A tyrosinase mutant, its preparation and application
By constructing the F337I/F352I mutant through site-directed mutagenesis of the tyrosinase gene of Bacillus wieldimannii, the low conversion rate and environmental pollution problems of the existing tyrosinase-catalyzed synthesis of L-dopa were solved, and efficient and low-cost L-dopa production was achieved.
Patent Information
- Application Number
- CN202510015769.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-06
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2045-01-06
AI Technical Summary
Existing methods for tyrosinase-catalyzed synthesis of L-dopa have problems such as low conversion rate, poor enantioselectivity, complex reaction steps and high cost. In addition, plant extraction and chemical synthesis methods cause serious environmental pollution and are difficult to meet industrial needs.
By performing site-directed mutagenesis on the tyrosinase gene from Bacillus Weizmannii, the F337I/F352I mutant was constructed and efficiently expressed in the Escherichia coli expression system to improve the activity of tyrosinase. The tyrosinase was then efficiently prepared in Bacillus subtilis, Bacillus amyloliquefaciens and Bacillus licheniformis using the Bacillus expression system.
The activity of tyrosinase was increased to 153% of the wild type, and high-efficiency expression was achieved in the Bacillus expression system, which reduced production costs, simplified reaction steps, increased L-dopa yield and conversion rate, and reduced environmental pollution.
Smart Images

Figure CN119799665B_ABST
Abstract
Description
Technical field:
[0001] The invention belongs to the technical field of bioengineering, and particularly relates to a tyrosinase mutant with improved enzyme activity obtained through molecular modification and application thereof. Background technology:
[0002] Tyrosinase (EC 1.14.18.1, tyrosinase, TYR), also known as polyphenol oxidase and catechol oxidase, is a binuclear copper-containing oxidoreductase. Tyrosinase is generally copper-dependent, requiring copper ions for its activity. Tyrosinase is an important bifunctional enzyme that catalyzes the conversion of monophenols to diphenols (monophenolase activity) and the corresponding quinones (diphenolase activity). Quinones, in turn, form melanin through a non-enzymatic redox reaction. Tyrosinases are found in abundance across all domains of life, from bacteria to mammals. These sources allow for the isolation and purification of tyrosinases, which can then be used in a variety of applications. Bacterial tyrosinases were first identified in Streptomyces, followed by several members of other bacterial genera, such as Thermomicrobium, Marinomonas, Rhizobium, Bacillus, and Pseudomonas. Fungal tyrosinases were first characterized from Agaricus bisporus. Further research has been conducted on tyrosinases from other fungi, such as Neurospora crassa, Lentinus edodes, Aspergillus, and Amanita. Plants are also good sources of tyrosinase. Studies of tyrosinase in various fruits and vegetables have revealed that Portulaca oleracea is a potent source of tyrosinase. Further research has also examined tyrosinase in eggplant, sunflower seeds, apples, and grapes.
[0003] L-DOPA, a precursor of dopamine, is an effective and well-tolerated dopamine replacement drug for the treatment of Parkinson's disease (PD). As a precursor of the neurotransmitter dopamine in the human brain, L-DOPA can cross the blood-brain barrier and be converted into dopamine, making it the most effective drug for Parkinson's disease. L-DOPA can also treat other diseases. For example, L-DOPA and related compounds are effective inhibitors in development for systemic amyloidosis. The market for L-DOPA is enormous, with an annual global demand of approximately 250 tons and a total market capacity of approximately 101 billion yuan. L-DOPA is currently extracted through plant extraction, chemical synthesis, and biosynthesis. L-DOPA is naturally present in plants such as faba beans, cat beans, mucuna beans, and sesame vines, but the content of L-DOPA in plants is relatively low. Furthermore, plant extraction methods typically use concentrated mineral or organic acids, which can easily cause environmental pollution. At the same time, in plant extraction methods, strong acid is required, and the extraction time is long and the downstream processing is complicated, which greatly increases the extraction cost of L-DOPA. At the same time, the energy consumption is huge, which seriously limits its industrial application. At present, the chemical synthesis of L-DOPA mostly uses hydantoin and vanillin as starting materials. However, the chemical synthesis of L-DOPA has key limitations, such as low conversion rate and low enantioselectivity. Chemical synthesis usually adopts complex reaction steps and requires expensive metal catalysts (for example, Rb-complex), which work under harsh operating conditions and have substrate specificity, and therefore gradually withdraw from the industrial market. Compared with chemical synthesis, enzymatic catalytic synthesis of L-DOPA has the advantages of high yield, high conversion rate, simple reaction steps, mild conditions, etc. At present, tyrosinase can catalyze the synthesis of L-DOPA using tyrosine as a substrate.
[0004] Irrational protein molecular design involves subjecting a protein to numerous mutations under certain conditions, without knowing its three-dimensional structure or mechanism of action. The desired mutants are then selected through multiple rounds of high-throughput screening. Rational molecular design, based on the known three-dimensional structure and function of a protein, involves targeted mutation of a gene sequence most likely to affect its function and properties, purposefully altering one or two amino acid residues or modules within the protein to construct a new protein molecule. Compared to irrational design, rational design offers the advantages of less effort and greater ease in obtaining effective mutants.
[0005] As a safe, efficient, versatile, and highly promising microbial strain, the Bacillus expression system has been widely used in industry, agriculture, medicine, health, food, animal husbandry, aquaculture, and scientific research. Compared to the commonly used Escherichia coli expression system, it offers a unique advantage: the product of the target gene can be secreted extracellularly, thereby reducing the cost and workload of further collection, isolation, and purification of the gene expression product. Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, and Bacillus megaterium are among the Bacillus species that can serve as expression hosts. With the advancement of molecular biology techniques and the deepening of Bacillus research, a large number of genes have been cloned and expressed using Bacillus expression systems, some of which have been put into large-scale industrial production. Numerous enzymes, clinically required chemical drugs, and industrial products are produced through Bacillus expression.
[0006] In the present invention, a tyrosinase mutant gene with enhanced activity is obtained by directed evolution of a wild-type tyrosinase gene, and efficient expression of tyrosinase is achieved in a Bacillus expression system to obtain a tyrosinase mutant strain with enhanced activity. Summary of the invention:
[0007] To address the application challenges of tyrosinase, further modifications to its existing properties are necessary to obtain an enzyme with enhanced activity. The present invention aims to provide a tyrosinase mutant with enhanced activity. The tyrosinase gene (tyr) from Bacillus wiedmannii was expressed in Escherichia coli BL21. Overlapping PCR was used to mutate the tyr gene, yielding a mutant with enhanced activity.
[0008] The technical route for achieving the purpose of the present invention is summarized as follows:
[0009] Site-directed mutagenesis of tyrosinase TYR from Bacillus wiedmannii was performed to generate the mutant F337I / F352I and the encoding gene tyrmF337I / F352I. Enzyme activity was increased to 153% of wild-type tyrosinase (TYR). The mutant F337I / F352I was efficiently prepared using Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No. 11218, and Bacillus licheniformis 2709.
[0010] One of the technical solutions provided by the present invention is a tyrosinase mutant, which is obtained by adding F337I and F352I to the wild-type tyrosinase shown in SEQ ID NO.1;
[0011] Furthermore, the tyrosinase mutant is a F337I / F352I mutant, and the amino acid sequence is shown in SEQ ID NO.3;
[0012] Furthermore, the nucleotide sequence of the gene encoding the F337I / F352I mutant, tyrmF337I / F352I, is shown in SEQ ID NO.4;
[0013] The second technical solution provided by the present invention is a recombinant plasmid or recombinant strain containing the above mutant encoding gene;
[0014] Furthermore, the expression vector used was pET-22b(+), and the host was Escherichia coli;
[0015] Furthermore, the host cell is Escherichia coli BL21;
[0016] Preferably, the recombinant strain is obtained by connecting the mutant encoding gene to the expression vector pET-22b(+) and expressing it in the host Escherichia coli.
[0017] Furthermore, in the Bacillus, the expression vector used by the recombinant plasmid is pBSA43, and the host cell is Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No.11218 or Bacillus licheniformis 2709.
[0018] The third technical solution provided by the present invention is the use of the above-mentioned recombinant plasmid or recombinant strain in producing the tyrosinase mutant described in the first technical solution.
[0019] The following definitions are used in the present invention:
[0020] 1. Nomenclature of amino acid and DNA sequences
[0021] The generally accepted IUPAC nomenclature for amino acid residues is used, using the three-letter code. The generally accepted IUPAC nomenclature for DNA nucleic acid sequences is used.
[0022] 2. Identification of Tyrosinase Mutants
[0023] The term "amino acid substituted at the original amino acid position" is used to represent the mutated amino acid in the TYR mutant. For example, Phe337Ile indicates that the amino acid at position 337 is substituted from Phe in wild-type TYR to Ile, and the position number corresponds to the amino acid sequence number of wild-type TYR in SEQ ID No. 1.
[0024] In the present invention, TYR represents wild-type tyrosinase, lowercase italic tyr represents the encoding gene of wild-type TYR, and lowercase italic tyrmF337I / F352I represents the encoding gene of mutant F337I / F352I, as shown in the following table.
[0025]
[0026] Beneficial effects:
[0027] The present invention performs site-directed mutagenesis on wild-type TYR to obtain a mutant F337I / F352I with enhanced activity. Description of the drawings:
[0028] Figure 1 This is the electrophoresis diagram of the PCR amplification of the TYR mutant F337I / F352I gene of the present invention, wherein M is DNA Marker and 1 is the TYR mutant F337I / F352I gene;
[0029] Figure 2 : This is the enzyme digestion verification diagram of the recombinant plasmid pET-22b(+)-tyrmF337I / F352I of the present invention, wherein M is DNA Marker, and 1 is the electrophoresis diagram of the recombinant plasmid pET-22b(+)-tyrmF337I / F352I double enzyme digestion;
[0030] Figure 3 The figure is an SDS-PAGE diagram of the wild-type TYR and the TYR mutant F337I / F352I after purification of the present invention, wherein: M is a protein marker, 1 is a purified sample of the wild-type TYR, and 2 is a purified sample of the mutant F337I / F352I. Specific implementation method:
[0031] The technical content of the present invention will be further described below in conjunction with the embodiments, but the present invention is not limited to these embodiments, and the protection scope of the present invention cannot be limited by the following embodiments.
[0032] Some of the solutions and culture media used in the examples of the present invention are as follows:
[0033] Lysis buffer (mM): Tris 20, NaCl 500, dithiothreitol 1, imidazole 20.
[0034] Wash buffer (mM): Tris 20, NaCl 500, dithiothreitol 1, imidazole 100.
[0035] Elution Buffer (mM): Tris 20, NaCl 500, dithiothreitol 1, imidazole 500.
[0036] LB medium (g / L): 5.0% yeast extract, 10.0% tryptone, 10.0% NaCl, and the remainder water. For solid medium, 2% agar was added.
[0037] In the present invention, the mature peptide sequence of wild-type tyrosinase TYR is shown in SEQ ID NO.1: MRIRKNQANLTHSERLAFTNALLELKRKPSRLPSSSGSTSRYDDYVYWHLMSMMNQTSSTPGSAHGGPAFLPWHRYYINQLELDLQQIDSTVTLPYWDWTVNNSIDPSASGSPWTNDFMGGDGDPNQGYAVTTGPFTGDNWKLTLFDDHHSDEPQDIRLRRQLGTLKNSSGATISINLPTNSEVQNCLLETPYYVSPWRAFQDLNNPSSMTVTKPSFCNRLEGWYGDGRIHNQVHLWVAGATQGSMYWMSSPNDPVFFLHHANVDRLWAQWQVANPNEGYHPTGTGSEVGPTGHNLNDPMKPWGNSVTPNSVLNHHSLGYAYDTDPTPLSEILIRAFNTEITTEKKVSIGSFITREDLEKM
[0038] In the present invention, the mature peptide sequence of the F337I / F352I mutant is as SEQ ID Shown in NO.3: MRIRKNQANLTHSERLAFTNALLELKRKPSRLPSSSGSTSRYDDYVYWHLMSMMNQTSSTPGSAHGGPAFLPWHRYYINQLELDLQQIDSTVTLPYWDWTVNNSIDPSASGSPWTNDFMGGDGDPNQGYAVTTGPFTGDNWKLTLFDDHHSDEPQDIRLRRQLGTLKNSSGATISIN LPTNSEVQNCLLETPYYVSPWRAFQDLNNPSSMTVTKPSFCNRLEGWYGDGRIHNQVHLWVAGATQGSMYWMSSPNDPVFFLHHANVDRLWAQWQVANPNEGYHPTGTGSEVGPTGHNLNDPMKPWGNSVTPNSVLNHHSLGYAYDTDPTPLSEILIRAINTEITTEKKVSIGSIITREDLEKM
[0039] The present invention will be further explained below through specific examples.
[0040] Example 1: Synthesis of wild-type TYR encoding gene tyr
[0041] 1. Submit the TYR gene (NCBI Number: WP_098828762.1) to GENEWIZ for synthesis and cloning into the plasmid pET-22b(+). This yields the recombinant plasmid pET-tyr. The recombinant plasmids are then transformed into competent E. coli BL21 cells, yielding the recombinant strain BL21 / pET-tyr.
[0042] Example 2: Construction of tyrosinase mutants
[0043] 1. Construction of TYR mutants
[0044] The amplification primers for the mutant TYR encoding gene tyrm were designed, and the sequences are as follows:
[0045] Upstream P1:
[0046] AAATAATTTTGTTTAACTTTAAGAAGGAGA
[0047] Downstream P2:
[0048] GGTGGTGGTGGTGGTG
[0049] The amino acids at positions 337 and 352 were selected for mutation, and the mutation primers were designed according to the mutation sites as shown in Table 1 below.
[0050] Table 1 Mutation primers are as follows:
[0051]
[0052] The tyrosinase mutant F337I / F352I was constructed by site-directed mutagenesis based on overlapping PCR technology.
[0053] First, construct the mutant F337I:
[0054] In the first step of overlapping PCR, P1 and 337-F were used as upstream and downstream primers, and P2 and 337-R were used as upstream and downstream primers, respectively. Using plasmid pET-tyr as a template, PCR1 was performed to obtain the upstream and downstream fragments, respectively.
[0055] The reaction system for upstream fragment amplification is:
[0056] P1 2μL 337-F 2μL Wild-type tyrosinase gene 2μL PrimerStarMax Enzyme 25 μL <![CDATA[ddH2O]]> 19 μL
[0057] The reaction system for downstream fragment amplification is:
[0058] P2 2μL 337-R 2μL Wild-type tyrosinase gene 2μL PrimerStarMax Enzyme 25 μL <![CDATA[ddH2O]]> 19 μL
[0059] The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, and extension at 72°C for 5 s, for 30 cycles; and extension at 72°C for 10 min.
[0060] 2. After gel excision and recovery of upstream and downstream fragments, PCR 2 was performed. The reaction system was:
[0061] Upstream fragment 2.0 μL Downstream fragment 2.0 μL PrimerStarMax Enzyme 25 μL <![CDATA[ddH2O]]> 21 μL
[0062] The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 54°C for 20 s, and extension at 72°C for 7 s, for 5 cycles; and extension at 72°C for 10 min.
[0063] 3. After PCR 2, 2 μL each of primers P1 and P2 were added to the system. PCR 3 was performed using the following protocol: pre-denaturation at 98°C for 30 seconds, followed by five cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 20 seconds, and extension at 72°C for 6 seconds, and finally extension at 72°C for 10 minutes. The PCR product was subjected to 0.8% agarose gel electrophoresis and recovered using a mini DNA recovery kit to obtain the site-directed mutation of the tyrosinase-encoding gene, tyrmF337I.
[0064] 4. The tyrosinase site-directed mutant gene tyrm F337I was ligated with the expression vector pET-22b(+) and transformed into JM109. The plasmid was extracted to obtain the recombinant plasmid pET-tyrmF337I. The recombinant plasmid pET-tyrmF337I was then transformed into Escherichia coli BL21. A single mutant colony was picked and inoculated into liquid LB medium containing Amp resistance for culture. The plasmid was extracted and sequenced to confirm that the F337I mutant gene tyrmF337I was obtained.
[0065] 5. Based on the F337I site-directed mutagenesis, the F352I site-directed mutagenesis was performed using overlapping PCR technology to construct a new tyrosinase.
[0066] In the first step of overlapping PCR reaction system, P1 and 352-F were used as upstream and downstream primers, and P2 and 352-R were used as upstream and downstream primers, respectively, to carry out PCR4 reaction to obtain upstream fragments and downstream fragments, respectively.
[0067] The reaction system for upstream fragment amplification is:
[0068] P1 2μL 352-F 2μL tyrmF337I 2μL PrimerStarMax Enzyme 25 μL <![CDATA[ddH2O]]> 19 μL
[0069] The reaction system for downstream fragment amplification is:
[0070] P2 2μL 352-R 2μL tyrmF337I 2μL PrimerStarMax Enzyme 25 μL <![CDATA[ddH2O]]> 19 μL
[0071] The amplification program was as follows: pre-denaturation at 98°C for 30 min; 30 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 20 s, and extension at 72°C for 5 s; and extension at 72°C for 10 min.
[0072] 6. After gel excision and recovery of upstream and downstream fragments, perform PCR 5. The reaction system is:
[0073] Upstream fragment 2.0 μL Downstream fragment 2.0 μL PrimerStarMax Enzyme 25 μL <![CDATA[ddH2O]]> 21 μL
[0074] The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, and extension at 72°C for 5 s, for 5 cycles; and extension at 72°C for 10 min.
[0075] After PCR 5, 2 μL of primers P1 and P2 were added to the system. PCR 3 amplification was performed using the following protocol: pre-denaturation at 98°C for 30 seconds, followed by five cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 20 seconds, and extension at 72°C for 6 seconds, followed by extension at 72°C for 10 minutes. The PCR product was electrophoresed on a 0.8% agarose gel and recovered using a mini DNA recovery kit to obtain the gene encoding the tyrosinase mutant F337I / F352I, tyrmF337I / F352I.
[0076] 7. The obtained tyrosinase site-directed mutant gene tyrmF337I / F352I was ligated with the vector pET-22b(+) and transformed into JM109. The plasmid was extracted to obtain the recombinant plasmid pET-tyrmF337I / F352I. The recombinant plasmid pET-tyrmF337I / F352I was then transformed into Escherichia coli BL21. A single mutant colony was picked and inoculated into liquid LB medium containing Amp resistance for culture. The plasmid was extracted and sent for sequencing to confirm the sequence of the mutant F337I / F352I gene tyrmF337I / F352I.
[0077] Example 3: Expression, purification and activity determination of tyrosinase
[0078] 1. Induced expression of tyrosinase strains
[0079] (1) Pick a single colony of BL21 / pET-tyr and BL21 / pET-tyrmF337I / F352I from an LB plate, inoculate it into a 5 mL LB tube (containing 50 μg / mL Amp), and culture it in a shaker at 37°C for 10 h.
[0080] (2) Transfer the recombinant bacterial suspension into 250 mL of LB medium (final concentration of 50 μg / mL Amp) and culture in a shaker at 37°C for 2-2.5 h.
[0081] (3) Add 125 μL of IPTG (final concentration 0.5 mmol / L) and induce the culture in a shaking incubator at 16°C for 16-20 h;
[0082] (4) The fermentation broth was purified to prepare wild-type tyrosinase and tyrosinase mutant F337I / F352I.
[0083] 2. Ni column purification of recombinant protein
[0084] (1) Broken cells
[0085] The fermentation broth was collected using a centrifuge cup and centrifuged at 10,000 rpm for 15 min. The supernatant was discarded and 20 mL of Lysis buffer was added to aspirate the bacteria. Ultrasonic waves were used to disrupt the bacteria, destroy the cell walls and release the proteins inside the bacteria.
[0086] After the disruption was completed, the bacterial solution was poured into a 50 mL centrifuge tube and centrifuged at 12000 rpm for 30 min at 4°C to collect the supernatant.
[0087] (2) Combined with nickel column
[0088] a. Before the nickel column purification process, add an appropriate amount of ddH2O to the purification column and add two column volumes of Lysis buffer to balance the resin;
[0089] b. Mix the equilibrated resin and bacterial supernatant, place in a magnetic stirrer, and combine at a speed of 80-100 r / min for 1 hour, while maintaining a low temperature (4°C) throughout the process.
[0090] (3) Protein purification
[0091] a. Add the binding solution to the purification column in 2-3 times in the chromatography cabinet;
[0092] b. After the binding solution is completely filtered out, add 10 mL of wash buffer to elute the impurities bound to the resin;
[0093] c. Finally, add 10 mL of pre-chilled Elution Buffer to the purification column to elute all the target protein bound to the resin and collect the filtrate;
[0094] d. Transfer the entire eluate to an ultrafiltration centrifuge tube and centrifuge until 1 mL of the solution remains. Then, add pre-chilled 50 mM Tris-HCl buffer, pH 7.0, and repeat the replacement twice to obtain the purified protein.
[0095] 3. Principle of tyrosinase activity assay
[0096] Under the catalysis of tyrosinase, L-tyrosine first forms dopa, which will continue to oxidize to form the red substance dopaquinone. Dopaquinone has a maximum absorbance coefficient at a wavelength of 410nm and can be detected, and the enzymatic activity of tyrosinase can be calculated.
[0097] 4. Definition of tyrosinase activity
[0098] Under certain reaction conditions (unless otherwise specified, the conditions are: 60°C, pH 7.0), the amount of enzyme required to produce 1 μmol of dopaquinone per minute is defined as one enzyme activity unit, recorded as U / mL.
[0099] Enzyme activity formula: U / mL = (ΔOD × V1) / (Δt × V2)
[0100] Note: ΔOD: represents the change in absorbance from the start to the end of the reaction;
[0101] V1: represents the total volume of the reaction system;
[0102] Δt: represents the time from the start to the end of the reaction;
[0103] V2: represents the volume of enzyme solution in the reaction system;
[0104] Specific enzyme activity (U / mg) = enzyme activity / protein concentration.
[0105] 5. Tyrosinase activity assay method used in the present invention: Incubate 180 μL of the reaction solution at 60°C, pH 7.0 for 1 minute. Add 20 μL of enzyme solution to the solution. Incubate at 60°C for 3 minutes. Measure the OD value at 410 nm using a microplate reader. Three parallel experiments were performed on each sample.
[0106] Blank control: The enzyme solution was treated at 100°C for 10 min to inactivate the enzyme. The heat-inactivated enzyme solution was used as a control. The reaction system and method were the same as above.
[0107] Note: Reaction solution: 2 mmol / L L-tyrosine solution: Accurately weigh 36 mg / L L-tyrosine and CuCl2 with a final concentration of 2 μmol / L, dissolve them in Tris-HCl (pH 7.0) and dilute to 100 mL. Store in a refrigerator at 4°C.
[0108] The final calculated specific activity of wild-type TYR and F337I / F352I mutant is as follows:
[0109] Tyrosinase Specific enzyme activity (U / mg) WT 13.67 F337I / F352I 20.92
[0110] Example 4 Expression and Preparation of Tyrosinase Mutants in Bacillus subtilis
[0111] The tyrosinase mutant F337I / F352I encoding gene tyrmF337I / F352I and wild-type tyrosinase encoding gene tyr were ligated with expression plasmid pBSA43 to obtain new recombinant plasmids pBSA43-tyrmF337I / F352I and pBSA43-tyr, respectively.
[0112] The recombinant plasmids were transformed into Bacillus subtilis WB600, and the mutant recombinant bacteria WB600 / pBSA43-tyrmF337I / F352I and the wild-type tyrosinase recombinant bacteria WB600 / pBSA43-tyr were obtained after kanamycin (Kan) resistance screening and enzyme digestion verification.
[0113] The recombinant strains WB600 / pBSA43-tyrmF337I / F352I and WB600 / pBSA43-tyr were inoculated into 5 mL of fermentation medium (containing kanamycin, 50 μg / mL), cultured overnight at 37°C, 220 r / min, and transferred to 50 mL of fresh fermentation medium (containing kanamycin, 50 μg / mL) at a 2% inoculum size, and cultured at 37°C, 220 r / min for another 48 h (fermentation medium (g / L): 64 g of corn flour, 40 g of soybean meal, 2.7 g of amylase, 4 g of Na2HPO4, 0.3 g of KH2PO4, and the remainder was water; kept at 90°C for 30 min and sterilized at 121°C for 20 min).
[0114] Tyrosinase activity obtained by fermentation of Bacillus subtilis was determined using the method described in Example 3-5 (the fermentation broth was centrifuged and the supernatant was collected for determination of enzyme activity). In Bacillus subtilis, the wild-type enzyme activity was 67.8 U / mL, and the F337I / F352I fermentation enzyme activity was 103.9 U / mL.
[0115] Example 5 Expression and Preparation of Tyrosinase Mutants in Recombinant Bacillus amyloliquefaciens Strains
[0116] The tyrosinase mutant F337I / F352I encoding gene tyrmF337I / F352I and wild-type tyrosinase encoding gene tyr were ligated with expression plasmid pBSA43 to obtain new recombinant plasmids pBSA43-tyrmF337I / F352I and pBSA43-tyr, respectively.
[0117] The recombinant plasmids were transformed into Bacillus amyloliquefaciens CGMCC No.11218, and the mutant recombinant bacteria CGMCC No.11218 / pBSA43-tyrmF337I / F352I and the wild-type tyrosinase recombinant bacteria CGMCC No.11218 / pBSA43-tyr were obtained after kanamycin (Kan) resistance screening and enzyme digestion verification.
[0118] The recombinant strains CGMCC No.11218 / pBSA43-tyrmF337I / F352I and CGMCC No.11218 / pBSA43-tyr were inoculated into 5 mL of fermentation medium (containing kanamycin, 50 μg / mL), cultured at 37°C, 220 rpm overnight, and then transferred to 50 mL of fresh fermentation medium (containing kanamycin, 50 μg / mL) at a 2% inoculum size and cultured at 37°C, 220 rpm for 48 h (fermentation medium (g / L): 64 g corn flour, 40 g soybean meal, 2.7 g amylase, 4 g Na2HPO4, 0.3 g KH2PO4, and the rest water; kept at 90°C for 30 min and sterilized at 121°C for 20 min).
[0119] Tyrosinase activity obtained by fermentation of Bacillus amyloliquefaciens was determined using the method described in Example 3-5 (the fermentation broth was centrifuged and the supernatant was collected for determination of enzyme activity). In Bacillus amyloliquefaciens, the wild-type enzyme activity was 127.9 U / mL, and the F337I / F352I fermentation enzyme activity was 199.6 U / mL.
[0120] Example 6 Expression and Preparation of Tyrosinase Mutants in Recombinant Bacillus licheniformis Strains
[0121] The recombinant plasmids pBSA43-tyrmF337I / F352I and pBSA43-tyr were respectively transformed into Bacillus licheniformis TCCC2709. After kanamycin (Kan) resistance screening and enzyme digestion verification, the wild-type recombinant strain TCCC2709 / pBSA43-tyr and the mutant recombinant strain TCCC2709 / pBSA43-tyrmF337I / F352I were obtained.
[0122] The mutant recombinant strain TCCC2709 / pBSA43-tyrmF337I / F352I and the wild-type recombinant strain TCCC2709 / pBSA43-tyr were inoculated into 5 mL of fermentation medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C, 220 rpm. The inoculum was then transferred to 50 mL of fresh fermentation medium (containing 50 μg / mL kanamycin) at a 2% inoculum volume and cultured at 37°C, 220 rpm for another 48 hours. (Fermentation medium (g / L): 64% corn flour, 40% soybean meal, 2.7% amylase, 4% Na2HPO4, 0.3% KH2PO4, the remainder water; incubated at 90°C for 30 minutes and sterilized at 121°C for 20 minutes.)
[0123] The tyrosinase activity obtained by fermentation of Bacillus licheniformis was determined using the method described in Example 3-5 (the fermentation broth was centrifuged and the supernatant was collected for determination of enzyme activity). In Bacillus licheniformis, the wild-type enzyme activity was 165.7 U / mL, and the F337I / F352I fermentation enzyme activity was 252.1 U / mL.
[0124] The above-described embodiments merely represent several implementation methods of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that, without departing from the concept of this patent, a person skilled in the art would be able to make various variations, combinations, and improvements to the above-described embodiments, all of which fall within the scope of protection of this patent. Therefore, the scope of protection of this patent shall be determined by the claims.
Claims
1. A tyrosinase mutant, characterized in that: The tyrosinase mutant is based on the wild-type tyrosinase shown in SEQ ID NO. 1, with only the amino acids at positions 337 and 352 being replaced by wild-type phe with Ile, resulting in the F337I / F352I mutation.
2. A tyrosinase mutant according to claim 1, characterized in that: The tyrosinase mutant is a F337I / F352I mutant, and the amino acid sequence is shown in SEQ ID NO.
3.
3. A gene encoding the tyrosinase mutant according to claim 1 or 2.
4. A recombinant plasmid or recombinant strain comprising a gene encoding the mutant according to claim 3.
5. The recombinant plasmid or recombinant strain according to claim 4, characterized in that: The expression vector is pLY-3 or pBSA43; the host cell is Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No. 11218 or Bacillus licheniformis 2709.
Citation Information
Patent Citations
Tyrosinase as well as preparation and application thereof
CN113604445A
Tyrosinase as well as engineering bacteria, preparation method and application thereof
CN115851631A