Rice leaf color regulation gene yl5, protein encoded by the gene and application thereof

Abstract

This invention discloses a rice leaf color regulating gene. YL5 The gene and the protein it encodes and its applications. YL5 The nucleotide sequence is any one of the following: (a) the nucleotide sequence shown in SEQ ID NO.1; (b) a nucleotide sequence shown in SEQ ID NO.1 generated by inserting, deleting, or substituting one or more bases, resulting in premature termination of the encoding protein controlling rice leaf color function. The gene of this invention YL5 It has biological functions in regulating rice leaf color, can be used as a color marker in hybrid rice seed production, has important breeding application value in improving seed purity, and provides new ideas for studying the regulation mechanism of rice leaf color.

Description

Technical Field

[0001] This invention belongs to the field of rice breeding technology, specifically relating to a rice leaf color regulating gene. YL5 And its encoded proteins and applications. Background Technology

[0002] Leaves are the primary site of photosynthesis in plants, and their photosynthetic efficiency is closely related to yield. Rice, as one of the world's most important food crops, has its growth cycle directly related to the photosynthetic process in its leaves, influencing both yield and quality. Leaf color mutants are crucial for studying plant photosynthesis, chlorophyll metabolism mechanisms, and chloroplast development regulation. Therefore, identifying and cloning new genes regulating rice leaf color and studying their formation mechanisms is beneficial for the development of rice photosynthetic systems and high-efficiency light-producing varieties. Leaf color can also serve as a morphological marker, used in the screening of breeding materials and the production of hybrid rice seeds to improve seed purity. Furthermore, it can be used for landscaping rice and paddy field designs.

[0003] Studies have shown that the genetic mechanisms of leaf color variation mainly include nuclear genetic variation, cytoplasmic genetic variation, and nucleo-cytoplasmic interaction mutations, involving multiple metabolic and signaling pathways, primarily chlorophyll metabolism, heme metabolism, chloroplast development regulation, nucleoplasmic transport, carotenoid metabolism, and purine nucleotide synthesis. Currently, some rice leaf color-related genes have been located and cloned. For example... OsCHLH This is the first cloned gene in rice, encoding the H subunit of magnesium ion chelate enzyme, a key enzyme in chlorophyll synthesis. Mutations in this gene cause chlorosis in plants (Jung et al.). Plant and Cell Physiology , 2003, 44(5): 463-472); YGL1 This gene encodes chlorophyll synthase; mutations in this gene cause incomplete chloroplast development and delayed thylakoid membrane formation, resulting in abnormal leaf color, appearing yellowish-green (Wu et al.). Plant Physiology , 2007, 145(1): 29-40); LYL1 Encoding geraniol reductase, which participates in the final step of chlorophyll synthesis in rice, its mutant phenotype is yellow leaves (Zhou et al.). PLoS ONE , 2013, 8(9): e75299); YGL8 The gene encodes a catalytic subunit of a magnesium protoporphyrin IX monoester cyclase, an intermediate in the synthesis of tetrapyrrole. Its mutant... ygl8 It manifests as yellow-green leaves (Kong et al., Plant Molecular Biology, 2016, 92(1): 177-191 ); YGL18 Encoding magnesium protoporphyrin IX methyltransferase, which catalyzes the formation of magnesium protoporphyrin IX monomethyl ester from magnesium protoporphyrin IX in the chlorophyll synthesis pathway, its mutant... ygl18The chlorophyll level decreased, and the leaves turned yellowish-green (Wang et al.). Frontiers in Plant Science (, 2017, 8: 1694); and GRY79GRY79 Encoding a metallo-β-lactamase-triple helix chimera involved in chloroplast development during the early seedling stage of rice (Wan et al.). Plant Cell Reports , 2015, 34(8): 1353-1363, etc.

[0004] Although a considerable number of rice leaf color regulatory genes have been cloned, the genetic mechanisms and protein level regulation controlling these leaf color traits are extremely complex processes. Therefore, discovering new rice leaf color regulatory genes is crucial for studying the molecular mechanisms of chlorophyll metabolism, photosynthesis, and photomorphogenesis; simultaneously, they can serve as excellent germplasm resources and screening markers for molecular design applications in hybrid rice breeding.

[0005] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0006] The purpose of this invention is to provide a rice leaf color regulating gene. YL5 The gene, along with its encoded protein and applications, has a biological function in regulating rice leaf color and can be used as a color marker in hybrid rice seed production, thus having important breeding application value in improving seed purity.

[0007] To achieve the above objectives, this invention provides a rice leaf color regulating gene. YL5 This gene YL5 The nucleotide sequence is any one of the following:

[0008] (a) The nucleotide sequence shown in SEQ ID NO.1;

[0009] (b) The nucleotide sequence shown in SEQ ID NO.1, generated by inserting, deleting or replacing one or more bases, resulting in premature termination of the nucleotide sequence encoding the functional protein controlling rice leaf color.

[0010] A second objective of this invention is to provide a rice leaf color-related protein YL5, wherein the amino acid sequence of protein YL5 is any one of the following:

[0011] (1) The amino acid sequence shown in SEQ ID NO.2;

[0012] (2) The amino acid sequence shown in SEQ ID NO.2 is derived by inserting, deleting, or replacing one or more amino acid residues and has the function of controlling the color of rice leaves.

[0013] A third objective of the present invention is to provide a recombinant expression vector comprising the aforementioned gene YL5.

[0014] A fourth objective of the present invention is to provide a host comprising the recombinant expression vector described above.

[0015] The fifth object of the present invention is to provide the aforementioned gene. YL5 The application of the protein YL5, the recombinant expression vector, or the host in regulating rice leaf color.

[0016] Preferably, the gene YL5 Alternatively, the protein YL5 mentioned above can be used to control the yellow-green color of rice leaves after heading.

[0017] Preferably, its application in molecular breeding of rice leaf color traits.

[0018] The sixth object of the present invention is to provide the aforementioned gene. YL5 The application of the protein YL5, the recombinant expression vector, or the host in the identification of hybrid purity in hybrid rice offspring and / or the identification of purity in self-pollinated seeds of sterile lines.

[0019] The rice leaf color regulating gene of the present invention YL5 Its encoded proteins and applications offer the following advantages:

[0020] The inventors of this invention obtained a mutant with a yellow-green leaf phenotype after heading by screening. They used the MutMap method based on whole-genome resequencing for gene localization analysis to obtain candidate genes, and constructed a genetic complementation expression vector to transform the yellow-green leaf mutant, obtaining positive transgenic plants. The leaf color of these plants recovered to the wild-type phenotype after heading. The genetic complementation function was verified, clarifying the biological function of this gene in regulating rice leaf color.

[0021] The gene of this invention YL5 This study can regulate the yellow-green leaves of rice, providing new insights into the regulatory network of yellow-green leaves in rice and offering new gene resources for molecular breeding. Furthermore, leaf color, as a marker, can be used to improve the leaf color of hybrid rice male-sterile lines, thereby increasing the purity of hybrid rice seeds. This has significant value in molecular breeding applications and also provides new insights into the regulatory mechanisms of rice leaf color variation. Attached Figure Description

[0022] Figure 1 Wild type and mutant yl5Plant phenotype and pigment content; where A represents the phenotype of mature plants; B represents the phenotype of mature sword leaves; and C represents the pigment content of mature sword leaves.

[0023] Figure 2 For the present invention YL5 Gene mapping results; where A represents gene mapping results using the Mutmap method; B represents... YL5 Gene structure; C is yl5 Sequencing peak diagram of gene mutation sites.

[0024] Figure 3 This is a diagram illustrating the construction of the genetic complementation vector of the present invention.

[0025] Figure 4 For the present invention pCAMBIA1300- YL5 Transformation yl5 Electrophoretic patterns of hygromycin detection in mutant complementary transgenes; lanes 1-16 represent different transgene lines of generation T0.

[0026] Figure 5 The mutant of this invention yl5 Phenotype of complementary positive transgenic plants; among them, WT is wild type. yl 5 is a mutant. yl 5-C is a complementary positive transgenic material; A is the phenotype of mature plants; B is the phenotype of mature flag leaves; C is the pigment content of mature flag leaves. Detailed Implementation

[0027] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] It should be noted that: for conditions not specifically specified in the examples, standard conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0029] In this invention, all features defined in the form of numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are used only for simplicity and convenience. Accordingly, the description of numerical ranges or percentage ranges should be considered as covering and specifically disclosing all possible secondary ranges and individual numerical values ​​(including integers and fractions) within those ranges.

[0030] The features mentioned in this invention can be combined arbitrarily, and all possible combinations should be considered within the scope of this specification, provided that there is no contradiction in the combination of these features. Each feature disclosed in the specification can be replaced by any alternative feature that provides the same, equivalent, or similar purpose. Therefore, unless otherwise specified, the disclosed features are merely general examples of equivalent or similar features.

[0031] Example 1: Phenotypic Identification of Yellow Leaf Mutant in Rice

[0032] 1. Mutant yl5 Phenotypic characteristics

[0033] "Qiaogang Pearl" japonica rice, a local resource from Guizhou. 60 A yellow-green leaf mutant was obtained from the Co-γ radiation-induced mutagenesis mutant library. Wild-type plants exhibit green leaves during normal growth and development, while the mutant... yl5 The leaves were normal in color before heading, but gradually turned yellowish-green after heading. Figure 1 ).

[0034] 2. Determination of photosynthetic pigment content

[0035] Changes in plant leaf color are usually related to changes in the content of photosynthetic pigments in the leaves, due to mutants yl5 After heading, the leaves turn yellowish-green; therefore, during the maturity period, the wild type and the mutant... yl5 The contents of chlorophyll a, b and carotenoids in the leaves were measured.

[0036] See Figure 1 The results showed that during the mature stage, the contents of chlorophyll a, chlorophyll b, total chlorophyll, and carotenoids in the mutant were all significantly lower than those in the wild type (P<0.01), indicating that the mutant... yl5 The yellow-green phenotype that appears after heading is caused by a decrease in the content of photosynthetic pigments in the leaves.

[0037] Experiment Example 2 YL5 Gene localization and candidate gene analysis

[0038] To locate the gene controlling the yellow-green leaf phenotype, mutants were used. yl5 The plants were crossed with the wild-type 'Qiaogang Pearl' (Wild-type, WT) to obtain F1 plants. The seeds harvested from the F1 plants were planted to form the F2 population. After heading, the segregation ratio of normal leaf color plants and yellow-green leaf plants in the F2 segregating population was counted for genetic analysis. The chi-square test results showed that the segregation ratio of normal leaf color plants and yellow leaf color plants was 3:1, indicating that the yellow-green leaf phenotype gene is controlled by a recessive gene.

[0039] To locate the yellow-green leaf gene, equal amounts of leaves from 30 mutant yellow-green leaf phenotype plants and 30 normal leaf color plants were selected from the F2 population, and DNA was extracted from them. DNA was also extracted from wild-type samples. Whole-genome resequencing was performed on both samples, and the gene controlling leaf color was located using the Mutmap method.

[0040] The results are as follows Figure 2 As shown, the SNP-Index only exhibits a distinct peak at the 18-19 Mb position on chromosome 5, and within this region, there is one SNP-index that is a candidate gene completely linked to the leaf color phenotype. LOC_Os05g32390 ( Figure 2 (A). Sanger sequencing analysis showed that the mutant yl5 exist LOC_Os05g32390 A T base in exon 11 of the gene is replaced by an A base. Figure 2 The B and C codons cause the codon encoding leucine to become a stop codon, resulting in premature termination of the coding.

[0041] Therefore, LOC_Os05g32390 Genes were selected as candidate genes. YL5 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. Analysis of the amino acid sequence of the encoded protein shows that the protein encoded by this gene is a transmembrane GTPase FZO-like protein.

[0042] SEQ ID NO. l is as follows:

[0043]

[0044] SEQ ID NO. 2 is as follows:

[0045] MFAASTSSTGLPLPRAGGLLLLPTSRSLLLPRHRHRLRLRDVGAAAAAGGGVSGGGGGAASSREPPRTLFPGGFKRPEIRVPALVLRVGADEALASGDAVVAAVARGVGIVVLEAGEEGGGRVYEAALSLKASVGDRAYLLVAERVDVASAVGASGVVLADDGIPAIVARSMMMKSNSDSIYLPLVARTIRSADTARSATSSEGADFLIIDTGSDDAINVMNGVSGTQHVKIPIFSTLSDSQSEGSYSDNTSRLLQSGASGIVMSLAGIQVLADDIIERDFSKVDTAESVLQANYSSASTLEEADNVMVLTREKAKVAGFTKLDEKVMQLISIEKPILSEAVAVIRKAAPMMEEVELLVDAASRLSEPFLLVTVGEFNSGKSTFINALLGRKYLQEGVVPTTNEIMLLSYSDVDSESAERCERHPDGQYMCYLSAPVLKEMNLVDTPGTNVILQRQQRLTEEYVPRADLILFVLSSDRPLTDSEVGFLQYVQQWKKKVVFVLNKLDLYRNSNELEEATAFIKENARKLLNTEDVTLFPVSSRSALEAKLLYSKNDGREHHGEALFNDPRWRNSKFYDLEHYLLSFLDGSTENGKERVRLKLETPIGIADRLLTSCQRLVKLEYEKAIDDLTSIKDLVSGANNYAVKIEADSDSWQRQISSLIARAKGRAISLMESTLQLSNIDLIFTYTLSGGKSTPTKVTSFFQNDILSPSLDDAANLLSEYSTWLSSTNVREANIYVDCFHERWGALVAQEQRIPPEKNELVNEEEKLCVKALDGFSASAAAKVFEEEIREVAWGTFGGLGVAGLSASLLTSVLTSTLEDLLALALCSAGGFFAISNFPTRRKLAVEKIGKAAEKLSSKVDEAIQQDISRSANQLVHFVETVSKPYQDACQQKIDWLQGVQGELSTVERKLQTLKVEIQNLHES。

[0046] Experiment Example 3: Verification of Genetic Complementation in Mutants

[0047] 1. YL5 Construction of gene complementation vector

[0048] According to the Rice Genome Annotation Project of MSU7.0 YL5 Gene( LOC_Os05g32390 Two pairs of primers were designed based on the full-length genome and cDNA sequences of the genome. YL5 -Pro-F / YL5 -Pro-R and YL5 -F / YL5 -R), as follows:

[0049] upstream primer YL5 -Pro-F (SEQ ID NO. 3):

[0050] 5'-tatgaccatgattacgaattcGCTCTTGTCCTTAGTGGCTTTTTT-3' (contains Eco (RI restriction site);

[0051] Downstream primer YL5 -Pro-R (SEQ ID NO. 4):

[0052] 5'-aacatGGGGAGCGACAGGGATGG-3';

[0053] upstream primer YL5 -F (SEQ ID NO. 5):

[0054] 5'-tccctgtcgctccccATGTTCCGCCGCTTCCACC-3';

[0055] Downstream primer YL5 -R (SEQ ID NO. 6):

[0056] 5'-agtgtcgactctagaggatccTGATTCATGAAGATTTTGAATTTCAA-3' (contains Bam (HI restriction enzyme site).

[0057] Using the high-fidelity enzyme Phanta Max Master Mix (Vazyme), it was obtained by amplification from wild-type genomic DNA via PCR. YL5 The 2 kb promoter of the gene was obtained and purified by electrophoresis. YL5-Pro fragment; obtained by amplification from wild-type cDNA using RT-PCR technology. YL5 Gene CDS, and obtained by electrophoresis purification YL5 -cds fragment; use Eco RI and Bam The pCambia1300-eGFP vector was double-digested with two restriction enzymes, HⅠ, and HCl. After electrophoretic purification, it was recovered by gel extraction. YL5 -Pro and YL5 -cds purified fragments and pCambia1300-eGFP ( Eco RI / Bam After double digestion with HI, the gel return products were mixed in a specific ratio and homologous recombination ligation was performed using the ClonExpress MultiS One Step Cloning Kit (Vazyme). Single clones were selected for PCR detection and sequencing verification, successfully obtaining the transformation vector pCAMBIA1300- YL5 (Figure 3).

[0058] Agrobacterium-mediated transformation was used to transform Agrobacterium EHA105 into callus induced by mature seed embryos of the yellow-green leaf mutant. The specific transformation method is referenced in (Hiei et al. Plant J. 1994 Aug;6(2):271-82). Hygromycin was used for resistance screening to obtain positive transgenic seedlings.

[0059] 2. Identification and phenotypic analysis of genetically complementary plants

[0060] After obtaining positive transgenic plants, leaves were taken from individual plants, and T0 generation rice DNA was extracted using the CTAB method. The transgenic plants were then subjected to PCR amplification using hygromycin Hpt-specific primers (Hpt-F / Hpt-R) to further confirm the positive status of the plants.

[0061] Hpt-F (SEQ ID NO. 7):

[0062] GAAGTGCTTGACATTGGGGAGT;

[0063] Hpt-R (SEQ ID NO. 8):

[0064] AGATGTTGGCGACCTCGTATT.

[0065] See electrophoresis results Figure 4 Using hygromycin Hpt-specific primers (PCR product size 472 bp), 13 independent positive transgenic complementary lines were obtained. Throughout the growth process, the leaf phenotype of the positive plants was similar to that of the wild type, while at maturity, the leaf color and pigment content in the leaves returned to wild-type levels (see [link to relevant documentation]). Figure 5 ).

[0066] Therefore, the above experiments identified the mutant. yl5 The yellow-green leaf phenotype is caused by LOC_Os05g32390 Caused by functional mutation YL5 Genes have biological functions in regulating rice leaf color. 。

[0067] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A rice leaf color regulating gene YL5 Its application in regulating rice leaf color is characterized by, Genes in rice YL5 Mutate the gene YL5 The substitution of the T base at position 2717 of the nucleotide sequence SEQ ID NO.1 with A caused premature termination of protein translation. The rice mutant showed normal leaf color before heading, but the leaves gradually turned yellowish-green after heading.

2. A rice leaf color regulating gene YL5 Its application in molecular breeding of rice leaf color traits is characterized by, Genes in rice YL5 Mutate the gene YL5 The substitution of the T base at position 2717 of the nucleotide sequence SEQ ID NO.1 with A caused premature termination of protein translation. The rice mutant showed normal leaf color before heading, but the leaves gradually turned yellowish-green after heading.

Images