Preparation of deletion gene target SOD6 and application of deletion gene target SOD6 in fungi

Abstract

The invention relates to the technical field of gene engineering, in particular to preparation of a gene-deleted target SOD6 and application of the gene-deleted target SOD6 in fungi. On the basis of an instantaneous CRISPR / Cas9 technology, sgRNA and repair DNA are designed, NAT is used as a selection marker, NAT is inserted into a fungal genome through a homologous recombination method, fixed-point knockout of a target gene SOD6 is achieved, and a candida albicans attenuated strain without the SOD6 gene is obtained; candida albicans SOD6 is found to regulate pathogenicity, itraconazole sensitivity, DNA damage, oxidative stress and ROS accumulation, a novel pathogenic target SOD6 of Candida albicans is found, the novel pathogenic target SOD6 is a potential ideal therapeutic target, and inhibitors or vaccines can be researched and developed in a targeted manner in the later stage.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the preparation of a SOD6 deletion gene target and its application in fungi. Background Art

[0002] Candida albicans is a common pathogenic fungus in clinical practice. It can exist in human oral cavity, respiratory tract, intestinal tract and vaginal tissues for a long time in a symbiotic relationship with the host. However, if the host's immunity is reduced or the normal flora is imbalanced, Candida albicans can cause invasive infections of tissues and organs such as skin, mucous membranes, brain, heart, kidney, liver, etc. At the same time, azoles are common drugs for the clinical treatment of Candida infections, and with the use of azole drugs, clinical drug-resistant strains have increased year by year, resulting in a significant increase in the incidence and mortality of invasive candidiasis. Therefore, in-depth exploration of potential new therapeutic targets for Candida albicans is of great significance for the effective prevention and treatment of invasive Candida infections.

[0003] Superoxide dismutase SOD is one of the biological enzymes widely present in organisms. It can effectively remove reactive oxygen ROS and plays a vital role in maintaining the body's oxidation-antioxidation balance. Among them, Candida albicans SOD6 is a copper superoxide dismutase unique to fungi, which may be a potential new therapeutic target for antifungal treatment. At present, the function and molecular regulation mechanism of Candida albicans SOD6 have not been reported. The present invention constructs a Candida albicans SOD6 gene knockout strain, and finds that SOD6 can regulate Candida albicans pathogenicity, itraconazole sensitivity, DNA damage, oxidative stress, and ROS accumulation. It is suggested that targeted inhibitors or vaccines can be developed based on this in the later stage. Summary of the invention

[0004] The present invention provides a preparation method for lacking a gene target point SOD6 and its application in fungi.

[0005] The preparation method of the deleted gene target SOD6 is based on transient CRISPR / Cas9 technology, sgRNA (ACGTCCATATTGATATGACA) is designed according to the SOD6 gene nucleic acid sequence, repair DNA is designed on both sides of the sgRNA sequence, NAT is used as a screening marker, and NAT is inserted into the fungal genome through homologous recombination to achieve site-specific knockout of the target gene SOD6.

[0006] The SOD6 gene target site is unique to fungi, and the SOD6 gene sequence is shown in SEQ.ID.NO.1; The sgRNA forward sequence is: ACGTCCATATTGATATGACA, as shown in SEQ.ID.NO.2; The reverse complementary sequence of the sgRNA is: TGTCATATCAATATGGACGT, as shown in SEQ.ID.NO.3.

[0007] Furthermore, the preparation method comprises the following steps: (1) Primer design: Design sgRNA according to the nucleic acid sequence of the SOD6 gene, design repair DNA primers on both sides of the sgRNA sequence, and design detection primers outside the homologous region; the sgRNA forward sequence is shown in SEQ.ID.NO.2; the sgRNA reverse complementary sequence is shown in SEQ.ID.NO.3; (2) PCR amplification of target DNA fragments and product purification: Amplify the Cas9 fragment and the repair DNA fragment, and use the fusion PCR method with the amplified sgRNA-1 and sgRNA-2 fragments as primers to obtain a fusion sequence containing the sgRNA-1 sequence and the sgRNA-2 sequence, and purify the amplified product; (3) The purified sgRNA, repair DNA and Cas9 were transformed into fungi by the lithium acetate method and cultured at 30°C for 2-3 days. Under the guidance of sgRNA, Cas9 cut the specific region of the SOD6 promoter at a fixed point. The repair fragment constructed based on pV1093 with a NAT marker was integrated into the corresponding region of the SOD6 gene to replace part of the SOD6 gene itself to construct a SOD6 knockout strain, thus obtaining a positive clone strain; The repair DNA forward sequence designed on both sides of the sgRNA sequence is shown in SEQ.ID.NO.4, and the repair DNA reverse sequence is shown in SEQ.ID.NO.5.

[0008] Furthermore, colony PCR was performed using define-F and define-R as primers to detect the genotype of the positive clone strain. After the NAT recombinant fragment replaced the SOD6 gene, a fragment of about 2.2 kb was produced, and the SOD6 knockout strain was obtained.

[0009] The define-F and define-R primer sequences are shown in SEQ.ID.NO.16-17.

[0010] Further: Cas9 gene: P7 and P8 were used as primers and pV1093 plasmid was used as template to amplify the Cas9 gene; Repair DNA: pV1093 was used as template and repair-F and repair-R were used as primers to amplify the recombinant DNA fragment with NAT tag; sgRNA fusion sequence fragment: P1 and sg-R were used as primers and pV1093 was used as a template to amplify the sgRNA-1 fragment; sg-F and P4 were used as primers and pV1093 was used as a template to amplify the sgRNA-2 fragment; primers P5 and P6 were used to perform fusion PCR with sgRNA-1 and sgRNA-2 as templates to amplify the complete sgRNA fusion sequence fragment.

[0011] The primer sequences of P1, P4, P5, P6, P7, P8, sg-F, sg-R, repair-F, and repair-R are shown in SEQ.ID.NO.6-15.

[0012] Preferably, the fungus is Candida albicans ( candida albicans ) Standard strain SC5314.

[0013] The application of the above-mentioned method for preparing the SOD6 deleted gene target in fungi.

[0014] The prepared fungus lacking the gene target SOD6 is used in screening or preparing targeted inhibitors or vaccines for treating fungal infection diseases.

[0015] Preferably, the fungus is Candida albicans.

[0016] The beneficial effects of the present invention are: 1. This invention is the first to explore the biological function of the copper metalloenzyme SOD6 of Candida albicans. The SOD6 gene is unique to fungi, revealing that the SOD6 gene can be used as a new pathogenic target for fungi (such as Candida albicans). In the future, SOD6 can be used as a new target to develop targeted inhibitors or vaccines; 2. Based on the SOD6 target, a Candida albicans SOD6 knockout strain was constructed for the first time, which has been proven to be applicable to the screening or preparation of targeted inhibitors or vaccines for the treatment of Candida albicans infections; 3. For the first time, it was discovered that Candida albicans SOD6 regulates its pathogenicity, itraconazole sensitivity, DNA damage, oxidative stress, and ROS accumulation. This can be used to explore the molecular mechanism of DNA damage and ROS accumulation mechanism in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Build the result graph for the Candida albicans SOD6 knockout strain; Figure 2 This is the survival curve of the Galleria mellonella infection model; Figure 3 The results of the azole drug sensitivity test of the Candida albicans SOD6 knockout strain; Figure 4 This is the result of DNA damaging agent sensitivity test of Candida albicans SOD6 knockout strain; Figure 5 This is the result of hydrogen peroxide sensitivity test of Candida albicans SOD6 knockout strain; Figure 6 These are the results of ROS accumulation detection in the Candida albicans SOD6 knockout strain. DETAILED DESCRIPTION

[0018] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be described clearly and completely below. It should be noted that if no specific conditions are specified in the examples, they are carried out under normal conditions. The drawings described below are only some embodiments of the present application and do not limit the present invention in any form. For those skilled in the art, several adjustments and improvements can be made without departing from the concept of the present invention. All technologies implemented based on the above content of the present invention belong to the protection scope of the present invention.

[0019] The present application discloses an attenuated strain of Candida albicans lacking the superoxide dismutase SOD6 gene and its application, wherein the attenuated strain of Candida albicans is a Candida albicans that does not express the SOD6 gene. The gene is unique to fungi and is a potential ideal therapeutic target. In the later stage, inhibitors or vaccines can be developed based on this target.

[0020] To achieve the above object, the technical solution adopted by the present invention is: Example 1: Construction of Candida albicans SOD6 knockout strain Candida albicans ( candida albicans The American Type Culture Collection (ATCC) standard strain SC5314 was used.

[0021] Based on transient CRISPR / Cas9 technology, sgRNA (ACGTCCATATTGATATGACA, as shown in SEQ.ID.NO.2) was designed, repair DNA was designed on both sides of the sgRNA sequence, and Nourseothricin (NAT) was used as a screening marker. NAT was inserted into the Candida albicans genome through homologous recombination, thereby achieving site-specific knockout of the target gene SOD6.

[0022] The sequence of the target gene SOD6 is shown in SEQ.ID.NO.1, and the SEQ.ID.NO.1 is: ATGATCTTTATTCCCATTATCATATTAATCTATCTAGTTTCAATAGCTGCTTCAGACAAGTCACCTAAAATCAAGAAAAACCCTAGAAACGTCGTTGCTGTTGCAGACTTTCCCTTTGGAGGTGATACACAGGTCAAAGGAAACGTGGTGTTTAGTGCTAAAGAAGGTAAACATGTCAACGTCCATATTGATATGACAGGGTTGCCCAAAGATGAAGGACCATTTTTCTACCATATACATGAACGGTCTGTTCCAGGAAACGGCAATTGCGAAGCAGTTGGGTTGCATTTTAATCCTTATAATGCTAGTCCAGTTTGCGATGAACAAAAAAACGATGCCTACTGTCAAGTGGGCGACTTGCTGGGGAAACATGGTTGTATCAACACAACTTGCTTTGAGTTGAAATACAGCGACCCTTATTTGTCGTTAAACAGAAAATCAAAGTCCTATATTATTGGAAAGTCGGTGGTGTTCCATTATCCGAATTTGACGAAAATTGCTTGTGCTGATATTGAAGAGGCAAACGAGTTGAGACTACAGAGTTTGATTGACGAATACACCCAAACCGATGACGCCATTCAATTAAAGGAACTAAATACTCCTCTTGAAACCGATTACAAATTTGACGAGGTAGAAGCGTTATCATCGGAAATTTACCATTCTGATACCGACTCCGACCCACCTCAACAAGAGTTAATTCTGACAGAAAAGTTATATAACAAAACTGACAACGTCTACAGCCCAGAAGAAACTAGGCCCAGCGACCAGAACAAAAAGAGTCACCGGCACTCCTTGCTACCCTTGGCTAAATGGAAAAAAAATAGCCCCAAAAACTATTCCAACATTTCTATCCACGGAATCTCTAGTGATTGTCTCAATGATGGTATGATGGTCACCGGTTCGGTCTTTGGTTCTCTCGTATTGGGAATAGCTGCAGGAATATTTGTTTAG。

[0023] The forward sequence of the sgRNA is shown in SEQ.ID.NO.2. The SEQ.ID.NO.2 is: ACGTCCATATTGATATGACA; The reverse complementary sequence of the sgRNA is shown in SEQ.ID.NO.3, The SEQ.ID.NO.3 is: TGTCATATCAATATGGACGT.

[0024] Design repair DNA on both sides of the sgRNA sequence: The repair DNA forward sequence is shown in SEQ.ID.NO.4, The SEQ.ID.NO.4 is: ATTCCCATTATCATATTAATCTATCTAGTTTCAATAGCTGCTTCAGACAAGTCACCTAAAATC; The repair DNA reverse sequence is shown in SEQ.ID.NO.5, The SEQ.ID.NO.5 is: TGACAGTAGGCATCGTTTTTTTGTTCATCGCAAACTGGACTAGCATTATAAGGATTAAAATGCAACC.

[0025] (I) Primer design: The SOD6 gene nucleic acid sequence was copied to the Benchling website (http: / / www.benchling.com) to analyze the single-guide RNA (sgRNA) sequence online. Repair DNA primers were designed on both sides of the sgRNA sequence using Snapgene software, and detection primers were designed around the homologous region, as well as universal primers P1, P4, P5, P6, P7, and P8, as shown in the table below.

[0026] 2. PCR amplification of target DNA fragments and product purification (1) sgRNA fragment amplification: sgRNA-1 PCR reaction system: pV1093 (Candida albicans CRISPR gene knockout vector): 1 μL, P1: 1 μL, sg-R: 1 μL, distilled water: 22 μL, Premix Taq TM : 25 μL; sgRNA-2 PCR reaction system: pV1093: 1 μL, P4: 1 μL, sg-F: 1 μL, distilled water: 22 μL, PremixTaq TM : 25 μL; The PCR reaction program was as follows: 95 °C, 5 min, 95 °C, 30 s, 55 °C, 30 s, 72 °C, 1 min30 s, 72 °C, 10 min, 16 °C, ∞, 35 cycles.

[0027] (2) sgRNA fusion PCR reaction system: sgRNA-1: 2 μL, sgRNA-2: 2 μL; P5: 1 μL, P6: 1 μL, distilled water: 19 μL, Premix Taq TM : 25 μL.

[0028] The PCR reaction program was as follows: 95 °C, 5 min, 95 °C, 30 s, 55 °C, 30 s, 72 °C, 1 min30 s, 72 °C, 10 min, 16 °C, ∞, 35 cycles.

[0029] (3) Cas9 fragment amplification: pV1093: 1 μL, P7: 1 μL, P8: 1 μL, distilled water: 22 μL, Premix Taq TM : 25 μL.

[0030] The PCR reaction program was as follows: 95 °C, 5 min, 95 °C, 30 s, 55 °C, 30 s, 72 °C, 5 min30 s, 72 °C, 10 min, 16 °C, ∞, 35 cycles.

[0031] (4) Repair DNA fragment amplification: pV1093: 1 μL, repair-F: 1 μL, repair-R: 1 μL, distilled water: 22 μL, Premix Taq TM : 25 μL.

[0032] The PCR reaction program was as follows: 95 °C, 5 min, 95 °C, 30 s, 55 °C, 30 s, 72 °C, 2 min30 s, 72 °C, 10 min, 16 °C, ∞, 35 cycles.

[0033] (5) Product purification: The obtained PCR product was purified according to the instructions of the PCR product purification kit.

[0034] Prepare 1% agarose gel: weigh 0.25 g agarose and add 25 mL 1×TAE. After boiling in a microwave, add 1 μL of Gel Red dye. After mixing evenly, pour the agarose gel liquid into the gelatin plate inserted with a comb.

[0035] After the gel solidifies, pull out the comb and place the gel in an electrophoresis tank filled with 1×TAE. Mix 1 μL of PCR product with 1 μL loading buffer and load the sample. The voltage is 120 V and the running time is 30 min.

[0036] After electrophoresis, use a multifunctional gel imaging analyzer to check the band positions (see Figure 1 ).

[0037] 3. Identification of positive clones by colony PCR The PCR reaction system is as follows: define-F: 1 μL, define-R: 1 μL, distilled water: 10.5 μL, PremixTaq TM : 12.5 μL, gently dip the positive clone on the NAT plate as a template, mix the system evenly, centrifuge at 12000 r / min for 30 s, and place it on the PCR instrument.

[0038] The PCR reaction program was as follows: 95 °C, 5 min, 95 °C, 30 s, 55 °C, 30 s, 72 °C, 2 min30 s, 72 °C, 10 min, 16 °C, ∞, 35 cycles.

[0039] Prepare 1% agarose gel: weigh 0.25 g agarose and add 25 mL 1×TAE. After microwave heating and boiling, add 1 μL of Gel Red dye. After mixing well, pour the agarose gel liquid into the gel plate inserted in the comb. After the gel solidifies, pull out the comb and put the gel into the electrophoresis tank filled with 1×TAE. Load the PCR product, set the voltage to 100 V, and run the gel for 40 min. After the electrophoresis is completed, use a multifunctional gel imaging analyzer to check the band position.

[0040] Colony PCR was performed directly using define-F and define-R as primers to detect the genotype of the positive clone strain. After the NAT recombinant fragment replaced the SOD6 gene, a fragment of about 2.2 kb was generated. The fragment size was consistent with the theoretical value. Further high-throughput sequencing was performed and compared with the SOD6 sequence through Snapgene. The sequencing results ( Figure 1 ) showed that the SOD6 gene had been replaced by the NAT gene, confirming that a SOD6 knockout strain was obtained.

[0041] Figure 1 Description of the AF thumbnail: Figure 1 A: Transient CRISPR / Cas9 system: Under the guidance of sgRNA, Cas9 cuts at a specific region of SOD6, and integrates the repair fragment constructed based on pV1093 with a NAT marker into the corresponding region of the SOD6 gene, replacing part of the SOD6 gene itself to construct a SOD6 knockout strain.

[0042] Figure 1 B: Cas9 nucleic acid gel image: Using P7 and P8 as primers and pV1093 plasmid as template, the Cas9 gene was amplified with a size of about 5.5 kb, which is consistent with the theoretical value.

[0043] Figure 1 C in Figure 1: repair DNA gel image: Using pV1093 as template and repair-F and repair-R as primers, a recombinant DNA fragment with a NAT tag was amplified. The size of the fragment was about 2.0 kb, which was consistent with the theoretical value.

[0044] Figure 1 D in: Constructing sgRNA using fusion PCR method: amplify sgRNA-1 and sgRNA-2 fragments separately, then use the amplified products as primers. The final product contains both sgRNA-1 sequence and sgRNA-2 sequence, forming a long fusion sequence.

[0045] Figure 1 E in Figure 1: sgRNA-1, sgRNA-2, sgRNA nucleic acid gel image: P1 and sg-R were used as primers, pV1093 was used as a template to amplify the sgRNA-1 fragment, which was about 1.5 kb in size; sgRNA-2 was amplified with sg-F and P4 as primers and pV1093 as a template, which was about 1 kb in size. The DNA fragment obtained by the experiment was consistent with the theoretical value. Using primers P5 and P6, sgRNA-1 and sgRNA-2 were used as templates for fusion PCR, and the complete sgRNA fragment amplified was about 1.3 kb in size, which was consistent with the theoretical value.

[0046] Figure 1 F in the figure: SOD6 positive clone colony PCR nucleic acid gel image: Use define-F and define-R as primers to directly perform colony PCR to detect the genotype of the positive clone. After the NAT recombinant fragment replaces the SOD6 gene, a fragment of about 2.2kb will be generated. The fragment size is consistent with the theoretical value, indicating that the SOD6 knockout strain was successfully constructed.

[0047] Example 2: Candida albicans SOD6 knockout strain mediated pathogenicity The pathogenicity of Candida albicans SOD6 knockout strain was analyzed by constructing a greater wax moth infection model.

[0048] Preparation of larvae: Purchase the Greater wax moth ( Galleria mellonella ) larvae and place them in a 30 ℃ incubator for 1-2 days. Select healthy larvae with a length of about 2-3 cm as test materials.

[0049] The overnight cultured SOD6 knockout strain and SC5314 bacterial suspension were centrifuged at 7000 r / min for 3 minutes, the supernatant was discarded, washed 3 times with PBS and then resuspended in PBS to 1×10 7 CFU / mL. The larvae were gently fixed on the injection platform, and 10 µL of the diluted SOD6 knockout strain suspension and SC5314 suspension were injected into the body through the left hind leg of the larvae with a syringe. An uninfected group and a group injected with the same volume of PBS were set as controls. There were 30 larvae in each group. They were cultured in a 37°C incubator with tin foil to avoid light for 7 days, and the death was observed and the survival rate of the greater wax moth was counted.

[0050] Results (see Figure 2 ) showed that the 7-day survival rate of Candida albicans SOD6 knockout strain infected with greater wax moth was significantly higher than that of Candida albicans standard strain SC5314. This suggests that SOD6 is a new pathogenic gene of Candida albicans, and targeted inhibitors or vaccines can be synthesized based on it in the future to treat Candida infection diseases.

[0051] Example 3: Candida albicans SOD6 knockout strain mediates azole sensitivity The drug sensitivity of the Candida albicans SOD6 knockout strain and the Candida albicans standard strain SC5314 to the common clinical azole drugs fluconazole, ketoconazole, voriconazole, itraconazole and econazole was analyzed. Figure 3 ) suggested that the sensitivity of Candida albicans SOD6 knockout strain to itraconazole was significantly increased, indicating that SOD6 could be a new therapeutic target for Candida albicans.

[0052] Example 4: Candida albicans SOD6 knockout strain mediates sensitivity to DNA damaging agents The absorption concentration is 1×10 8 CFU / mL, 1×10 7 CFU / mL, 1×10 6 CFU / mL, 1×10 5 CFU / mL, 1×10 42 μL of CFU / mL Candida albicans SOD6 knockout strain and Candida albicans standard strain SC5314 were spotted on YPD agar plates containing 40 μg / mL zeocin, 20 μg / mL camptothecin (CPT), 2 ng / mL 4-nitroquinoline 1-oxide (4-NQO), and 0.005% methyl methanesulfonate (MMS), and incubated in an incubator at 30 degrees Celsius for 24 hours. Results ( Figure 4 ) suggested that the sensitivity of Candida albicans SOD6 knockout strain to bleomycin and camptothecin was significantly increased.

[0053] Example 5. Candida albicans SOD6 knockout strain mediates hydrogen peroxide sensitivity The absorption concentration is 1×10 8 CFU / mL, 1×10 7 CFU / mL, 1×10 6 CFU / mL, 1×10 5 CFU / mL, 1×10 4 CFU / mL Candida albicans SOD6 knockout strain and Candida albicans standard strain SC5314 2 μL was spotted on hydrogen peroxide plates with different concentrations (2 mM, 3 mM, 4 mM) and incubated inverted at 30 degrees Celsius incubator for 24 hours. Results ( Figure 5 ) suggested that the sensitivity of Candida albicans SOD6 knockout strain to hydrogen peroxide was significantly increased.

[0054] Example 6. Candida albicans SOD6 knockout strain mediates ROS accumulation 2,7'-Dichlorodihydrofluorescein diacetate (DCFH-DA) was used to measure the ROS content inside and outside the cells of the Candida albicans SOD6 knockout strain and the Candida albicans standard strain SC5314.

[0055] The bacterial solution in the logarithmic growth phase was cultured for 24 hours and diluted with PBS to different concentrations (OD 600 nm =2.0, OD 600 nm =1.5,OD 600 nm =1.0), incubated with fluorescent probe DCFH-DA at 37 degrees Celsius in the dark for 30 minutes, and mixed every 10 minutes. The relative fluorescence intensity was detected by the microplate reader with excitation light of 488 nm and emission light of 525 nm. Results ( Figure 6 ) suggested that the intracellular and extracellular ROS content of the Candida albicans SOD6 knockout strain was significantly increased.

Claims

1. A method for preparing a gene target SOD6 deletion: Based on transient CRISPR / Cas9 technology, sgRNA was designed according to the nucleic acid sequence of the SOD6 gene, and repair DNA was designed on both sides of the sgRNA sequence. NAT was used as a screening marker and inserted into the fungal genome through homologous recombination to achieve site-specific knockout of the fungal target gene SOD6. The SOD6 gene target site is unique to fungi, and the SOD6 gene sequence is shown in SEQ.ID.NO.1; The sgRNA forward sequence is: ACGTCCATATTGATATGACA, as shown in SEQ.ID.NO.2; The reverse complementary sequence of the sgRNA is: TGTCATATCAATATGGACGT, as shown in SEQ.ID.NO.

3.

2. The preparation method according to claim 1, characterized in that: The steps include: (1) Primer design: Design sgRNA based on the SOD6 gene nucleic acid sequence, design repair DNA primers on both sides of the sgRNA sequence, and design detection primers outside the homologous region; The sgRNA forward sequence is shown as SEQ.ID.NO.2; the sgRNA reverse complementary sequence is shown as SEQ.ID.NO.3; (2) PCR amplification and product purification of target DNA fragments: Amplify the Cas9 fragment and the repair DNA fragment, use the amplified sgRNA-1 and sgRNA-2 fragments as primers to obtain a fusion sequence containing the sgRNA-1 sequence and the sgRNA-2 sequence using the fusion PCR method, and purify the amplified product; (3) The purified sgRNA, repair DNA and Cas9 were transformed into fungi using the lithium acetate method to obtain positive cloned fungi.

3. The preparation method according to claim 2, characterized in that: Colony PCR was performed using define-F and define-R as primers to detect the genotype of the positive cloned fungi. After the NAT recombinant fragment replaced the SOD6 gene, a fragment of about 2.2 kb was produced, that is, a strain lacking the SOD6 gene was obtained; The define-F and define-R primer sequences are shown in SEQ.ID.NO.16-17.

4. The preparation method according to claim 2, characterized in that: The repair DNA forward sequence designed on both sides of the sgRNA sequence is shown in SEQ.ID.NO.4, and the repair DNA reverse sequence is shown in SEQ.ID.NO.

5.

5. The preparation method according to claim 2, characterized in that: Cas9 gene: P7 and P8 were used as primers and pV1093 plasmid was used as template to amplify the Cas9 gene; Repair DNA: pV1093 was used as template and repair-F and repair-R were used as primers to amplify the recombinant DNA fragment with NAT tag; sgRNA fusion sequence fragment: P1 and sg-R were used as primers and pV1093 was used as a template to amplify the sgRNA-1 fragment; The sgRNA-2 fragment was amplified using sg-F and P4 as primers and pV1093 as a template. Fusion PCR was performed using primers P5 and P6 and sgRNA-1 and sgRNA-2 as templates to amplify the complete sgRNA fusion sequence fragment. The primer sequences of P1, P4, P5, P6, P7, P8, sg-F, sg-R, repair-F, and repair-R are shown in SEQ.ID.NO.6-15.

6. The preparation method according to claim 2, characterized in that: The fungus is Candida albicans.

7. Use of the method for preparing the target gene SOD6 according to any one of claims 1 to 6 in fungi.

8. The use according to claim 7, characterized in that: The prepared fungus lacking the gene target SOD6 is used in screening or preparing targeted inhibitors or vaccines for treating fungal infection diseases.

9. The use according to claim 8, characterized in that: The fungus is Candida albicans.

Images