Application of wheat ELP2 gene in regulating resistance of wheat to stripe rust

Abstract

The application provides application of a wheat ELP2 gene in regulating resistance of wheat to stripe rust, and belongs to the technical field of genetic engineering. The application provides application of the wheat ELP2 gene in regulating resistance of wheat to stripe rust, also provides a silencing fragment of the wheat ELP2 gene obtained by an amplification method, and gene silencing of the wheat ELP2 gene is carried out by using the silencing fragment, and in the examples, overexpression plants of the ELP2 gene are constructed, it is found that the overexpression weakens the resistance of wheat to non-compatible races of Puccinia striiformis f. sp. tritici, the interaction relationship between ELP2 and the PAZ motif of DCL1 is verified by using yeast double hybridization, LCI and Pull-down, meanwhile, the resistance of wheat to compatible races is enhanced and the infection of Puccinia striiformis f. sp. tritici is inhibited after silencing DCL1 in wheat by VIGS, therefore, the ELP2 gene plays a disease function in the interaction between wheat and Puccinia striiformis f. sp. tritici.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the wheat ELP2 gene in regulating wheat resistance to stripe rust. Background Technology

[0002] Wheat (Triticum aestivum L.) is a widely cultivated cereal crop worldwide. Stripe rust, caused by the wheat-specific strain of Triticum aestivum, is a significant fungal disease affecting wheat production. Its rapid spread and wide-ranging impact make its control an urgent priority.

[0003] Wheat stripe rust is a fungal disease caused by *Striga styracifolium*, a wheat-specific rust fungus, and occurs in almost all wheat-producing regions worldwide. While chemical agents can effectively control the economic losses caused by wheat diseases, for environmental safety and human health reasons, developing and promoting disease-resistant varieties remains considered the most fundamental, economical, and safest approach.

[0004] Breeding and utilizing disease-resistant varieties is the best measure to control this disease, but the frequent mutations in the pathogen's virulence lead to the "loss" of resistance in wheat varieties. Discovering and utilizing genes with disease-resistant functions has become paramount in preventing large-scale outbreaks of stripe rust. However, current research on the genetics of wheat-stripe rust interactions is progressing slowly, and few genes regulating wheat susceptibility have been discovered. Therefore, it is necessary to expand the wheat stripe rust resistance gene pool. Summary of the Invention

[0005] This invention provides the application of the wheat ELP2 gene in regulating wheat resistance to stripe rust. The wheat ELP2 gene plays a susceptible role in the interaction between wheat and stripe rust fungus. Silencing the wheat ELP2 gene can enhance the resistance of wheat plants to stripe rust races.

[0006] This invention provides the application of the wheat ELP2 gene in regulating wheat resistance to stripe rust, and the nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0007] The present invention also provides the application of knocking down or knocking out the expression level of the wheat ELP2 gene in enhancing wheat resistance to stripe rust, wherein the nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0008] In a preferred embodiment of the present invention, the method for knocking down the expression level of the wheat ELP2 gene includes a virus-induced gene silencing method.

[0009] The present invention also provides a silencing fragment of the wheat ELP2 gene, the nucleotide sequence of which is shown in SEQ ID No. 2.

[0010] The nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0011] The present invention also provides primer pairs for amplifying the above-mentioned silent fragments, including a forward primer with a nucleotide sequence as shown in SEQ ID No. 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID No. 4.

[0012] The present invention also provides a recombinant silencing vector comprising the above-mentioned silencing fragments.

[0013] In a preferred embodiment of the present invention, the base vector of the recombinant silencing vector includes a γ vector.

[0014] The present invention also provides the application of the wheat ELP2 gene in the creation of wheat germplasm, the nucleotide sequence of which is shown in SEQ ID No.1.

[0015] The present invention also provides the application of the wheat ELP2 gene in screening or developing drugs to resist wheat stripe rust, wherein the nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0016] The present invention also provides a method for improving wheat resistance to stripe rust, comprising silencing the expression of the wheat ELP2 gene in the wheat genome, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0017] Beneficial Effects: This invention discovered that the ELP2 gene (TraesCS1A02G104700.1) is a protein complex that regulates gene transcription in eukaryotic cells by interacting with RNA polymerase II. Transcriptome sequencing showed that the ELP2 gene is upregulated in response to wheat infection with stripe rust fungus. In this embodiment, the ELP2 gene in wheat plants was silenced using a gene silencing method, which enhanced the resistance of wheat plants to infection by races compatible with stripe rust fungus. Simultaneously, the ELP2 gene was overexpressed in wheat plants, which weakened the resistance of wheat to races incompatible with stripe rust fungus. The interaction between ELP2 and the PAZ motif of DCL1 was verified using yeast two-hybrid assays, LCI, and pull-down assays. Furthermore, silencing DCL1 in wheat using VIGS inhibited stripe rust infection. Therefore, this invention demonstrates that the ELP2 gene plays a susceptible role in the interaction between wheat and stripe rust fungus. Attached Figure Description

[0018] Figure 1Figure 2 shows the results of detecting the growth, sporulation, and silencing efficiency of ELP2 gene in silenced wheat plants and non-silenced wheat plants after inoculation with stripe rust fungus CYR31; where A is the growth of ELP2 gene in silenced wheat plants and the phenotypic diagram of stripe rust fungus CYR31 inoculated with non-silenced wheat plants; B is the corresponding biomass after inoculation; and C is the result of detecting the expression level after silencing ELP2.

[0019] Figure 2 The figures show the growth, sporulation, and expression levels of ELP2-overexpressing transgenic wheat plants after inoculation with CYR23 stripe rust fungus in Example 3. Figure A shows the phenotype of CYR23 stripe rust fungus in ELP2-overexpressing transgenic wheat plants; Figure B shows the corresponding biomass after inoculation; and Figure C shows the expression level after ELP2 overexpression.

[0020] Figure 3 The diagram shows the interaction between the PAZ motifs of ELP2 and DCL1. In the diagram, A represents the yeast two-hybrid experiment, B represents the LCI experiment, and C represents the pull-down experiment.

[0021] Figure 4 Figure 5 shows the results of detecting the growth, sporulation, and silencing efficiency of stripe rust fungus after inoculation with CYR31 in wheat plants with the DCL1 gene silenced and in non-silenced wheat plants. Figure A shows the growth of stripe rust fungus CYR31 in wheat plants with the DCL1 gene silenced and the phenotypic diagram of stripe rust fungus CYR31 inoculated in non-silenced wheat plants. Figure B shows the corresponding biomass after inoculation. Figure C shows the expression level detection results after DCL1 silencing. Detailed Implementation

[0022] This invention provides the application of the wheat ELP2 gene in regulating wheat resistance to stripe rust, and the nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0023] The ELP2 gene described in this invention has the Gene ID TraesCS1A02G104700.1, a length of 2511 bp, and its nucleotide sequence is shown in SEQ ID No. 1:

[0024]

[0025] In this embodiment of the invention, the ELP2 gene was obtained by amplification. Specifically, using Ensemble Plantsdatabase:TraesCS1A02G104700 as a reference sequence, primers were designed, and the ELP2 gene was obtained by PCR amplification. During the PCR amplification, cDNA obtained from the reverse transcription of wheat total RNA was used as a template. The PCR amplification system, in 30 μL volumes, included: 15 μL Premix ExTaq, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 2 μL of wheat cell cDNA, and 11 μL of ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles.

[0026] The primer pairs used in this embodiment of the invention to amplify the ELP2 gene are shown below:

[0027] Forward primer (SEQ ID No. 5): 5'-ATGCCGCCGGCGGCCGG-3';

[0028] Reverse primer (SEQ ID No. 6): 5'-TCAAGTATCACGGACTGCA-3'.

[0029] The present invention also provides the application of knocking down or knocking out the expression level of the wheat ELP2 gene in enhancing wheat resistance to stripe rust, wherein the nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0030] The present invention does not specifically limit the method of knockdown or knockout; gene knockout or expression reduction can be performed using conventional methods in the art. In one embodiment of the present invention, the wheat ELP2 gene is silenced using a virus-induced gene silencing method, which can refer to the method described in the literature (Holzberg S, Brosio P, Gross C, et al. Barley stripe mosaic virus-induced gene silencing in amonocotplant[J]. Plant J,2002,30(3):315-327.).

[0031] This invention also provides a silencing fragment of the wheat ELP2 gene, the nucleotide sequence of which is shown in SEQ ID No. 2:

[0032] TCACTTTCATTAGCGGTGTTGCCAGAACAGGAAGGCTGCCTAATTTTAGCAATGGGAGGATTAGATCATAAGGTCCACATATATTGTGGGGATCAGTCAGGCAAGTTCATTAAAGCCTGTGAACTTAAGGGCCATTCTGACTGGATTAGAAGTTTAGACTTCTCTTACCTGTGATGACGAGCAGTGAGAAACACGGC.

[0033] The nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0034] The present invention also provides primer pairs for amplifying the above-mentioned silent fragments, including a forward primer with a nucleotide sequence as shown in SEQ ID No. 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID No. 4.

[0035] Forward primer (SEQ ID No. 3):

[0036] TTTTTTTTAGCTAGCTGATTAATTAATCACTTTCATTAGCGGTG;

[0037] Reverse primer (SEQ ID No. 4):

[0038] TCTTCCGTTGCTAGCTGAGCGGCCGCCCGTGTTTCTCACTGCT.

[0039] This invention uses the non-conserved region of the ELP2 gene as a silencing fragment. In one embodiment, when amplifying the silencing fragment, a T-vector connected to the ELP2 gene is used as a template. A forward primer with Pac I (TTAATTAA) introduced at the 5' end and a reverse primer with Not I (GCGGCCGC) introduced at the 5' end are selected for amplification, resulting in an amplification product of about 200 bp, which is the silencing fragment of the wheat ELP2 gene used in one embodiment of this invention.

[0040] The present invention also provides a recombinant silencing vector comprising the above-mentioned silencing fragments.

[0041] In one embodiment of the present invention, the silenced fragment is ligated into a target linearized vector, the target linearized vector including a linearized γ vector, such as by digesting the γ vector with Pac I and Not I, and then in one embodiment, the vector is constructed using a one-step cloning method.

[0042] The present invention also provides the application of the wheat ELP2 gene in the creation of wheat germplasm, the nucleotide sequence of which is shown in SEQ ID No.1.

[0043] Based on the function of the wheat ELP2 gene described in this invention, those skilled in the art can create wheat germplasm that meets the target expectations according to experimental or research needs, such as germplasm with high resistance to stripe rust, germplasm susceptible to stripe rust, and other germplasm targeting stripe rust resistance.

[0044] The present invention also provides the application of the wheat ELP2 gene in screening or developing drugs to resist wheat stripe rust, wherein the nucleotide sequence of the wheat ELP2 gene is shown in SEQ ID No. 1.

[0045] This invention can use wheat germplasm created using the wheat ELP2 gene as raw material to screen or develop drugs resistant to wheat stripe rust.

[0046] The present invention also provides a method for improving wheat resistance to stripe rust, comprising silencing the expression of the wheat ELP2 gene in the wheat genome, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0047] In this embodiment of the invention, the function of the wheat ELP2 gene was verified using Shuiyuan 11 as the varietal raw material. It was found that the number of leaf spores in wheat plants with silenced ELP2 gene significantly decreased after 14 days of inoculation with CYR31 stripe rust (compatible), while wheat plants without silenced ELP2 gene produced more spores after inoculation with CYR31 stripe rust. In transgenic wheat overexpressing the ELP2 gene, the number of leaf spores significantly increased compared to wild-type plants after 14 days of inoculation with CYR23 stripe rust (incompatible). Simultaneously, yeast two-hybrid, LCI, and pull-down experiments showed that the motif of ELP2 interacts with that of the DCL1 PAZ, and silencing DCL1 in wheat enhanced wheat resistance to the compatible race CYR31. Therefore, the ELP2 gene provided by this invention has the function of promoting wheat susceptibility to stripe rust. In this embodiment of the invention, a virus-induced gene silencing method is used to silence the wheat ELP2 and DCL1 genes, thereby reducing the expression levels of the ELP2 and DCL1 genes and enhancing the resistance of wheat plants to stripe rust fungus.

[0048] To further illustrate the present invention, the application of the wheat ELP2 gene provided by the present invention in regulating wheat resistance to stripe rust is described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] 0.5g of fresh wheat leaves were collected, and total RNA was extracted from wheat cells using the Magen Plant RNA Extraction Kit. cDNA was then synthesized using the Vazyme cDNA Synthesis Kit. Primers (SEQ ID No. 5 and SEQ ID No. 6) were designed and optimized using Primer 5.0 software. The synthesized cDNA was used as a template for PCR amplification. The PCR amplification system was 20μL, including 10μL Premix ExTaq, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 2μL of wheat cell cDNA, and 7μL of ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles.

[0051] After PCR amplification, the target fragment was purified using a DNA purification kit. The purified target fragment was ligated with the pMD19-T vector at 16℃ for 12 hours to obtain the ligation product. The obtained ligation product was transformed into E. coli DH5α competent cells. The transformed E. coli DH5α cells were inoculated on LB plates coated with ampicillin for selection culture to obtain positive clones.

[0052] After obtaining positive clones, colony PCR was used to verify the positive clones. Then, three independent positive clones were randomly selected from the verified positive clones and sent to a biotechnology company for sequencing. After sequencing, the sequence of the ELP2 gene was obtained, as shown in SEQ ID No. 1.

[0053] Primer sequences for colony PCR:

[0054] Forward primer (SEQ ID No. 5): 5'-ATGCCGCCGGCGGCCGG-3';

[0055] Reverse primer (SEQ ID No. 6): 5'-TCAAGTATCACGGACTGCA-3';

[0056] 15 μL colony PCR: 7.5 μL Premix ExTaq, 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, and 6.5 μL ddH2O.

[0057] Example 2

[0058] Using the T-vector containing the ELP2 gene described in Example 1 as a template for the cloned target gene sequence, PCR amplification was performed using primers shown in SEQ ID No. 3 and SEQ ID No. 4. The amplification product was about 200 bp in size. The target fragment was recovered by gel extraction. The purified PCR product was ligated and linearized with a γ-vector digested with Pac I and Not I enzymes. The γ-ELP2 vector was constructed using a one-step cloning method.

[0059] 20 μL one-step cloning reaction system: 50-200 ng linearized vector, 20-200 ng PCR product of insert fragment, 4 μL 5×CEⅡ buffer, 1 μL Exnase Ⅱ and the remainder ddH2O.

[0060] The α, β, γ, and γ-ELP2 plasmids were linearized using their respective restriction endonucleases. The plasmids were digested at 37°C for 2 hours in a PCR instrument, and 1 μL of the digestion product was then subjected to gel electrophoresis to ensure complete vector linearization. Finally, the restriction endonucleases were inactivated at 65°C for 20 minutes.

[0061] (1) 20 μL α / γ plasmid digestion system: 2 μL 10×R Buffer, 1.5 μL M1uI (10U / μL), 3 μg α / γ plasmid and the remainder ddH2O;

[0062] (2) 20 μL β plasmid digestion system: 2 μL 10×Tango Buffer, 1.5 μL Spe I (10 U / μL), 3 μg β plasmid and the remainder ddH2O;

[0063] (3) 20 μL γ-ELP2 digestion system: 2 μL 10×R Buffer, 1.5 μL BssHI (10 U / μL), 3 μg γ-ELP2 plasmid and the remainder ddH2O;

[0064] Linearized plasmids of α, β, γ, and γ-ELP2 were transcribed in vitro. The transcribed products were incubated at 37°C for 2 hours in a PCR instrument. After the reaction, 1 μL of the in vitro transcription product was diluted 10-fold with nuclease-free water and immediately analyzed by gel electrophoresis.

[0065] In vitro transcription reaction system: 3.5 μL linearized plasmid, 2.0 μL 5×T7 Transcription Buffer, 0.5 μL each of the four rNTPs (total 2 μL), 0.5 μL RNase Inhibitor, 0.5 μL Ribo m7G capAnalog, 0.5 μL Nuclease-free Water, and 1.0 μL T7 Enzyme.

[0066] Wheat seedlings (Shuiyuan 11) with uniform growth and at the two-leaf-one-bud stage were selected for virus inoculation, with 50-60 seedlings per treatment. 10 μL of linearized α plasmid, linearized β plasmid, and linearized γ-ELP2 plasmid were added separately, mixed in equal proportions, and then 170 μL of es buffer was added and mixed thoroughly. After each mixing, 10 μL of the mixture was pipetted to the fingertip of a clean disposable glove, and the seedlings were inoculated by rubbing the mixture onto the two leaves of the wheat seedlings with the index finger and thumb. Plants inoculated with the empty γ-ELP2 plasmid vector served as negative controls, and plants inoculated with the γ-ELP2 plasmid served as positive controls. The wheat seedlings inoculated with barley stripe mosaic virus were then treated at 25℃-28℃ under high temperature and high humidity conditions for 24 h, and then transferred to 16℃ for further cultivation.

[0067] Ten to fourteen days after inoculation with barley stripe mosaic virus, mottled symptoms caused by viral infection could be observed on wheat leaves. Simultaneously, photobleaching also occurred in the positive control plants. Subsequently, wheat stripe rust fungus CYR31 (a compatible strain) was inoculated. Based on the location of photobleaching in the positive control, lines were drawn on the upper surface of the fourth leaf of each treatment wheat variety to mark the inoculation area. The stripe rust fungus was then diluted with fluoride solution and evenly applied along one direction of the marked area on the leaf. Inoculated wheat seedlings were immediately sprayed with water to maintain humidity and placed in a 16°C humidity chamber for 24 hours. The wheat was then transferred to a 16°C light incubator for cultivation, and phenotypic observation was performed after 14 days.

[0068] The results are as follows Figure 1 As shown, wheat plants with silenced ELP2 gene inoculated with CYR31 stripe rust produced fewer sporulations, while wheat plants without silenced ELP2 gene inoculated with CYR31 stripe rust produced more sporulations. Real-time quantitative PCR was used to detect biomass at 5 and 7 days after inoculation with stripe rust. The results showed that the biomass of stripe rust on the leaves of TaELP2-silenced plants was significantly lower than that of the control. The silencing efficiency of wheat leaves after ELP2 silencing was tested, and the results indicated that silencing ELP2 led to enhanced resistance of wheat to the stripe rust race.

[0069] Example 3

[0070] Using a T-vector linked to the ELP2 gene described in Example 1 as a template for the cloned target gene sequence, primers with BmaHI restriction sites were designed based on the pCUB vector map, using the CDS region sequence of TaELP2. The TaELP2-pCUB recombinant vector was constructed using homologous recombination. After obtaining the recombinant plasmid, it was transformed into Agrobacterium EHA105 using a liquid nitrogen freeze-thaw method. Agrobacterium-mediated genetic transformation integrated the transgenic vector into wheat embryos. The recipient variety was wheat Fielder. Transgenic tissue culture was performed by Professor Huang Xueling of the State Key Laboratory of Crop Stress Resistance and High-Efficiency Production at Northwest A&F University.

[0071] After obtaining transgenic wheat that had overexpressed the virus, T2 generation overexpression plants identified as positive were cultured until they reached the two-leaf stage. The two leaves were then inoculated with the CYR23 physiological race of stripe rust fungus. After inoculation, the plants were kept in darkness and kept moist for 24 hours, after which they were placed in an incubator for normal growth. Sporulation in the wheat leaves was observed approximately 14 days later. Simultaneously, RNA was extracted from the positive plants, and qRT-PCR was used to detect the TaELP2 overexpression in the overexpression lines.

[0072] The results are as follows Figure 2 As shown, necrosis symptoms appeared after inoculation with the incompatible race CYR23. Necrotic spots also appeared on the leaves of the ELP2 overexpressing lines compared with wild-type Fielder, but spore masses were produced. Subsequently, the relative biomass of Fielder and overexpressing lines was detected. The relative biomass of the overexpressing lines was significantly increased compared with the control. The expression level of ELP2 in Fielder and overexpressing transgenic plants was detected by qRT-PCR, indicating that the overexpression of ELP2 reduced the resistance of wheat to stripe rust.

[0073] Example 4

[0074] Literature reports the interaction between ELP2 and DCL1 in Arabidopsis (Fang X, Cui Y, Li Y, Qi Y. Transcription and processing of primary microRNAs are coupled by Elongator complex in Arabidopsis. Nat Plants. 2015 Jun 1; 1:15075. doi:10.1038 / nplants.2015.75.PMID:27250010.). The PAZ motif sequence of wheat DCL1 was obtained through homologous sequence alignment, as shown in SEQ ID No. 7.

[0075] GAGAATTCATTTCCTAGGAAGGAAGGCTACCTGGGGCCTTTGGAATATAGCTCATATGCCGATTACTACAAGCAGAAATATGGTGTGGAGCTAGTGTATAAGAAACAACCTCTTATACGTGCACGTGGT GTTCCTATTGCAAGAATCTTCTGTCTCCTAGATTTGAGCATTCTGAAGCTAGAGAAGGTGACTTTTCGGAGAACGTTGACAAAACATACTATGTGTATTTACCACCTGAACTTTGCCTTGTGCACCCA.

[0076] Similar to the steps in Example 1, primers (SEQ ID No. 8 and SEQ ID No. 9) were designed using Primer 5.0 software and manually optimized. The PAZ motif sequence of DCL1 was obtained by PCR amplification and constructed into the T vector.

[0077] Forward primer (SEQ ID No. 8): GAGAATTCATTTCCTAGG;

[0078] Forward primer (SEQ ID No. 9): TGGGTGCACAAGGCAAAGT;

[0079] Yeast two-hybrid assay: The ELP2 gene was constructed into the pGBKT7 vector, and the DCL1 PAZ motif sequence was constructed into the pGADT7 vector. Interaction was verified using yeast two-hybrid assay. The ELP2-BD plasmid was then cross-linked with the DCL1 gene. PAZ -AD plasmid was simultaneously transformed into yeast AH109 competent cells, with ELP2-BD and empty AD plasmid as negative controls. 10 μL ssDNA (10 mg / mL), 70 μL 10×TE, 70 μL 10×LiAc, and 560 μL 50% PEG4000 were added to the competent cells. After gently rotating and mixing, the cells were incubated at 30°C and 200 rpm for 30 min. 70 μL DMSO reagent was added to the centrifuge tube, and the cells were heat-shocked in a 37°C water bath for 15 min and then placed on ice for 2 min. (9) The cells were centrifuged at 4500 rpm for 5 min, the supernatant was discarded, and 100 μL 1×TE solution was added to suspend the cells. When finally plating, the plate culture medium was SD / -Trp-Leu and SD / -Trp-Leu-His. If colonies grow on SD / -Trp-Leu-His medium, resuspend them in ddH2O and transfer them to SD / -Trp-Leu-His-Ade+X-α-gal medium. Observe whether the yeast colonies turn blue. If they do, it indicates that there is an interaction between the two.

[0080] Luciferase complementation assay verification: Vector primers with two restriction enzyme sites, BamHI and SalI, were designed to construct the recombinant vector ELP2-Cluc,DCL1. PAZ -Nluc, after obtaining the plasmid, was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method, DCL1 PAZ -Nluc bacterial solution was mixed with ELP2-Cluc and GUS+Cluc bacterial solutions in equal proportions and injected into both sides of the back of tobacco leaves. After culturing for 40 hours, the leaves were removed, luciferase was applied to the injection sites, and the leaves were placed in the dark for 5 minutes before the fluorescence intensity was detected using a plant in vivo molecular imaging system.

[0081] pull-down: Builds ELP2 onto pET 28a, DCL1 PAZ The recombinant plasmid was constructed into pGEX 4T-1 and transformed into competent BL21 expression cells. The cells were cultured overnight at 16°C and then collected for sonication. Protein-protein interactions were validated using a GST-pull-down kit (Thermo, USA). Horseradish peroxidase (HRP)-conjugated anti-His-tag and anti-GST-tag mouse monoclonal antibodies (Beyotime Biotech, China) were used for Western blot analysis.

[0082] The results of yeast two-hybrid, LCI, and pull-down experiments are as follows: Figure 3 As shown, this indicates that there is an interaction relationship between the PAZ motifs of ELP2 and DCL1.

[0083] Example 5

[0084] The DCL1 described in Example 4 PAZ The T-vector of the gene was used as a template for the cloned target gene sequence. PCR amplification was performed using the primers shown in SEQ ID No. 8 and SEQ ID No. 9. The target fragment was recovered by gel electrophoresis, and the purified PCR product was ligated with the γ-vector linearized by PacI and NotI restriction enzymes. A one-step cloning method was used to clone the γ-DCL1 vector. PAZ Construction. Subsequent experimental procedures are the same as in Example 2.

[0085] The results are as follows Figure 4 As shown, silent DCL1 PAZ Subsequent inoculation with the affinity race CYR31 significantly reduced sporulation and biomass, enhancing wheat's resistance to the affinity race of stripe rust.

[0086] The above results demonstrate that the wheat ELP2 gene plays a role in the infection response of wheat to stripe rust.

[0087] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Knock down wheat ELP2 Gene expression levels or knockout wheat ELP2 The application of genes in enhancing wheat resistance to stripe rust is characterized by, The wheat ELP2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, The knockdown of wheat ELP2 Methods for measuring gene expression include virus-induced gene silencing.

3. Reduce wheat ELP2 The application of gene expression in creating wheat germplasm with high stripe rust resistance is characterized by, The wheat ELP2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. A method for improving wheat resistance to stripe rust, characterized in that, Including the silent wheat genome ELP2 Gene expression, in wheat ELP2 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

Images