Method for improving heat resistance of wheat by editing TaTT2 gene

Abstract

The invention discloses a method for improving heat resistance of wheat by editing a TaTT2 gene. According to the invention, the constructed expression vector pBUE411-TT2 with the function of knocking out the TaTT2 gene is transferred into the wheat to silence the expression of the TaTT2 gene in the wheat, so that a wheat plant with higher heat resistance can be obtained. By utilizing a wheat gene editing system, the genome level TaTT2 gene can be silenced through a gene transformation process, and the method is a powerful tool for silencing the TaTT2 gene by utilizing a gene engineering technology. Meanwhile, three copies of the TaTT2 gene are silenced, so that researchers can be helped to create new wheat germplasm with higher heat resistance by utilizing the mutant, and candidate genes and heat-resistant germplasm resources are provided for wheat breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for improving the heat resistance of wheat by editing the TaTT2 gene, and the development of a heat-resistant molecular marker thereof. Background Art

[0002] Global warming seriously threatens food security worldwide by reducing crop productivity and quality. Studies have predicted that by 2040, the average temperature will rise by 1.5-2.0℃, which will reduce global food production by 30%-40%. Every 1℃ increase in global average temperature will lead to a 19.7% reduction in the production of major food crops, including a 6.0% reduction in wheat production. At the same time, as the global population continues to increase, food demand will also double, which is a huge challenge that everyone needs to deal with.

[0003] At present, climate warming has become an unstoppable trend. In this case, in order to increase food production, it is urgent to find technologies and measures that can increase food production under high temperatures. Wheat is the most important food crop in the world, providing 20% ​​of the heat energy and protein needed by humans and feeding 40% of the world's population. Therefore, in today's severe situation, it is necessary to find key genes for wheat heat resistance through various means, and accelerate the cultivation of new wheat varieties that are heat-resistant, high-yield, and high-quality through technologies such as transgenics combined with traditional breeding to cope with the severe challenges brought about by global warming and population growth.

[0004] In 2022, Lin Hongxuan's research team discovered that the TT2 gene encodes a G protein γ subunit. High temperature will induce the generation of calcium signals and increase the intracellular calcium concentration. High concentrations of calcium ions will be sensed by CaM and promote the interaction between CaM and SCT1, thereby strengthening CaM's inhibition of SCT1 transcriptional activity, ultimately leading to a rapid decrease in the expression of OsWR2 under high temperature conditions, a decrease in wax content, and ultimately an inability to withstand high temperatures, presenting a heat-sensitive phenotype. The OsTT2 gene was knocked out, and the tt2 mutant had a high survival rate after high temperature stress. After high temperature stress during the filling period of adult plants, the grains of the tt2 mutant were larger and had a higher thousand-grain weight than the wild type. However, whether this gene is heat-resistant in wheat has not been reported.

[0005] Wheat is an allohexaploid crop, consisting of three sets of genomes, A, B and D. The homologous genes of these three sets of genomes have high homology. Only when these homologous genes mutate at the same time can gene knockout mutants be obtained. Using the CRISPR / Cas9 (Clustered regularly interspaced short palindromicrepeats) / (CRISPR-associated 9) editing system, sgRNA is designed according to the conserved regions between homologous genes, which can achieve the simultaneous knockout of all homologous genes in wheat. Using this system to knock out the TaTT2 gene of wheat to create heat-resistant wheat germplasm resources will have important guiding significance for heat-resistant wheat breeding. Summary of the invention

[0006] The present invention uses a wheat gene editing system to provide a method for improving wheat heat tolerance by editing three homologous genes of TaTT2, and develops a molecular marker for detecting target site mutations. The present invention is to transfer the constructed expression vector pBUE411-TT2 with a knockout TaTT2 gene into wheat, silence the expression of the TaTT2 gene in wheat, and obtain heat-resistant wheat plants.

[0007] The technical solution adopted by the present invention to solve its technical problem is: a method for improving the heat resistance of wheat by editing the wheat TaTT2 gene, characterized in that the expression of the wheat TaTT2 gene in wheat is reduced or silenced.

[0008] The wheat TaTT2 gene is located on 7A, 7D and 4A of chromosome 4 in wheat, and is named TaTT2-7A, TaTT2-7D and TaTT2-4A, respectively. The nucleotide sequences of TaTT2-7A, TaTT2-7D and TaTT2-4A are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0009] The method of reducing or silencing the expression of wheat TaTT2 gene in wheat specifically comprises the following steps:

[0010] 1) Design and synthesize sgRNA targeting TaTT2 gene;

[0011] 2) Connecting the sgRNA obtained in step 1) to the pBUE411 vector to construct a pBUE411-TT2 binary vector with the function of knocking out the wheat TaTT2 gene;

[0012] 3) The binary vector obtained in step 2) is transformed into plants by Agrobacterium-mediated transformation to reduce or silence the expression of the wheat TaTT2 gene, thereby obtaining wheat plants with high heat resistance.

[0013] The nucleotide sequence of the sgRNA of the TaTT2 gene described in step 1) is shown in SEQ ID NO:4.

[0014] The pBUE411-TT2 binary vector having the function of knocking out the wheat TaTT2 gene described in step 3) comprises an expression cassette A and an expression cassette B;

[0015] The expression cassette A specifically includes the following elements from upstream to downstream: the TaU3 promoter A from wheat, the sgRNA of the TaTT2 gene and the terminator A;

[0016] The expression cassette B specifically includes the following elements from upstream to downstream: the promoter B, the corn Cas9 coding sequence, and the terminator B.

[0017] The sgRNA is shown in SEQ ID NO: 4; the corn Cas9 coding sequence is shown in SEQ ID NO: 5; the sequence of the promoter A is shown in SEQ ID NO: 6; the sequence of the promoter B is shown in SEQ ID NO: 7; the sequence of the terminator A is shown in SEQ ID NO: 8; and the sequence of the terminator B is shown in SEQ ID NO: 9.

[0018] The expression cassette A is located upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

[0019] The pBUE411-TT2 binary vector also contains a resistance marker gene, such as a bar gene; the nucleotide sequence of the pBUE411-TT2 binary vector is as follows:

[0020] >Vector

[0021] Gtaaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcc

[0022] aagctcaagctgctctagcattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctgg

[0023] cgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagct

[0024] tcatgaatccaaaccacacggagttcaaattcccacagattaaggctcgtccgtcgcacaaggtaatgtgtgaatattatatctgtcgtgc

[0025] aaaattgcctggcctgcacaattgctgttatagttggcggcagggagagttttaacattgactagcgtgctgataatttgtgagaaataat

[0026] aattgacaagtagatactgacatttgagaagagcttctgaactgttattagtaacaaaaatggaaagctgatgcacggaaaaaggaaagaa

[0027] aaagccatacttttttttaggtaggaaaagaaaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcaggcag

[0028] cagcccaccaacctcacgggccagcaattacgagtccttctaaaagctcccgccgaggggcgctggcgctgctgtgcagcagcacgtctaa

[0029] cattagtcccacctcgccagtttacagggagcagaaccagcttataagcggaggcgcggcaccaagaagcggcgaaagtccccgctcgacc

[0030]

[0031] agctgttttactcaaatacacatcacctttttagacggcggcgctcggtttcttcagcggccaagctggccggccaggccgccagcttggc

[0032] atcagacaaaccggccaggatttcatgcagccgcacggttgagacgtgcgcgggcggctcgaacacgtacccggccgcgatcatctccgcc

[0033] tcgatctcttcggtaatgaaaaacggttcgtcctggccgtcctggtgcggtttcatgcttgttcctcttggcgttcattctcggcggccgc

[0034] cagggcgtcggcctcggtcaatgcgtcctcacggaaggcaccgcgccgcctggcctcggtgggcgtcacttcctcgctgcgctcaagtgcg

[0035] cggtacagggtcgagcgatgcacgccaagcagtgcagccgcctctttcacggtgcggccttcctggtcgatcagctcgcgggcgtgcgcga

[0036] tctgtgccggggtgagggtagggcgggggccaaacttcacgcctcgggccttggcggcctcgcgcccgctccgggtgcggtcgatgattag

[0037] ggaacgctcgaactcggcaatgccggcgaacacggtcaacaccatgcggccggccggcgtggtggtgtcggcccacggctctgccaggcta

[0038] cgcaggcccgcgccggcctcctggatgcgctcggcaatgtccagtaggtcgcgggtgctgcgggccaggcggtctagcctggtcactgtca

[0039] caacgtcgccagggcgtaggtggtcaagcatcctggccagctccgggcggtcgcgcctggtgccggtgatcttctcggaaaacagcttggt

[0040] gcagccggccgcgtgcagttcggcccgttggttggtcaagtcctggtcgtcggtgctgacgcgggcatagcccagcaggccagcggcggcg

[0041] ctcttgttcatggcgtaatgtctccggttctagtcgcaagtattctactttatgcgactaaaacacgcgacaagaaaacgccaggaaaagg

[0042] gcagggcggcagcctgtcgcgtaacttaggacttgtgcgacatgtcgttttcagaagacggctgcactgaacgtcagaagccgactgcact

[0043] atagcagcggaggggttggatcaaagtactttgatcccgaggggaaccctgtggttggcatgcacatacaaatggacgaacggataaacct

[0044] tttcacgcccttttaaatatccgttattctaa

[0045] The sequence tables of the mutation detection primers pBUE411-F, pBUE411-R, TT2-Primer-F, and TT2-Primer-R at the target site of the sgRNA described in step 2) are shown as SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13, respectively.

[0046] The present invention constructs an expression vector that can realize the in vivo editing of three partial homologous genes TaTT7A, TaTT2-7D and TaTT2-4A by designing a specific guide single-stranded sgRNA, and can simultaneously knock out three copies of the wheat TaTT2 gene. The TaTT2 gene is located on 7A, 7D and 4A in wheat, and is named TaTT7A, TaTT2-7D and TaTT2-4A, respectively. The full length of its genome sequence on 7A, 7D and 4A is 1983, 2352 and 1936 bases, respectively, and these three partial homologous genes are composed of 5 exons and 4 introns. TaTT7A, TaTT2-7D and TaTT2-4A contain open reading frames of 510, 510 and 366 bases, respectively, encoding a polypeptide chain containing 170, 170 and 122 amino acid residues, respectively. The similarity of the coding regions among the three partially homologous genes TaTT7A, TaTT2-7D and TaTT2-4A is very high. This feature provides a theoretical basis for using gene editing technology to simultaneously silence the above three genomic sites.

[0047] Beneficial effects:

[0048] In practical applications, the silencing of the TaTT2 gene at the genome level can be achieved through a gene transformation process, which is a powerful tool for silencing the TaTT2 gene using genetic engineering technology. Silencing the three partial homologous genes of TaTT2 at the same time can improve the heat tolerance of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 .The deduced amino acid sequence of the wild-type wheat TaTT2 gene.

[0050] Figure 2. Deduced amino acid sequence of the mutant wheat tt2 gene.

[0051] Figure 3 The mutation type of the sgRNA target site in the .tt2 mutant. The second column is the mutation type, and the number in the third column is the number of reads from hitom sequencing.

[0052] Figure 4 .Heat treatment phenotype of tt2 mutant at seedling stage.

[0053] Figure 5 .The phenotype of the tt2 mutant after dry hot wind.

[0054] Figure 6 .Yield phenotype of tt2 mutant after dry hot wind. DETAILED DESCRIPTION

[0055] In order to enable those skilled in the art to better understand the technical solutions in the present application, the present invention is further described below in conjunction with embodiments. The described embodiments are only a part of the embodiments of the present application, not all of them, and the present invention is not limited to the following embodiments.

[0056] The following examples are convenient for better understanding of the present invention, but they are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. The high-fidelity enzyme required for PCR amplification, the T4 ligase required for DNA fragment ligation, the gel recovery kit required for enzyme fragment recovery, and the plasmid extraction kit were all purchased from Dalian Bao Biotechnology Company. The plasmid extraction kit was purchased from Tiangen Biology, the inorganic salts required for culture medium preparation were purchased from Sinopharm Group, and vitamins, antibiotics, and hormones were purchased from Sigma. The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9p simulates the characteristics of the 5'-end GC content of the grass plant gene, and is a designed and synthesized plant optimized codon gene. The Escherichia coli strain used in this laboratory is E.coli DH5α.

[0057] T4 ligase, DNA Marker DL2000 and other reagents were purchased from Takara; FastPfu, 2*Taq Mix, DH5α and others were purchased from Beijing Quanshijin Company; restriction endonuclease BsaI-HF was purchased from NEB Company; the primers used were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., and the sequences are as follows:

[0058] Table 1 Primers used in this study

[0059]

[0060] The wheat variety JW1 is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0061] Plasmid pBUE411 (17430 bp) was provided by Sun Qixin's research group at China Agricultural University; it is available to the public from China Agricultural University.

[0062] Experimental Example 1 Construction of expression vector

[0063] 1. Design of sgRNA targeting TaTT2 gene

[0064] A suitable targeting site was found in the coding region of the TaTT2 gene through the website CRISPRdirect (http: / / crispr.dbcls.jp / ), and a 20 bp sequence fragment was found before the PAM structure and set as the target sequence. The sgRNA sequence of TaTT2 was selected as AAGTCCCCGCTCGACCCCTG CGG .

[0065] 2. Linearization of pBUE411 vector

[0066] The pBUE411 vector was digested with BsaI endonuclease, and the pBUE411 vector was connected to the sgRNA. The connection reaction system was: 5×ligation Buffer 2μL, annealed oligo duplex 4μL, pBUE411 / BsaI 2ul (100ng), T4 ligase 1μL, ddH2O supplemented to 10μL, and the connection reaction was carried out at 25℃ for 30min.

[0067] 3. Conversion Verification

[0068] The ligation product was transformed into E. coli, and the recombinant plasmid was transformed into DH5α competent cells. After that, the cells were cultured on LB (kan) plates until clones grew out. Single clones were selected for bacterial liquid PCR identification and sequencing. The primers used were pBUE411-F and pBUE411-R (Table 1). TaU3 promoter sequence and sgRNA sequence were detected upstream of the target sequence, indicating that the sgRNA expression cassette was successfully constructed and successfully assembled into the pBUE411 binary expression vector, proving that the CRISPR / Cas9 gene editing vector of pBUE411-TT2 was successfully constructed.

[0069] Experimental Example 2 Transformation of Gene Editing Vector into Common Wheat

[0070] 1. Culture medium preparation: see Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science + Business Media New York 2015

[0071] 2. Agrobacterium transformation: Take wheat ears that have been pollinated for about 15 days, and remove the embryos from the grains. Shake the Agrobacterium suspension the day before the experiment, and culture it at 160r and 28 degrees for 24 hours. After the ears are ready, start preparing the Agrobacterium suspension. Take 1ml of the bacterial solution in a 1.5ml centrifuge tube, add 1.4ul of acetosyringone (0.1M) and mix well. Add the prepared bacterial solution and infect for 5 minutes, then place it on the co-cultivation medium and culture it in the dark at 23 degrees for 3 days. After co-cultivation, place it on the resting medium and culture it in the dark at 25 degrees for 5 days. Transfer the callus to the screening medium 1. Seal the culture dish with a sealing film and culture it in the dark in a 25.5-degree incubator for 2 weeks. Cut the callus and transfer it to the screening medium 2.

[0072] Seal the culture dish with a sealing film and culture it in a dark incubator at 25.5 degrees for 2 weeks. After 2 weeks of callus cutting and screening, calli showing resistance are transferred to the regeneration medium. Resistant calli generally have green buds or green spots, or beautiful beige spherical structures.

[0073] Mushy and brown callus should not be transferred. Callus with proliferation can be cut into smaller callus. Small pieces from the same callus should be placed on the same line again. Pay attention to the direction of the callus, for example, green buds and green spots facing up.

[0074] Seal the culture dish and place it in a 25-degree incubator for 2 weeks under light (16 hours). After 2 weeks of regeneration, transfer the healthy seedlings to a new resistance regeneration box. When the seedlings grow to a certain size, samples can be taken for testing.

[0075] 3. Mutant Detection in Transgenic Seedlings

[0076] Specific amplification of target sites and identification of mutants in T0 transgenic plants

[0077] Whether the target gene editing is successful requires sequencing to identify. This experiment uses the Hi-TOM gene editing site detection kit produced by Xi'an Qingxue Biotechnology Co., Ltd. The kit automatically completes the high-throughput library construction process through the PCR method, and uses the Hi-TOM online software to directly analyze the variation information of multiple samples and multiple sites. TaTT2 is amplified using specific primers on both sides of the target sequence (TT2-Primer-F and TT2-Primer-R in Table 1), and the amplified product is sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing after library construction. The wild-type nucleotide sequence of the target gene TaTT2 is shown in SEQ ID NO: 1-3, and its deduced amino acid sequence is shown in Figure 1 As shown, the nucleotide sequence of the target gene can also be obtained after sequencing the mutant, and its deduced amino acid sequence is as follows Figure 2 The mutation types of sgRNA target sites are shown in Figure 3The figure shows the insertion or deletion of bases. After comparison, the tt2 mutant lacks a base C after the +34 position of the CDS sequence of TaTT2-7A, causing the amino acid sequence of the CDS region to change after the 36th base and terminating the translation after the 165th base of the CDS region, that is, the amino acid length of the gene mutant is only 55, which is 114 amino acids shorter than the wild type; the tt2 mutant lacks a base C after the +34 position of the CDS sequence of TaTT2-7D, causing the amino acid sequence of the CDS region to change after the 36th base. The sequence changed and translation was terminated after the 165th base in the CDS region, that is, the amino acid length of the gene mutant was only 55, which was 114 amino acids shorter than the wild type; the tt2 mutant lacked two base Cs after the +34 position of the CDS sequence of TaTT2-4A, causing the amino acid sequence after the 33rd base in the CDS region to change and translation was terminated after the 114th base in the CDS region, that is, the amino acid length of the gene mutant was only 38, which was 84 amino acids shorter than the wild type.

[0078] The first round of PCR reaction system: 1 μL of DNA from wheat plant leaves of the tt2 mutant was used as a template, 10 μL of 2×Taq Master Mix in the kit, 0.5 μL of Primer-F and Primer-R (Table 1) (10 μM) each, and Nuclease-free water was added to make up the volume to 20 μL. The PCR reaction conditions were: denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 20 s, for a total of 33 cycles; and finally extension at 72°C for 5 min. After the PCR was completed, 5 μL of agarose gel electrophoresis was taken to detect the PCR product to ensure the presence of the target product and good specificity.

[0079] Then, the second round of PCR reaction was performed, with 12 μL of Hi-TOM Mix in the kit, 1 μL of the first round PCR product as template, and the volume was supplemented to 20 μL with Nuclease-free Water. PCR reaction program: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 25 s, a total of 33 cycles; and finally 72℃ extension for 5 min.

[0080] 4. Heat resistance treatment of tt2 mutant

[0081] The seeds of the tt2 mutant plant and the wild type were sterilized with sodium hypochlorite for 15 minutes and washed with sterile water for 5 to 6 times. After the seeds were sterilized, they were placed on moist filter paper for germination. After germination, they were planted in a 96-well culture box filled with Hoagland nutrient solution and cultured for one week at 20°C at 16 / 8 (light / dark). The temperature was adjusted to 42°C and the phenotype was observed for 7-10 days. The wild type plants turned yellow and wilted, while the tt2 mutant plants were still relatively green. Figure 4 The phenotypes of wild-type and tt2 mutant plants after heat treatment. Figure 5 This is the plant phenotype of the tt2 mutant under natural dry wind. After the dry hot wind, the wild-type plants turned yellow and withered, while the tt2 mutant became greener. Figure 6 This is the grain phenotype of the tt2 mutant under natural dry hot wind. After dry hot wind, the thousand-grain weight of the tt2 mutant was 37.89 g, which was significantly higher than the thousand-grain weight of the wild type of 35.10 g (P-value = 3.24E-04); the single-plant yield of the wild type and tt2 mutant was 26.08 g and 15.13 g, respectively, with a significant difference between the two (P-value = 7.99E-06); the total number of grains per plant of the wild type and tt2 mutant was 431.76 and 689.56, respectively, and the total number of grains per plant of the mutant was significantly higher than that of the wild type (P-value = 7.99E-06).

Claims

1. A method for improving heat tolerance of wheat by editing the wheat TaTT2 gene, characterized in that: Reducing or silencing the expression of the wheat TaTT2 gene in wheat.

2. The method according to claim 1, characterized in that The wheat TaTT2 gene is located on 7A, 7D and 4A of chromosome 4 in wheat, and is named TaTT2-7A, TaTT2-7D and TaTT2-4A, respectively. The nucleotide sequences of TaTT2-7A, TaTT2-7D and TaTT2-4A are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

3. The method according to claim 1, characterized in that The method of reducing or silencing the expression of wheat TaTT2 gene in wheat specifically comprises the following steps: 1) Design and synthesize sgRNA targeting TaTT2 gene; 2) Connecting the sgRNA obtained in step 1) to the pBUE411 vector to construct a pBUE411-TT2 binary vector with the function of knocking out the wheat TaTT2 gene; 3) The binary vector obtained in step 2) is transformed into plants by Agrobacterium-mediated transformation to reduce or silence the expression of the wheat TaTT2 gene, thereby obtaining wheat plants with high heat resistance.

4. The method according to claim 3, characterized in that The nucleotide sequence of the sgRNA of the TaTT2 gene described in step 1) is shown in SEQ ID NO:

4.

5. The method according to claim 3, characterized in that The pBUE411-TT2 binary vector having the function of knocking out the wheat TaTT2 gene described in step 3) comprises an expression cassette A and an expression cassette B; The expression cassette A specifically includes the following elements from upstream to downstream: the TaU3 promoter A from wheat, the sgRNA of the TaTT2 gene and the terminator A; The expression cassette B specifically includes the following elements from upstream to downstream: the promoter B, the corn Cas9 coding sequence, and the terminator B.

6. The method according to claim 5, characterized in that The corn Cas9 coding sequence is shown in SEQ ID NO: 5; the sequence of the promoter A is shown in SEQ ID NO: 6; the sequence of the promoter B is shown in SEQ ID NO: 7; the sequence of the terminator A is shown in SEQ ID NO: 8; and the sequence of the terminator B is shown in SEQ ID NO:

9.

7. The method according to claim 5, characterized in that The expression cassette A is located upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

8. The method according to claim 3, characterized in that The pBUE411-TT2 binary vector also contains a resistance marker gene, such as a bar gene; the nucleotide sequence of the pBUE411-TT2 binary vector is shown in SEQ ID NO.

10.

9. The method according to claim 3, characterized in that The sequence tables of the mutation detection primers pBUE411-F, pBUE411-R, TT2-Primer-F, and TT2-Primer-R at the target site of the sgRNA described in step 2) are shown as SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13, respectively.

Images