used, using the three-letter code. The generally accepted IUPAC nomenclature for DNA nucleic acid sequences is used.

[0022] 2. Identification of tyrosinase mutants

[0023] The mutated amino acid in the TYR mutant is represented by "amino acid replaced by the original amino acid position", such as Phe337Ile, which means that the amino acid at position 337 is replaced by Ile from Phe of wild-type TYR, and the position number corresponds to the amino acid sequence number of wild-type TYR in SEQ ID No. 1.

[0024] In the present invention, TYR represents wild-type tyrosinase, lowercase italic tyr represents the coding gene of wild-type TYR, and lowercase italic tyrmF337I / F352I represents the coding gene of mutant F337I / F352I, and the information is shown in the following table.

[0025]

[0026] Beneficial effects:

[0027] The present invention performs site-directed mutagenesis on wild-type TYR to obtain mutants F337I / F352I with improved activity. Description of the drawings:

[0028] Figure 1 It is the electrophoresis diagram of PCR amplification of the TYR mutant F337I / F352I gene of the present invention, wherein M is DNA Marker, and 1 is the TYR mutant F337I / F352I gene;

[0029] Figure 2 1 is a restriction enzyme cutting verification diagram of the recombinant plasmid pET-22b(+)-tyrmF337I / F352I of the present invention, wherein M is DNA Marker, and 1 is a double restriction enzyme cutting electrophoresis diagram of the recombinant plasmid pET-22b(+)-tyrmF337I / F352I;

[0030] Figure 3 The SDS-PAGE diagram of the wild-type TYR and the TYR mutant F337I / F352I after purification of the present invention, wherein: M is a protein marker, 1 is a purified sample of the wild-type TYR, and 2 is a purified sample of the mutant F337I / F352I. Specific implementation method:

[0031] The technical content of the present invention is further described below in conjunction with the embodiments, but the present invention is not limited to these embodiments, and the protection scope of the present invention cannot be limited by the following embodiments.

[0032] Some solutions and culture media used in the embodiments of the present invention are as follows:

[0033] Lysis buffer (mM): Tris 20, NaCl 500, dithiothreitol 1, imidazole 20.

[0034] Wash buffer (mM): Tris 20, NaCl 500, dithiothreitol 1, imidazole 100.

[0035] Elution Buffer (mM): Tris 20, NaCl 500, dithiothreitol 1, imidazole 500.

[0036] LB medium (g / L): 5.0% yeast extract, 10.0% tryptone, 10.0% NaCl, and the rest is water. 2% agar was added to the solid medium.

[0037] In the present invention, the mature peptide sequence of wild-type tyrosinase TYR is shown in SEQ ID NO.1: MRIRKNQANLTHSERLAFTNALLELKRKPSRLPSSSGSTSRYDDYVYWHLMSMMNQTSSTPGSAHGGPAFLPWHRYYINQLELDLQQIDSTVTLPYWDWTVNNSIDPSASGSPWTNDFMGGDGDPNQGYAVTTGPFTGDNWKLTLFDDHHSDEPQDIRLRRQLGTLKNSSGATISINLPTNSEVQNCLLETPYYVSPWRAFQDLNNPSSMTVTKPSFCNRLEGWYGDGRIHNQVHLWVAGATQGSMYWMSSPNDPVFFLHHANVDRLWAQWQVANPNEGYHPTGTGSEVGPTGHNLNDPMKPWGNSVTPNSVLNHHSLGYAYDTDPTPLSEILIRAFNTEITTEKKVSIGSFITREDLEKM

[0038] In the present invention, the mature peptide sequence of the F337I / F352I mutant is as SEQ ID Shown in NO.3: MRIRKNQANLTHSERLAFTNALLELKRKPSRLPSSSGSTSRYDDYVYWHLMSMMNQTSSTPGSAHGGPAFLPWHRYYINQLELDLQQIDSTVTLPYWDWTVNNSIDPSASGSPWTNDFMGGDGDPNQGYAVTTGPFTGDNWKLTLFDDHHSDEPQDIRLRRQLGTLKNSSGATISIN LPTNSEVQNCLLETPYYVSPWRAFQDLNNPSSMTVTKPSFCNRLEGWYGDGRIHNQVHLWVAGATQGSMYWMSSPNDPVFFLHHANVDRLWAQWQVANPNEGYHPTGTGSEVGPTGHNLNDPMKPWGNSVTPNSVLNHHSLGYAYDTDPTPLSEILIRAINTEITTEKKVSIGSIITREDLEKM

[0039] The present invention will be further explained below through specific examples.

[0040] Example 1: Synthesis of wild-type TYR encoding gene tyr

[0041] 1. Submit the TYR gene (NCBI Number: WP_098828762.1) to GENEWISE for synthesis and clone into the plasmid pET-22b(+). Obtain the recombinant plasmid pET-tyr. Then transform the recombinant plasmids into E. coli BL21 competent cells. Obtain the recombinant strain BL21 / pET-tyr.

[0042] Example 2: Construction of tyrosinase mutants

[0043] 1. Construction of TYR mutants

[0044] The primers for amplification of the mutant TYR encoding gene tyrm were designed, and the sequences were as follows:

[0045] Upstream P1:

[0046] AAATAATTTTGTTTAACTTTAAGAAGGAGA

[0047] Downstream P2:

[0048] GGTGGTGGTGGTGGTG

[0049] The amino acids at positions 337 and 352 were selected for mutation, and mutation primers were designed according to the mutation sites as shown in Table 1 below.

[0050] Table 1 Mutation primers are as follows:

[0051]

[0052] The tyrosinase mutant F337I / F352I was constructed by site-directed mutagenesis based on overlapping PCR technology.

[0053] First, construct the mutant F337I:

[0054] In the first step of overlapping PCR reaction system, P1 and 337-F were used as upstream and downstream primers, and P2 and 337-R were used as upstream and downstream primers, respectively. Plasmid pET-tyr was used as a template to perform PCR1 reaction to obtain upstream and downstream fragments, respectively.

[0055] The reaction system for upstream fragment amplification is:

[0056] P1 2μL 337-F 2μL Wild-type tyrosinase gene 2μL PrimerStarMax Enzyme 25μL <![CDATA[ddH2O]]> 19μL

[0057] The reaction system for downstream fragment amplification is:

[0058] P2 2μL 337-R 2μL Wild-type tyrosinase gene 2μL PrimerStarMax Enzyme 25μL <![CDATA[ddH2O]]> 19μL

[0059] The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, extension at 72°C for 5 s, 30 cycles; and extension at 72°C for 10 min.

[0060] 2. After gel excision and recovery of upstream and downstream fragments, PCR 2 was performed. The reaction system was:

[0061] Upstream fragment 2.0μL Downstream fragment 2.0μL PrimerStarMax Enzyme 25μL <![CDATA[ddH2O]]> 21μL

[0062] The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 54°C for 20 s, extension at 72°C for 7 s, 5 cycles; and extension at 72°C for 10 min.

[0063] 3. After PCR 2, 2 μL of primers P1 and P2 were added to the system, and the PCR 3 amplification program was as follows: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 55°C annealing for 20 s, 72°C extension for 6 s, 5 cycles; 72°C extension for 10 min. The PCR amplification product was subjected to 0.8% agarose gel electrophoresis, and the PCR product was recovered using a small amount of DNA recovery kit to obtain the site-directed mutation of the tyrosinase encoding gene tyrmF337I.

[0064] 4. The tyrosinase site-directed mutant gene tyrm F337I was connected to the expression vector pET-22b(+) and transformed into JM109, and the plasmid was extracted to obtain the recombinant plasmid pET-tyrmF337I. The recombinant plasmid pET-tyrmF337I was then transformed into Escherichia coli BL21, and a single mutant colony was picked and inoculated into a liquid LB medium containing Amp resistance for culture. The extracted plasmid was sent for sequencing to confirm that the F337I mutant gene tyrmF337I was obtained.

[0065] 5. Based on the F337I site-directed mutagenesis, the F352I site-directed mutagenesis was performed using overlapping PCR technology to construct a new tyrosinase.

[0066] In the first step of overlapping PCR reaction system, P1 and 352-F were used as upstream and downstream primers, and P2 and 352-R were used as upstream and downstream primers, respectively, and PCR4 reaction was carried out to obtain upstream fragments and downstream fragments, respectively.

[0067] The reaction system for upstream fragment amplification is:

[0068] P1 2μL 352-F 2μL tyrmF337I 2μL PrimerStarMax Enzyme 25μL <![CDATA[ddH2O]]> 19μL

[0069] The reaction system for downstream fragment amplification is:

[0070] P2 2μL 352-R 2μL tyrmF337I 2μL PrimerStarMax Enzyme 25μL <![CDATA[ddH2O]]> 19μL

[0071] The amplification program was as follows: pre-denaturation at 98°C for 30 min; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, and extension at 72°C for 5 s for 30 cycles; and extension at 72°C for 10 min.

[0072] 6. After gel excision and recovery of upstream and downstream fragments, PCR 5 was performed. The reaction system was:

[0073] Upstream fragment 2.0μL Downstream fragment 2.0μL PrimerStarMax Enzyme 25μL <![CDATA[ddH2O]]> 21μL

[0074] The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, extension at 72°C for 5 s, 5 cycles; and extension at 72°C for 10 min.

[0075] After PCR 5, 2 μL of primers P1 and P2 were added to the system, and the PCR 3 amplification program was as follows: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 55°C annealing for 20 s, 72°C extension for 6 s, 5 cycles; 72°C extension for 10 min. The PCR amplification product was subjected to 0.8% agarose gel electrophoresis, and the PCR product was recovered using a small amount of DNA recovery kit to obtain the tyrosinase mutant F337I / F352I encoding gene tyrmF337I / F352I.

[0076] 7. The obtained tyrosinase site-directed mutant gene tyrmF337I / F352I was connected to the vector pET-22b(+) and transformed into JM109, and the plasmid was extracted to obtain the recombinant plasmid pET-tyrmF337I / F352I. The recombinant plasmid pET-tyrmF337I / F352I was then transformed into Escherichia coli BL21, and a single mutant colony was picked and inoculated into a liquid LB medium containing Amp resistance for culture. The extracted plasmid was sent for sequencing to determine the sequence of the mutant F337I / F352I gene tyrmF337I / F352I.

[0077] Example 3: Expression, purification and activity determination of tyrosinase

[0078] 1. Induced expression of tyrosinase strains

[0079] (1) Pick a single colony of BL21 / pET-tyr and BL21 / pET-tyrmF337I / F352I on the LB plate, inoculate it into a 5 mL LB tube (containing 50 μg / mL Amp), and place it in a shaker at 37°C for 10 h;

[0080] (2) Transfer the recombinant bacterial suspension into 250 mL LB medium (final concentration 50 μg / mL Amp) and place in a shaker at 37°C for 2-2.5 h;

[0081] (3) Add 125 μL of IPTG (final concentration 0.5 mmol / L) and induce the culture in a shaking incubator at 16°C for 16-20 h;

[0082] (4) The fermentation broth was purified to prepare wild-type tyrosinase and tyrosinase mutants F337I / F352I.

[0083] 2. Ni column purification of recombinant protein

[0084] (1) Broken bacteria

[0085] The fermentation broth was collected using a centrifuge cup and centrifuged at 10,000 rpm for 15 min. The supernatant was discarded and 20 mL of Lysis buffer was added to blow the bacteria away. Ultrasound was used to break the bacteria, destroy the cell wall and release the protein inside the bacteria.

[0086] After the disruption was completed, the bacterial solution was poured into a 50 mL centrifuge tube and centrifuged at 12000 rpm for 30 min at 4°C to collect the supernatant.

[0087] (2) Combined with nickel column

[0088] a. Before the nickel column purification process, add an appropriate amount of ddH2O to the purification column and add two column volumes of Lysis buffer to balance the resin;

[0089] b. Mix the equilibrated resin and the supernatant of the bacteria, place them in a magnetic stirrer, and combine them at a speed of 80-100 r / min for 1 hour, while maintaining a low temperature (4°C) throughout the process.

[0090] (3) Protein purification

[0091] a. Add the binding solution to the purification column in 2-3 times in the chromatography cabinet;

[0092] b. After the binding solution is completely filtered out, add 10mL Wash buffer to elute the impurities bound to the resin;

[0093] c. Finally, add 10 mL of pre-cooled Elution Buffer to the purification column to elute all the target protein bound to the resin and collect the filtrate;

[0094] d. Transfer all the eluate to an ultrafiltration centrifuge tube, centrifuge and ultrafilter until 1 mL of the solution remains, add pre-cooled 50 mM, pH 7.0 Tris-HCl buffer, and repeat the replacement twice to obtain the purified protein.

[0095] 3. Tyrosinase activity assay principle

[0096] Under the catalysis of tyrosinase, L-tyrosine first forms DOPA, which will then continue to oxidize to form the red substance dopaquinone. Dopaquinone has a maximum absorbance coefficient at a wavelength of 410nm and can be detected, and the enzyme activity of tyrosinase can be calculated.

[0097] 4. Definition of tyrosinase activity

[0098] Under certain reaction conditions (unless otherwise specified, the conditions are: 60°C, pH 7.0), the amount of enzyme required to produce 1 μmol of dopaquinone per minute is defined as one enzyme activity unit, recorded as U / mL.

[0099] Enzyme activity formula: U / mL = (ΔOD×V1) / (Δt×V2)

[0100] Note: ΔOD: represents the change in absorbance from the beginning to the end of the reaction;

[0101] V1: represents the total volume of the reaction system;

[0102] Δt: represents the time from the start to the end of the reaction;

[0103] V2: represents the volume of enzyme solution in the reaction system;

[0104] Specific enzyme activity (U / mg) = enzyme activity / protein concentration.

[0105] 5. The method and steps for determining the activity of tyrosinase used in the present invention are as follows: 180 μL of the reaction solution is kept at 60°C and pH 7.0 for 1 min, 20 μL of the enzyme solution is added thereto, and the OD value is detected at 410 nm using a microplate reader after reacting at 60°C for 3 min. Each sample contains 3 sets of parallel experiments.

[0106] Blank control: Treat the enzyme solution at 100°C for 10 min to inactivate the enzyme, and use the heat-inactivated enzyme solution as a control. The reaction system and method are the same as above.

[0107] Note: Reaction solution: 2mmol / L L-tyrosine solution: Accurately weigh 36mg / L L-tyrosine and CuCl2 with a final concentration of 2μmol / L, dissolve them in Tris-HCl (pH7.0) and make up to 100mL, and store in a refrigerator at 4℃.

[0108] The final calculated activity ratio of wild-type TYR and F337I / F352I mutant is as follows:

[0109] Tyrosinase Specific enzyme activity (U / mg) WT 13.67 F337I / F352I 20.92

[0110] Example 4 Expression and preparation of tyrosinase mutants in Bacillus subtilis

[0111] The tyrosinase mutant F337I / F352I encoding gene tyrmF337I / F352I and the wild-type tyrosinase encoding gene tyr were connected to the expression plasmid pBSA43 to obtain new recombinant plasmids pBSA43-tyrmF337I / F352I and pBSA43-tyr respectively;

[0112] The recombinant plasmids were transformed into Bacillus subtilis WB600, and the mutant recombinant bacteria WB600 / pBSA43-tyrmF337I / F352I and the wild-type tyrosinase recombinant bacteria WB600 / pBSA43-tyr were obtained by kanamycin (Kan) resistance screening and enzyme digestion verification.

[0113] The recombinant strains WB600 / pBSA43-tyrmF337I / F352I and WB600 / pBSA43-tyr were inoculated into 5 mL of fermentation medium (containing kanamycin, 50 μg / mL), respectively, and cultured at 37°C, 220 r / min overnight. They were transferred to 50 mL of fresh fermentation medium (containing kanamycin, 50 μg / mL) according to the 2% inoculum amount and cultured at 37°C, 220 r / min for 48 h (fermentation medium (g / L): corn flour 64, soybean cake powder 40, 2.7 amylase, Na2HPO44, KH2PO40.3, and the rest was water; kept at 90°C for 30 min and sterilized at 121°C for 20 min).

[0114] The enzyme activity of tyrosinase obtained by fermentation of Bacillus subtilis was determined using the method described in Example 3-5 (the fermentation broth was centrifuged and the supernatant was taken to determine the enzyme activity). In Bacillus subtilis, the wild-type enzyme activity was 67.8 U / mL, and the F337I / F352I fermentation enzyme activity was 103.9 U / mL.

[0115] Example 5 Expression and preparation of tyrosinase mutants in recombinant strains of Bacillus amyloliquefaciens

[0116] The tyrosinase mutant F337I / F352I encoding gene tyrmF337I / F352I and the wild-type tyrosinase encoding gene tyr were connected to the expression plasmid pBSA43 to obtain new recombinant plasmids pBSA43-tyrmF337I / F352I and pBSA43-tyr respectively;

[0117] The recombinant plasmids were respectively transferred into Bacillus amyloliquefaciens CGMCC No.11218, and the mutant recombinant bacteria CGMCC No.11218 / pBSA43-tyrmF337I / F352I and the wild-type tyrosinase recombinant bacteria CGMCC No.11218 / pBSA43-tyr were obtained by kanamycin (Kan) resistance screening and enzyme digestion verification.

[0118] The recombinant strains CGMCC No.11218 / pBSA43-tyrmF337I / F352I and CGMCCNo.11218 / pBSA43-tyr were inoculated into 5 mL of fermentation medium (containing kanamycin, 50 μg / mL), cultured overnight at 37°C, 220 r / min, transferred to 50 mL of fresh fermentation medium (containing kanamycin, 50 μg / mL) according to 2% inoculum, and continued to be cultured at 37°C, 220 r / min for 48 h (fermentation medium (g / L): corn flour 64, soybean cake powder 40, 2.7 amylase, Na2HPO44, KH2PO40.3, the rest is water; keep warm at 90°C for 30 min and sterilize at 121°C for 20 min).

[0119] The tyrosinase activity obtained by fermentation of Bacillus amyloliquefaciens was determined using the method described in Example 3-5 (the fermentation broth was centrifuged and the supernatant was taken to determine the enzyme activity). In Bacillus amyloliquefaciens, the wild-type enzyme activity was 127.9 U / mL, and the fermentation enzyme activity of F337I / F352I was 199.6 U / mL.

[0120] Example 6 Expression and preparation of tyrosinase mutants in recombinant strains of Bacillus licheniformis

[0121] The recombinant plasmids pBSA43-tyrmF337I / F352I and pBSA43-tyr were respectively transferred into Bacillus licheniformis TCCC2709, and the wild-type recombinant strain TCCC2709 / pBSA43-tyr and the mutant recombinant strain TCCC2709 / pBSA43-tyrmF337I / F352I were obtained by kanamycin (Kan) resistance screening and enzyme digestion verification.

[0122] The mutant recombinant strain TCCC2709 / pBSA43-tyrmF337I / F352I of Bacillus licheniformis and the wild-type recombinant strain TCCC2709 / pBSA43-tyr were inoculated into 5 mL of fermentation medium (containing kanamycin, 50 μg / mL), cultured overnight at 37°C, 220 r / min, and transferred to 50 mL of fresh fermentation medium (containing kanamycin, 50 μg / mL) according to the inoculum of 2%, and continued to be cultured at 37°C, 220 r / min for 48 hours. (Fermentation medium (g / L): corn flour 64, soybean meal 40, 2.7 amylase, Na2HPO44, KH2PO40.3, the rest is water; keep warm at 90°C for 30 minutes and sterilize at 121°C for 20 minutes.)

[0123] The activity of tyrosinase obtained by fermentation of Bacillus licheniformis was determined by the method in Example 3-5 (the fermentation broth was centrifuged and the supernatant was taken to determine the enzyme activity). In Bacillus licheniformis, the wild-type enzyme activity was 165.7 U / mL, and the fermentation enzyme activity of F337I / F352I was 252.1 U / mL.

[0124] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent. It should be pointed out that, for ordinary technicians in this field, the above-mentioned implementation methods can also be modified, combined and improved without departing from the concept of this patent, which all belong to the protection scope of this patent. Therefore, the protection scope of this patent shall be based on the claims.

Claims

1. A tyrosinase mutant, characterized in that: The tyrosinase mutant is obtained by causing F337I / F352I mutations to occur on the basis of the wild-type tyrosinase shown in SEQ ID NO.

1.

2. A tyrosinase mutant according to claim 1, characterized in that: The tyrosinase mutant is a F337I / F352I mutant, and the amino acid sequence is shown in SEQ ID NO.

3.

3. A gene encoding the tyrosinase mutant according to claim 1 or 2.

4. A recombinant plasmid or recombinant strain comprising the mutant encoding gene according to claim 3.

5. The recombinant plasmid or recombinant strain according to claim 4, characterized in that: The expression vectors are pLY-3 and pBSA43; the host cells are Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No.11218 and Bacillus licheniformis 2709.

Images