Rice lpa1 gene and application thereof in regulating phosphorus nutrient accumulation in plants
By cloning and expressing the rice LPA1 gene, phosphorus accumulation was regulated, solving the problem of low phosphorus utilization in plants, improving rice growth and tolerance to abiotic stress, and increasing tiller number and yield.
Patent Information
- Application Number
- CN202411571797.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-06
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-11-06
AI Technical Summary
In existing technologies, plants have low phosphorus utilization and mobility, making it difficult to effectively regulate phosphorus nutrient accumulation and affecting plant growth and tolerance to abiotic stress.
By cloning and expressing the rice LPA1 gene, the accumulation of phosphorus in plants can be regulated, including overexpression and gene editing, to increase the expression level of LPA1 protein in rice and enhance its ability to accumulate phosphorus.
It significantly improved the accumulation of phosphorus nutrients in rice, enhanced plant growth and tolerance to abiotic stress, and increased the number of tillers and yield per plant.
Smart Images

Figure CN119799720B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant genetic engineering, and particularly relates to a rice LPA1 gene and its application in regulating plant phosphorus accumulation. BACKGROUND
[0002] Phosphorus is one of the essential macroelements for plant growth and development, and is involved in important processes such as signal transduction, photosynthesis and respiration, yield and quality formation. Adequate phosphorus can improve the tolerance of plants to various stress, but its utilization rate and mobility in plants are very low. Phosphorus in natural soil is mainly absorbed in the form of Pi (H 2 PO4 - , HPO4 2- and PO4 3- ), and the available Pi concentration is generally not more than 10 μmol / L, which is much lower than the optimal concentration for plant growth.
[0003] Histone modification, as one of the important ways of epigenetic research, includes methylation, acetylation, ubiquitination, adenylation and other post-translational covalent modifications of histone. Histone acetylation is a dynamic and reversible modification process, which is regulated by protein acetyltransferase and deacetylase, and is involved in important processes such as gene expression activity, genome stability and chromatin structure remodeling in organisms. In recent years, research on histone modification in rice has been emerging, and some acetyltransferase genes have been cloned in rice. These genes are involved in changing chromatin state, regulating the transcription of genes related to plant growth and development and stress response, thereby affecting the development of rice organs and the growth process at each stage. Song et al. found that HAT1 increased grain weight and yield and plant biomass by increasing cell number and accelerating grain filling to increase the husk, and increased the overall acetylation level of histone H4 (SONG X J, KUROHA T, AYANO M, et al .. Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice [J]. Proc. Natl. Acad. Sci. USA, 2015, 112 (1): 76-81); Ullah et al. found that HDA710 was involved in the regulation of salt stress response genes by changing the acetylation level of histone H4 in its promoter, and the knockout mutation hda710 could enhance the salt tolerance of rice (ULLAH F, XU Q, ZHAO Y, et alHistone deacetylase HDA710 controls salt tolerance by regulating ABA signaling in rice. J. Intergr. Plant Biol., 2021, 63: 451-467.) However, the application of histone acetylase genes in the accumulation of phosphorus nutrients in plants has not been reported. SUMMARY
[0004] The present application aims to provide a rice LPA1 gene and its application in regulating the accumulation of phosphorus nutrients in plants.
[0005] The present application aims to provide a rice LPA1 The polynucleotide of the LPA1 (a) a polynucleotide as shown in SEQ ID No: 1; or
[0006] (b) a polynucleotide capable of hybridizing to the complement of SEQ ID No: 1 under stringent hybridization conditions, the protein encoded by the polynucleotide still having the function of regulating the accumulation of phosphorus nutrients in plants;
[0007] (c) a polynucleotide having at least 90% or more homology with the polynucleotide shown in SEQ ID No: 1; or
[0008] (d) a polynucleotide mutant obtained by deleting, substituting or inserting one or more bases on the basis of the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still having the function of regulating the accumulation of phosphorus nutrients in plants.
[0009] The present application aims to provide a rice
[0010] (a) an amino acid sequence as shown in SEQ ID No: 2; or
[0011] (b) an amino acid having at least 90% or more homology with the amino acid shown in SEQ ID No: 2; or
[0012] (c) a protein mutant obtained by deleting, substituting or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still having the function of regulating the accumulation of phosphorus nutrients in plants.
[0013] The present application aims to provide a rice
[0014] The present application aims to provide a rice LPA1 gene and its application in regulating the accumulation of phosphorus nutrients in plants.
[0015] The rice containing the gene LPA1 The engineering bacteria of the gene carrier.
[0016] The rice is amplified LPA1 The primer of any fragment in the gene.
[0017] The rice LPA1 The application of the gene in regulating the phosphorus nutrient accumulation of plants.
[0018] A method for enhancing the phosphorus nutrient accumulation of rice, which improves the expression level of LPA1 protein in rice.
[0019] Advantages of the present application: the present application first identifies LPA1 The gene expression can obviously regulate the accumulation of phosphorus nutrients, and the mutation of rice LPA1 protein reduces the accumulation of phosphorus nutrients, and the overexpression of rice LPA1 protein enhances the accumulation of phosphorus nutrients. The protein and its encoding gene of the present application have important theoretical and practical significance for improving the phosphorus nutrient accumulation of plants and the yield of crops, and will play an important role in crop genetic breeding and have a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 The relative expression level of the gene in the rice overexpression transgenic plant LPA1 The relative expression level of the gene in the rice overexpression transgenic plant
[0021] Figure 2 The creation of rice LPA1 Cas9 gene editing mutant.
[0022] Figure 3 The leaf phenotype observation and inorganic phosphorus content of the rice LPA1 overexpression transgenic plant under normal condition culture.
[0023] Figure 4 The inorganic phosphorus staining observation of the inorganic phosphorus content in the leaf of the rice LPA1 overexpression transgenic plant under normal water culture condition.
[0024] Figure 5 The phenotype and plant height, tiller number, single plant yield and phosphorus content statistical determination and analysis of LPA1 overexpression and LPA1 mutant plant. DETAILED DESCRIPTION
[0025] In order to facilitate the understanding of the present application, the present application will be described more fully below. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.
[0026] The experimental materials used in the following examples are: rice material: SSBM; strains: Escherichia coli strain DH5α, Agrobacterium tumefaciens strain EHA105; overexpression vector: pCAMBIA1300.
[0027] pCAMBIA1300-HDA1 Overexpression vector construction: Using cDNA from the aboveground parts of rice SSBM grown under hydroponic conditions as a template, PCR amplification was performed using the upstream primer 5'-TCGAGGGGGGGCCCGGTACCATGTCGGGGCAGGCGCCG-3' (SEQ ID No: 3) and the downstream primer 5'-TCCTCACCATGTCGACCTACTCGTTTGCAGCAACTTCTGC-3' (SEQ ID No: 4). Approximately 5000 bp of the vector was purified and recovered. LPA1 Gene DNA fragments, used Kpn I endonuclease (NEB) and Sal The pCAMBIA1300 vector was digested with NEB (a restriction enzyme), and the digestion products were recovered. The digestion products were then processed using In-Fusion (Clontech). LPA1 The recovered fragment was ligated into the linearized pCAMBIA1300 vector to obtain the recombinant vector. pCAMBIA1300-HDA1 .
[0028] HDA1 Preparation of transgenic plants by overexpression: Using rice SSBM as background material, transgenic plants containing... pCAMBIA1300- HDA1 Agrobacterium EHA105 strain containing the vector was used to infect rice embryos, resulting in T0 generation transgenic positive plants. These T0 generation positive transgenic plants were then self-crossed twice to obtain homozygous transgenic plants. LPA1 Overexpression of transgenic rice materials. Two homozygous overexpression lines, #1 and #2, were selected and real-time quantitative PCR was performed using primer pairs consisting of 5'-GCACCATACTATACCGTTG-3' (SEQ ID No: 5) and 5'-CGTCATTCCTTTTTTTCTC-3' (SEQ ID No: 6).
[0029] The results are as follows Figure 1 As shown, compared to wild-type plants, LPA1-OE#1 And in the #2 strain of plants LPA1 The relative expression level of genes is increased.
[0030] Selecting genes LPA1 The target site is 45-66 bp of the CDS sequence (e.g. Figure 1 The homologous arm primer is LPA1 -u3-F:ggcAGTCACAGTACAACCAGGA (SEQ ID No: 7),LPA1 -u3-R: aaacTCCTGGTTGTACTGTGACT (SEQ ID No: 8);
[0031] LPA1 -u6a-F: ggcGCAACCTCAGATAAAAACTG (SEQ ID No: 9), LPA1 -u6a-R: aaacCAGTTTTTATCTGAGGTTG (SEQ ID No: 10). The identified primers are LPA1-cas9-Seq-F1: TGGACATCTTTCCAGCTCTC (SEQ ID No: 11), LPA1-cas9-Seq-R1: CATCTGACACTAGGTCGATG (SEQ ID No: 12), LPA1-cas9-Seq-F2: CATTACACCCATTTGATCTG (SEQ ID No: 13), LPA1-cas9-Seq-R2: GACATTATCATGAGCACTTC (SEQ ID No: 14). The specific steps of CRIPSR / Cas9 vector construction refer to Zeng Dongchang et al. (Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Plant CRISPR / Cas9 multi-gene editing vector construction and mutation analysis operation method [J]. Chinese science: life science, 2018, 48(07): 783-794.). The constructed vector was introduced into Shiga white hair (SSBM) by Agrobacterium EHA105 mediated transgenic method (entrusted to the Institute of Crop Science, Chinese Academy of Agricultural Sciences), and 2 independent lpa1 mutants were obtained, which were named lpa1-Cr-1 and lpa1-Cr-2 , respectively, as Figure 2 .
[0032] Experimental material treatment and inorganic phosphorus content measurement: wild type material (SSBM) and LPA1 overexpression transgenic material (#1 and #2) were treated by water culture. The formula of water culture complete nutrient solution is: 1.4 mM NH4NO3, 0.2 mM NaH2PO4·2H2O, 0.19 mM K2SO4, 0.55 mM MgSO4·7H2O, 0.36 mM CaCl2, 0.1 mM EDTA-FeNa, 0.005 mM MnCl2·4H2O, 0.03 mM H3BO3, 0.001 mM (NH4)6Mo7O 24• 4H20, 0.004 mM ZnS04·7H20, 0.002 mM CuS04·5H20. pH is 6. The nutrient solution is changed twice a week. After 3 weeks of culture under 12 h light / 12 h dark, 30 °C / 22 °C, the leaf phenotype of transgenic materials is observed. Meanwhile, the 3rd leaf is sampled, frozen in liquid nitrogen and grinded into powder, added with 5 M H2S04for 30 min, 1 mL ddH20, vortexed, centrifuged at 1,300 rpm for 10 min, the supernatant is taken, and the inorganic phosphorus content is calculated by molybdenum-antimony anti-colorimetric method at wavelength 695 nm.
[0033] The results are shown in Table 1. Figure 3 Under normal full nutrient solution hydroponic conditions, the leaves of wild type rice remain green and swollen, while LPA1 the leaves of overexpression plant materials appear scorched and chlorotic phenotype. In addition, LPA1 the inorganic phosphorus content of overexpression plant leaves is higher than that of wild type, and the accumulation of phosphorus nutrients occurs.
[0034] The test plants are: LPA1 overexpression transgenic materials #1 and #2 , wild type materials (SSBM).
[0035] Leaf Pi staining: take the middle part of the 2nd leaf of wild type and transgenic plants grown under full nutrient solution hydroponic conditions for 2 weeks, about 1 cm long, and embed with 4% agarose. The embedded material is fixed on the base of the vibration slicer, and the slice thickness is 50 μm. Add Pi staining solution in advance in a 2 mL EP tube, and pick the complete slice material in the tube for staining. After 1-2 h at room temperature, make a film, and observe and take pictures with a 10x optical microscope.
[0036] The results are shown in Table 2. Figure 4 Compared with wild type plants, the color of Pi staining in LPA1 OE #1 and #2 lines is deepened, indicating that the Pi content is increased.
[0037] Example 5 Enhancing LPA1 expression can increase the number of tillers and yield of rice
[0038] The test plants are: LPA1 overexpression transgenic materials #1 and #2 , gene editing mutants lpa1-Cr-1 and lpa1-Cr-2 , wild type materials (SSBM).
[0039] Pot experiment and agronomic trait analysis: the above materials are planted in conventional rice soil, and after growth and maturation, the plant height, tiller number, single plant yield, and phosphorus content are statistically determined and analyzed.
[0040] Results are shown in Figure 5 Figure 4, compared with wild type plants, LPA1-OE #1 and #2 lines had significantly higher tiller number and yield per plant than wild type; while mutant plants lpa1-Cr-1 and lpa1-Cr-2 had significantly lower tiller number and yield per plant than other plants. These results indicated that enhanced expression of OsPHO1;2 could increase tiller number and yield in rice, and also implied that #1 and #2 lines had higher potential of phosphorus utilization. LPA1 LPA1-OE
[0041] The above-described embodiments only express several embodiments of the present application, which are described in more detail and in more detail, but cannot be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application patent should be subject to the appended claims.
Claims
1. Oryza sativa LPA1 The use of the gene in increasing inorganic phosphorus content in rice plants, characterized in that, The nucleotide sequence of the rice LPA1 gene is shown as SEQ ID No:
1.
2. A method for increasing inorganic phosphorus content in a rice plant, the method comprising, Overexpressing the LPA1 gene in rice.
Citation Information
Patent Citations
Rice phytic acid related gene ZJU-LPA1 and method for cultivating low-phytic-acid rice
CN102864156A
Rice cyclin OsCYCP4 ; 4 application and method for improving rice tolerance to low phosphate stress
CN105524153A