Application of CmbHLH93 gene in melon and gourd grafting

By silencing the CmbHLH93 gene in melon and using CGMMV virus vector and VIGS technology, the incompatibility problem of melon and gourd grafting was solved, and the successful grafting of melon and gourd and high yield were achieved.

CN119799765BActive Publication Date: 2025-10-21HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411940574.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2025-10-21
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

Grafting incompatibility leads to grafting failure between melons and gourds, affecting plant growth and yield. The existing technology has limited gene options for improving affinity.

Method used

The CmbHLH93 gene in melon was silenced using CGMMV viral vector and VIGS technology, and the CmbHLH93 gene was knocked out using gene editing technology to improve the affinity of melon and gourd grafting.

Benefits of technology

It significantly improved the success rate of melon and gourd grafting and the growth performance of the plants, and enhanced the health and yield of the grafted plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119799765B_ABST
    Figure CN119799765B_ABST
Patent Text Reader

Abstract

The application belongs to the grafting technical field, and particularly relates to application of a CmbHLH93 gene in melon and gourd grafting. The application provides a virus carrier for silencing a CmbHLH93 gene, and silences the CmbHLH93 gene of melon based on the carrier. The melon with the silenced gene is grafted with gourd, and graft compatibility is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the field of grafting technology, and specifically relates to the application of the CmbHLH93 gene in melon and gourd grafting. Background Art

[0002] Grafting is a method of asexual plant reproduction, in which the branch or bud of one plant (called a scion) is grafted onto the stem or root of another plant (called a stock), allowing the two to grow together to form a new plant. Grafting is mainly achieved by utilizing the plant's ability to callus after being injured. When the cambium of the scion and the stock are tightly combined, since the cambium cells have the ability to divide, they will continue to divide and produce new cells. These new cells will fill the gap between the scion and the stock, gradually forming callus tissue. As the callus tissue continues to grow and differentiate, it will connect the conducting tissues (such as the xylem and phloem) of the scion and the stock to each other, thereby realizing the transport of water and nutrients, allowing the scion to grow and develop normally on the stock.

[0003] However, grafting technology faces the technical problem of graft incompatibility. Graft incompatibility refers to the inability of the scion and rootstock to heal properly after grafting, or even after healing, the grafted plant exhibits a series of physiological or morphological abnormalities during growth. This incompatibility can lead to grafting failure, or cause the grafted plant to grow weak, become susceptible to pests and diseases, and even eventually die. For example, gourds are an important rootstock for melon crops. In the grafting of melons and gourds, the quality of the compatibility is directly related to the growth of the grafted seedlings and the subsequent yield and quality. Summary of the Invention

[0004] In view of this, the embodiments of the present application disclose at least the following technical solutions:

[0005] In a first aspect, the embodiment discloses a vector for silencing the CmbHLH93 gene, which is a viral vector containing the sequence shown in SEQ ID NO: 1.

[0006] In the second aspect, the embodiments disclose an engineered bacterium for silencing the CmbHLH93 gene, which contains the vector described in the first aspect.

[0007] In a third aspect, the embodiments disclose a method for silencing the CmbHLH93 gene in melon, comprising the step of introducing the vector described in the first aspect into melon.

[0008] In a fourth aspect, the embodiments disclose a method for producing a muskmelon with a silenced CmbHLH93 gene. The method comprises: preparing the vector described in the first aspect; transforming the vector into Agrobacterium to obtain an engineered bacterium that silences the CmbHLH93 gene; transforming the engineered bacterium into infected muskmelon seeds; and screening the infected melon progeny for positive clones, which are muskmelons with a silenced CmbHLH93 gene.

[0009] In a fifth aspect, embodiments disclose a method for grafting melons onto gourds. The method comprises: preparing a melon with a silenced CmbHLH93 gene; obtaining a branch or bud of the melon as a scion; obtaining a stem or root of a gourd as a rootstock; and grafting the scion onto the rootstock.

[0010] Compared with the existing technology, this application has at least the following technical effects:

[0011] The beneficial effects of this application are:

[0012] Grafting incompatibility seriously affects the quality and yield of melons, and the damage it causes is becoming increasingly serious. In melons, few genes that improve affinity have been reported and applied. This application has discovered a new function of the CmbHLH93 gene related to melon / cucurbit grafting affinity, providing new options and targets for melon / cucurbit grafting affinity. This application also provides a method for improving melon / cucurbit grafting affinity using CGMMV viral vectors and VIGS gene silencing technology, laying the foundation for resolving melon / cucurbit grafting incompatibility. Next, gene editing technology can be used to knock out the CmbHLH93 gene to obtain a melon grafting affinity resource that can be stably inherited. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of the results of PV190 plasmid.

[0014] Figure 2 The results of qRT-PCR detection of the relative expression level of the CmbHLH93 gene. In the figure, "PV190" is a melon plant infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" is a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector.

[0015] Figure 3 The plant heights of the melon and gourd provided in the example at 7, 14, and 21 days after grafting are shown. "PV190" refers to a melon plant infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" refers to a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector.

[0016] Figure 4 The fresh weight of the scion of the melon and gourd grafted in the example was measured 21 days after grafting. "PV190" refers to a melon plant infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" refers to a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector.

[0017] Figure 5The SPAD values ​​of the melon and gourd grafted on day 21 after the grafting provided in the examples are shown in Table 1. “PV190” refers to a melon plant infected with Agrobacterium containing the PV190 plasmid, and “PV190_CmbHLH93” refers to a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector.

[0018] Figure 6 This is a picture of the melon and gourd grafted 21 days after grafting provided in the examples. "PV190" is a melon plant infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" is a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0020] VIGS (Virus-Induced Gene Silencing) is a widely used technique for studying gene function in plants. It leverages plant defense mechanisms against viruses. Using recombinant viral vectors, partial sequences of target genes are introduced into plant cells, triggering the plant's own RNA silencing mechanism. This results in decreased expression or loss of function of the target gene, allowing for the study of the gene's role in various physiological processes, including plant growth, development, and disease resistance.

[0021] Plant cells contain an RNA silencing system primarily comprised of Dicer-like (DCL) proteins, Argonaute (AGO) proteins, and RNA-dependent RNA polymerase (RDR) proteins. When a virus invades a plant cell, its double-stranded RNA (dsRNA) is recognized by the DCL protein and cleaved into small interfering RNAs (siRNAs), typically 21-24 nucleotides in length. These siRNAs bind to the AGO protein to form an RNA-induced silencing complex (RISC). The siRNA in the RISC acts as a guide sequence, recognizing and binding to viral RNA homologous to its sequence through complementary base pairing. The AGO protein then activates its nuclease activity, degrading the target RNA and thereby inhibiting viral replication and spread.

[0022] Based on this, VIGS technology can be used to silence target genes using this mechanism: In VIGS technology, a sequence of the target gene (usually 200-1000bp) is inserted into a viral vector to construct a recombinant virus. When this recombinant virus is inoculated into a plant, the plant cells will transcribe the RNA of the recombinant virus. Because it contains the sequence of the target gene, the plant's RNA silencing mechanism will be activated. These RNAs containing the target gene sequence will be treated as foreign "viral RNA" and produce corresponding siRNA, which will cause the mRNA homologous to the target gene in the plant cell to be degraded, ultimately achieving the silencing of the target gene.

[0023] Based on this, the embodiment discloses a vector for silencing the CmbHLH93 gene, which is a viral vector containing the sequence shown in SEQ ID NO: 1.

[0024] In some embodiments, the viral vector is a PV190 plasmid.

[0025] Based on this, the embodiment discloses an engineered bacterium for silencing the CmbHLH93 gene, which contains a vector for silencing the CmbHLH93 gene.

[0026] In some embodiments, the engineered bacterium is Agrobacterium containing a vector for silencing the CmbHLH93 gene.

[0027] Based on this, the embodiment discloses a method for silencing the CmbHLH93 gene in melon, comprising the step of introducing a vector for silencing the CmbHLH93 gene into melon.

[0028] In some embodiments, the method comprises infecting melon seeds with Agrobacterium containing a vector for silencing the CmbHLH93 gene; and screening positive clones from the infected melon progeny, namely, melons with silenced CmbHLH93 gene.

[0029] Based on this, the examples disclose a method for producing a muskmelon with silenced CmbHLH93 genes. The method comprises: preparing the vector described in the first aspect; transforming the vector into Agrobacterium to obtain an engineered bacterium that silences the CmbHLH93 gene; transforming the engineered bacterium into infected muskmelon seeds; and screening the infected melon progeny for positive clones, which are muskmelons with silenced CmbHLH93 genes.

[0030] Based on this, the embodiment discloses a method for grafting melon and gourd. The method comprises: preparing a melon with silenced CmbHLH93 gene; obtaining a branch or bud of the melon as a scion; obtaining a stem or root of a gourd as a rootstock; and grafting the scion and the rootstock.

[0031] The following will illustrate the implementation of this application with reference to more specific examples, but it does not constitute a limitation on the implementation of this application. 1. Key materials and their descriptions:

[0032] PV190 plasmid (eg Figure 1 (as shown), published in the journal Plant Methods in 2020, paper link: https: / / doi.org / 10.1186 / s13007-020-0560-3.

[0033] Competent Escherichia coli DH5α and Agrobacterium tumefaciens GV3101 were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0034] The reverse transcription kit HiScript IIQ RT SuperMix for qPCR (+gDNAwiper); PCR amplification enzyme 2×TaqMaster Mix; and fluorescent quantitative dye ChamQ Universal SYBR qPCR Master Mix were all purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0035] All amplification primers used were synthesized by Wuhan Hece Biotechnology Co., Ltd.

[0036] 2. Preparation of vector for silencing CmbHLH93 gene

[0037] 1. Provide target sequence for silencing CmbHLH93 gene based on VIGS technology

[0038] From the Cucurbitaceae genome database, the target sequence shown in SEQ ID NO: 1 was obtained as the target sequence for silencing the CmbHLH93 gene based on VIGS technology.

[0039] 2. Extract melon RNA, reverse transcribe and PCR amplify to obtain the DNA described in SEQ ID NO: 4

[0040] Example Total RNA was extracted from the hypocotyl of a melon stem segment and reverse transcribed to obtain cDNA. PCR amplification was then performed using CmbHLH93-F and CmbHLH93-R as a primer pair. The amplified product was subjected to electrophoresis, and the DNA described in SEQ ID NO: 4 was recovered from the electrophoretic band.

[0041] The steps of extracting total RNA from the hypocotyl of the melon stem segment include:

[0042] 1) Grinding the hypocotyl of a melon stem segment with liquid nitrogen to obtain ground powder;

[0043] 2) Add the ground powder to Trizol reagent (mixing ratio: 100 mg ground powder to 1 mL Trizol reagent), homogenize, and shake at room temperature for 5 minutes;

[0044] 3) Add 0.2 ml of RNA Extraction Agent per 1 ml of Trizol reagent, shake vigorously for 15 seconds, and incubate at room temperature for 3 minutes;

[0045] 4) Centrifuge at 10,000 rpm and 2-8°C for 15 min. The sample will separate into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). Collect the upper aqueous phase, where the RNA is mainly located.

[0046] 5) Transfer the aqueous phase to a new centrifuge tube. Add 0.5 ml of isopropanol for every 1 ml of TransZol used, mix thoroughly by inversion, and incubate at room temperature for 10 min.

[0047] 6) Centrifuge at 10,000 rpm at 2-8°C for 10 min, remove the supernatant, and a gelatinous precipitate will form on the sides and bottom of the tube.

[0048] 7) Add 1 ml of 75% ethanol (prepared with DEPC-treated water) and vortex vigorously (add at least 1 ml of 75% ethanol for every 1 ml of TransZol used).

[0049] 8) Centrifuge at 7500 rpm at 2-8°C for 5 min. Allow the pellet to air dry at room temperature (approximately 5 min). Dissolve the pellet in 50-100 μL RNA dissolution buffer and incubate at 5-60°C for 10 min. Store the sample at -80°C for long-term use. This is a solution containing total RNA.

[0050] The step of obtaining cDNA by reverse transcription includes:

[0051] 1) Mix 2 μL of total RNA solution, 4 μL of 4×g DNA wiper mix, and 10 μL of RNAse-free ddH2O and react at 42°C for 2 minutes (in a PCR instrument).

[0052] 2) Add 4 μL of 5× HiseripⅡqRT superMixⅡ to step 1), maintain at 25°C for 10 min, maintain at 50°C for 30 min, and maintain at 85°C for 5 min to obtain cDNA.

[0053] The step of using CmbHLH93-F and CmbHLH93-R as a primer pair for PCR amplification includes:

[0054] 1) Prepare a PCR system containing 25 μL 2× SuperPfx MasterMix, 2.5 μL CmbHLH93-F, 2.5 μL CmbHLH93-R, 200 ng cDNA, and the balance ddH2O in 50 μL.

[0055] 2) The PCR system was pre-denatured at 98°C for 3 min; 35 cycles were performed consisting of 10 s of denaturation at 98°C, 30 s of annealing at 55°C, and 15 s of extension at 72°C; the reaction was then extended at 72°C for 10 min; and the reaction was maintained at 12°C.

[0056] Based on the target sequence, the upstream primer CmbHLH93-F as shown in SEQ ID NO: 2 and the downstream primer CmbHLH93-R as shown in SEQ ID NO: 3 were synthesized in the embodiment to perform PCR amplification on the target sequence, so that the 5' end of the target sequence as shown in SEQ ID NO: 1 has a homology arm ( CGTCAGGACTTTACTTAATGGATCC ) and a homology arm at the 3' end ( GGATCCAGTTATAGGTCTAGGTCG ), the DNA shown in SEQ ID NO: 4 can be amplified.

[0057] CmbHLH93-F: CGTCAGGACTTTACTTAATGGATCC ATAGAACGGCGATTCTGGCA, as in SEQ ID NO: 2, the homology arms are underlined.

[0058] CmbHLH93-R: CGACCTAGACCTATAACTGGATCC GCGAAGTCATTGAAGCAGCT, as in SEQ ID NO: 3, the homology arms are underlined.

[0059] The step of performing electrophoresis on the amplified product comprises:

[0060] Weigh 0.8g of agarose into a conical flask, add 40mL of 1× TAE solution, and microwave until the agarose is completely melted. Then, add 4μL of Ultra GelRed (10000×). Place the inner tank horizontally and place a comb in place. Pour the agarose gel solution, cooled to approximately 65°C, onto the glass plate of the inner tank. Let it stand at room temperature until the gel is completely solidified. Gently pull the comb vertically to prepare a 1.5% agarose gel. Place the gel and inner tank into an electrophoresis tank. Use a 10μL micropipette to add the DL2000 DNA Marker (as a control) and the above-mentioned PCR amplification product into the small groove of the gel plate. After adding the samples, apply power and perform electrophoresis at a voltage of 120V. After electrophoresis, remove the gel and visualize it with a gel imager using UV light. A band of approximately 300bp should be observed, indicating successful amplification of the target fragment.

[0061] The step of recovering the DNA described in SEQ ID NO: 4 from the electrophoresis band comprises:

[0062] Purification and recovery were performed using a PCR product purification kit (QIAGEN, QIAquick PCR Purification Kit (50), 28104). The following procedures were followed according to the instructions: Add the PCR product to a 2 mL centrifuge tube, add 5 volumes of Buffer PB equal to the volume of the PCR product, and mix well. Place the adsorption column in a 2 mL centrifuge tube, add the solution mixed well in the previous step to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the 2 mL centrifuge tube, add 750 μL of Buffer PE to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 min again, and discard the filtrate. Place the adsorption column in a clean 1.5 mL centrifuge tube and leave for 5 min. Add 30 μL of Buffer EB (heated to 65°C to improve elution efficiency) to the center of the adsorption column, let it stand at room temperature for 1 min, and centrifuge at 12000 rpm for 1 min. Obtain the PCR liquid recovery product. The concentration of the fragment liquid recovery was 126 ng / μL.

[0063] 3. Homologous recombination of the DNA shown in SEQ ID NO: 4 with the PV190 plasmid

[0064] Example: Single enzyme digestion of PV190 plasmid. The enzyme digestion reaction system (20 μL) contained 1 μg PV190 plasmid, 1 μL BamHI, 2 μL 10× KBuffer, and the balance double-distilled water. The enzyme digestion reaction conditions were incubation at 37°C for 3 hours.

[0065] In the present embodiment, homologous recombination reactions were performed between the digested PV190 fragment and the DNA set forth in SEQ ID NO:4. The homologous recombination reaction system (10 μL) contained 2 μL of 5× In-Fusion HD Enzyme Premix, 50 ng of the digested PV190 fragment, 100 ng of the DNA set forth in SEQ ID NO:4, and the remainder in double-distilled water. The homologous recombination reaction was incubated at 50°C for 15 minutes.

[0066] The embodiment also transforms the product of the homologous recombination reaction into E. coli, screens positive clones from the transformants, and extracts a large number of vectors for silencing the CmbHLH93 gene from the culture of the positive clones. Specifically, the process includes:

[0067] In a clean bench, transfer 5 μL of the homologous recombination reaction product into 100 μL of competent E. coli DH5α and gently flick to mix. Incubate on ice for 5 minutes, then heat shock the plate in a 42°C water bath for 90 seconds. Immediately incubate on ice for 3 minutes. Add 1 mL of LB solution and mix thoroughly. Incubate the plate at 37°C, shaking at 220 rpm for 30 minutes. Spread approximately 200 μL of the transformed bacterial solution evenly onto a solid LB+kan plate, seal the plate, and invert it in a 37°C incubator for 12 hours. A single colony that grows is considered a positive clone. A single plaque from a positive clone is inoculated into LB+kan liquid medium and incubated at 37°C, shaking at 220 rpm for 12 hours. The culture medium of the positive clone is sent to Wuhan Hece Biotechnology Co., Ltd. for sequencing and alignment with NCBI. Correct alignment indicates successful construction of the VIGS silencing vector. The vector for silencing the CmbHLH93 gene is extracted from the culture medium of this positive clone using conventional methods.

[0068] 4. Preparation of Agrobacterium containing vectors for silencing the CmbHLH93 gene

[0069] The embodiment also transferred the vector for silencing the CmbHLH93 gene into Agrobacterium GV3101 to obtain Agrobacterium containing the vector for silencing the CmbHLH93 gene. Specifically, the vector comprises:

[0070] In a clean bench, take 2 μL of the vector for silencing the CmbHLH93 gene and add it to 100 μL of GV3101 Agrobacterium competent cells. Gently flick to mix. After mixing, place the cells on ice for 5 minutes, freeze them in liquid nitrogen for 5 minutes, and then quickly place them in a 37°C water bath for 5 minutes. Add 700 μL of LB medium and incubate them on a shaker at 28°C and 220 rpm for 3 hours. Centrifuge at 12,000 rpm for 1 minute to collect the bacterial suspension. Discard the supernatant and resuspend the suspension in 100 μL of LB liquid medium. Mix thoroughly and spread the suspension evenly on solid LB+Kan+rif medium. Incubate at 28°C in the dark for 2 days. Pick out Agrobacterium monoclonal plaques and shake them in LB+Kan+rif liquid for 12 hours. Store the suspension in a -80°C ultra-low temperature freezer until needed.

[0071] 5. Infection of melon with Agrobacterium containing the vector for silencing the CmbHLH93 gene

[0072] The embodiment also provides a step of infecting muskmelon with Agrobacterium containing a vector for silencing the CmbHLH93 gene. The step comprises:

[0073] 1) Soak the melon seeds in 55°C warm water for 8 hours, and then culture the soaked melon seeds in the dark at 28°C for 24 hours to accelerate germination.

[0074] 2) Agrobacterium GV3101 containing the vector for silencing the CmbHLH93 gene was cultured in LB+kan+rif liquid culture medium (the mass percentage of kan was 0.1%, the mass percentage of rif was 0.1%) on a shaker for 18 h, and the Agrobacterium culture liquid was collected.

[0075] 3) Centrifuge the Agrobacterium culture at 6000 rpm for 8-10 minutes. Resuspend the pellet in MAA resuspension buffer as described in the table. Pour a small amount of the prepared MMA solution onto the culture and shake by hand. Adjust the OD value to 0.4 using MMA as a control. Incubate at room temperature in the dark for 2-3 hours.

[0076] 4) Spread melon seeds approximately 1 cm in length into a 9 cm Petri dish. Pour 30 ml of the above inoculum (OD600 = 0.4) into the dish, just enough to submerge the eye but not completely submerge the radicle. Incubate in the dark at 20°C-23°C for 24 hours. Then, place the inoculated seeds on sterile filter paper to absorb excess inoculum and sow. 20 days after sowing, if the melon leaves show signs of photobleaching, it indicates a positive clone.

[0077] Table 8 MAA resuspension preparation method

[0078] Reagents concentration volume water 500ml <![CDATA[MgCl2]]> 1M 5ml MES 0.5M 10ml AS 20mg / ml 200 μL

[0079] In addition, to verify that the melon plants that showed photobleaching were positive clones, qRT-PCR was also performed to detect whether the expression level of CmbHLH93 had indeed decreased. The qRT-PCR detection process includes:

[0080] 1) RNA was extracted from muskmelon tissues according to the above example and reverse transcribed to obtain cDNA.

[0081] 2) Using qPCR-CmbHLH93-F as shown in SEQ ID NO: 5 and qPCR-CmbHLH93-R as shown in SEQ ID NO: 6 as primer pairs, PCR amplification of cDNA was performed, using CmADP as the reference gene, and 2- ΔΔCt The relative expression level of CmbHLH93 was determined using a PCR amplification method in positive clones and in melon plants infected with Agrobacterium containing the PV190 empty plasmid. The PCR amplification system (10 μL) consisted of 0.5 μL of a 10 μM upstream primer, 0.5 μL of a 10 μM downstream primer, 1 μL of cDNA, 5 μL of ChamQ Universal SYBR qPCR Master Mix, and the remainder in double-distilled water. Reference gene primers were CmADP-F (shown in SEQ ID NO: 7) and CmADP-R (shown in SEQ ID NO: 8).

[0082] like Figure 2The relative expression level of the CmbHLH93 gene in the positive clone was significantly lower than that in the melon plants infected with Agrobacterium containing the PV190 empty plasmid, indicating that the CmbHLH93 gene was successfully silenced.

[0083] 6. Grafting

[0084] Take the branches and leaves of the positive cloned melon and graft them onto the gourd (one leaf and one heart) rootstock, cover to keep it moist, observe the phenotype, and use the melon plant infected with Agrobacterium containing PV190 empty plasmid as a control. Identify the phenotype of the grafted plant. Figure 3 As shown, from 7 to 21 days after grafting, the CmbHLH93 gene silenced plants grew better and their plant height continued to increase significantly compared with the PV190 empty-load control. Figure 6 It shows that on day 21, the CmbHLH93 gene silenced plants were taller.

[0085] like Figure 4 and Figure 5 As shown in Figure 3, 21 days after grafting, the fresh weight and SPAD value of the scion of the CmbHLH93 gene-silenced plants also increased significantly.

[0086] In summary, the vector for silencing the CmbHLH93 gene, the engineered bacteria for silencing the CmbHLH93 gene, the method for silencing the melon CmbHLH93 gene, the method for preparing a melon with silenced CmbHLH93 gene, and the melon and gourd grafting method provided in this application can improve the grafting affinity between melon and gourd.

[0087] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be covered by the scope of protection of the present application.

Claims

1. Melon and gourd grafting method, including: Introducing a vector for silencing the CmbHLH93 gene or an engineered bacterium containing the vector into a melon, wherein the vector is a viral vector containing the sequence shown in SEQ ID NO: 1, to prepare a melon in which the CmbHLH93 gene is silenced; obtaining a branch or bud of the melon as a scion; as well as The stem or root of the bottle gourd is obtained as a rootstock and the scion and the rootstock are grafted.

2. The melon and gourd grafting method according to claim 1, wherein the viral vector is a PV190 plasmid.

3. The melon and gourd grafting method according to claim 1, wherein the engineered bacteria is Agrobacterium containing the vector.

4. The method for grafting melon and gourd according to claim 1, comprising: Transforming the vector into Agrobacterium to obtain the engineered bacterium with the CmbHLH93 gene silenced; Infecting muskmelon seeds with the engineered bacteria; Positive clones were screened from the progeny of the infected melons, which were melons with CmbHLH93 gene silenced.

5. The method for grafting melon and gourd according to claim 1, wherein the preparation of the vector for silencing the CmbHLH93 gene comprises: The DNA sequence shown in SEQ ID NO: 4 was subjected to homologous recombination reaction with the PV190 plasmid.

6. The melon and gourd grafting method according to claim 5, wherein the homologous recombination reaction system (10 μL) comprises 2 μL of 5× In-Fusion HD Enzyme Premix, 50 ng of the enzyme-digested PV190 fragment, 100 ng of the DNA shown in SEQ ID NO: 4, and the balance of double-distilled water.

7. Use of a vector for silencing the CmbHLH93 gene or an engineered bacterium containing the vector in improving the grafting affinity between melon and gourd, wherein the vector is a viral vector containing the sequence shown in SEQ ID NO:

1.

8. Use of the vector for silencing the CmbHLH93 gene according to claim 7 or an engineered bacterium containing the vector in improving the grafting affinity between melon and gourd, wherein the viral vector is a PV190 plasmid.

9. Use of the vector for silencing the CmbHLH93 gene according to claim 7 or an engineered bacterium containing the vector in improving the grafting affinity between melon and gourd, wherein the engineered bacterium is Agrobacterium containing the vector.

Citation Information

Patent Citations

  • Compositions and methods for modulating pigment production in plants

    AU2006285507A1

  • Plant flavonoid synthesis regulation gene and its application

    CN103131715A