Dengue virus RNA dependent RNA polymerase activity reporter plasmid and application thereof

Abstract

The invention discloses an activity reporter plasmid of RNA dependent RNA polymerase of type 2 dengue virus, the nucleotide sequence of the activity reporter plasmid is as shown in SEQ ID NO: 1, the activity reporter plasmid can indicate the activity of RNA dependent RNA polymerase RdRp of type 2 dengue virus, and the RdRp activity reporter plasmid is applied to screening of anti-type 2 dengue virus drugs. Experimental results show that the inhibition effect of the to-be-screened medicine can be visually observed through fluorescence intensity, the method can achieve high-throughput screening of the anti-type-II dengue virus medicine, time and cost consumed for screening the anti-type-II dengue virus medicine are greatly saved, operation is easy and convenient, and the method is suitable for application and popularization.

Description

Technical Field

[0001] The present invention belongs to the technical field of drug screening, and in particular relates to a dengue virus type II RNA-dependent RNA polymerase (RdRp) activity reporter plasmid and application of the activity reporter plasmid in screening drugs against dengue virus type II. Background Art

[0002] Dengue fever is a disease caused by infection with dengue virus (DENV). The disease is widespread and has different common names in different countries. In ancient China, it was commonly known as "broken bone fever", in Singapore and Malaysia it is called dengue fever or dengue disease, and in Vietnam it is commonly known as hot hemorrhagic disease. Dengue is one of the most important mosquito-borne viruses and is listed as one of the top ten threats to global health in 2019. It is transmitted by Aedes aegypti and Aedes albopictus and includes four DENV serotypes (DENV-1, DENV-2, DENV-3, DENV-4). DENV infection is widely prevalent in tropical and subtropical regions such as the Americas, Africa, and Southeast Asia. Currently, many countries in the world are affected by the dengue fever epidemic. About half of the people live in areas suitable for the spread of dengue virus, which poses a serious economic and social burden to these countries and regions.

[0003] DENV belongs to the Flaviviridae family, Flavivirus genus, and is an enveloped virus with a single-stranded RNA genome. At present, due to the lack of vaccines and effective drugs for dengue infection, the screening and development of therapeutic drugs is particularly necessary. The current research direction of antiviral drugs is mainly aimed at key viral proteins, and the NS5 protein has the largest and most conserved genome among all Flavivirus proteins, with 70% sequence identity in four serotypes. This high degree of conservation indicates that targeted compounds can be screened for this protein. The NS5 protein has RNA-dependent RNA polymerase activity (RdRp), which is a core component of the replication and transcription mechanism of dengue virus and can catalyze the synthesis of viral RNA; inhibitors developed for RdRp are expected to become broad-spectrum anti-dengue virus drugs.

[0004] Firefly luciferase is a protein with a molecular weight of about 61kD. In the presence of ATP, magnesium ions and oxygen, it can catalyze the oxidation of luciferin to oxyluciferin. During the oxidation of luciferin, bioluminescence is emitted, which is widely used as a fluorescent marker in biomedical research. The bioluminescence system of luciferin and luciferase can detect gene expression extremely sensitively and efficiently. Summary of the invention

[0005] The present invention provides an activity reporter plasmid of dengue virus type 2 RNA-dependent RNA polymerase RdRp. By inserting a firefly luciferin reporter gene into the 5' non-coding region and the 3' non-coding region of dengue virus type 2, an activity reporter plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2) (DENV-2) of dengue virus type 2 RNA-dependent RNA polymerase is constructed. The nucleotide sequence of the plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2) is shown in SEQ ID NO: 1.

[0006] Another object of the present invention is to apply the above-mentioned dengue virus type 2 RNA-dependent RNA polymerase reporter plasmid to the screening of anti-dengue virus type 2 drugs, and the activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) and the expression plasmid pEGFPN3-NS5 are used for drug screening at the same time. The nucleotide sequence of the expression plasmid pEGFPN3-NS5 is shown in SEQ ID NO:2.

[0007] The purpose of the present invention is achieved through the following technical solutions: 1. Construction of the RNA-dependent RNA polymerase activity reporter plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2) of dengue virus type 2 The 5' non-coding DNA sequence (5' UTR), 3' non-coding DNA sequence (3' UTR) (GenBank: KM204118.1) and coding DNA sequence of firefly luciferin reporter gene of dengue virus type 2 were downloaded from NCBI (nih.gov), synthesized and ligated to pCMV-c-flag to obtain plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2); 2. Construction of the RNA-dependent RNA polymerase expression plasmid pEGFPN3-NS5 of dengue virus type 2 (1) Download the coding DNA sequence of dengue virus type 2 NS5 from NCBI, analyze the restriction sites and design specific primers using Primer Primer 5.0; (2) Extracting dengue virus type 2 RNA and reversely transcribing it to obtain cDNA, using the cDNA as a template and using primers NS5-F and NS5-R to amplify the NS5 gene fragment; (3) Use an agarose gel DNA recovery kit to recover the target fragment and use Hind III and Bm ⅠDouble enzyme digestion of target fragment, gel recovery and purification of fragment; (4) Using the purified NS5 product as a template, the NS5 gene was ligated to the pCE2 TA / Blunt-Zero vector (C601) using a blunt-end ligase (5 min TA / Blunt-Zero Cloning Kit) and named C601-NS5. (5) Transform C601-NS5, use the transformed bacterial solution as a template, C601-F and C601-R as primers, use Green Taq Mix to amplify the junction, and connect the NS5 gene to the pCE2 TA / Blunt-Zero vector; C601-NS5 and pEGFP-N3 were extracted using the Tiangen Plasmid Extraction Kit. Hind III and Bm Ⅰ Double-digest C601-NS5 plasmid and pEGFP-N3 plasmid, and recover and purify the double-digestion products by gel recovery; C601-NS5 was connected to pEGFP-N3 using T4 DNA ligase, and the ligation product was transformed into competent cells to pick a single clone. After the plasmid was extracted and sequenced to verify the successful construction of the plasmid, the endotoxin-free plasmid was extracted to obtain the plasmid pEGFPN3-NS5.

[0008] 3. Screening of anti-Dengue virus RdRp drugs using the RNA-dependent RNA polymerase activity reporter plasmid of dengue virus type II (1) Screening of anti-dengue virus type 2 drugs using the activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) and the expression plasmid pEGFPN3-NS5 ① One day before transfection, the density is 2×10 5 cells / mL HEK-293T cells (human embryonic kidney epithelial cells) were plated into a cell well plate, 1 mL of cell suspension was added to each well, and an experimental group with the drug to be screened and a control group without the drug to be screened were set up. After the cell adhesion and fusion reached 60-70%, the RdRp activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) and expression plasmid pEGFPN3-NS5 were co-transfected into the experimental group and control group cells; ② 6 hours after transfection, the experimental group replaced the culture medium containing the drug to be screened, and the control group replaced the normal culture medium. After continuing to culture for 48 hours, the firefly luciferase activity was detected using an enzyme reader. When the firefly luciferase activity of the drug-added group cells was lower than that of the control group cells, the drug to be screened had RdRp inhibitory activity and was an anti-dengue virus type II drug.

[0009] In the present invention, HEK-293T cells are cultured in a complete DMEM medium containing 10% serum, 1% penicillin-streptomycin, and 1% Hepes at a constant temperature of 37° C. and 5% CO 2 .

[0010] Advantages and technical effects of the present invention: The present invention constructs an RdRp activity reporter plasmid by inserting a firefly luciferase reporter gene into the 5' non-coding region and the 3' non-coding region of the type II dengue virus, and co-transfects the RdRp activity reporter plasmid prepared by the present invention with the expression plasmid pEGFPN3-NS5. When the firefly luciferase activity of the drug-added group cells is lower than that of the control group cells without drug addition, the drug to be screened has RdRp inhibitory activity. The method of the present invention can intuitively observe the inhibitory effect through the firefly luciferase activity, and can realize high-throughput screening of anti-type II dengue virus drugs, greatly saving the time and cost of screening anti-type II dengue virus drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The electrophoresis results of NS5 fragment PCR amplification are shown in Figure 1. Lane 1 is the DL5000 DNA Marker, and lane 2 is the electrophoresis results of NS5 protein PCR products. Figure 2 The lanes are the results of PCR of pEGFPN3-NS5 bacterial solution, lane 1 is DL5000 DNA Marker, and lanes 2-8 are the electrophoresis results of PCR products of bacterial solution; Figure 3 The results of detecting firefly luciferase activity after HEK-293T cells were co-transfected with plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2) + pEGFPN3-NS5 and HEK-293T cells were transfected with pCMV-5' UTR-LUC-3' UTR (DENV-2) alone; Figure 4 This is the result of using the activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) to screen drugs against dengue virus type 2. DETAILED DESCRIPTION

[0012] The present invention is further described below by means of the accompanying drawings and examples, but the protection scope of the present invention is not limited to the above contents. The methods in the present embodiments are operated according to conventional methods unless otherwise specified, and the reagents used are conventional reagents or reagents prepared according to conventional methods unless otherwise specified; Example 1: Construction of the expression plasmid pEGFPN3-NS5 of dengue virus type 2 RNA-dependent RNA polymerase RdRp The dengue virus type 2 coding DNA sequence (GenBank: KM204118.1) was downloaded from NCBI, and specific primers were designed using PrimerPrimer 5.0. The primer sequences are shown in the following table (the underlined sequences in the table represent enzyme sites);

[0013] 2. Use the kit OMEGA EZNA®Total RNA Kit I to extract the RNA of dengue virus type 2. The extraction steps are carried out according to the instructions of the kit; 3. Using RNA as a template, reverse transcribe the cDNA using TAKARA One Step PrimeScript™ RT-PCR Ki. Follow the instructions of the kit. 4. Using cDNA as template, primers NS5-F and NS5-R were used, and Novazon high-fidelity enzyme was used to amplify the NS5 DNA fragment with restriction sites. The amplification system was: 2 mL of NS5-F, 2 mL of NS5-R, 3 mL of cDNA, 25 mL of 2 × PhantaFlash Master Mix, and 18 mL of ddH2O. Amplification conditions were: 98°C for 30 s; 98°C for 10 s, 55°C for 5 s, and 72°C for 15 s, for 30 cycles; 72°C for 1 min. The amplification results were as follows: Figure 1 As shown, the target fragment was recovered using Tiangen Agarose Gel DNA Recovery Kit; 5. Using the purified NS5 product as a template, the NS5 gene was connected to the pCE2 TA / Blunt-Zero vector (C601) by blunt-end ligase (5min TA / Blunt-Zero CloningKit), named C601-NS5. The mixed solution system was: 5 × TA / Blunt-Zero Cloning Mix 1mL; template 1.5mL; ddH2O 2.5mL; react at 25℃ for 15 min on PCR; take 20μL of the product and add it to 100μL E. coli DH5α, after ice bath for 30 min, transfer to a 42℃ water bath for heat shock for 90s, then place on ice for 5min, and then make up to 1mL with liquid LB medium, and then place it at 37℃, 200rpm shaker for 1 minute. h, finally, the culture medium was taken out, centrifuged at 4000 rpm for 5 min, 900 mL of the culture medium was discarded, the cells were resuspended with the remaining culture medium, the cell suspension was spread on solid LB medium containing kanamycin resistance, and cultured at 37°C overnight; 6. Use the transformed bacterial solution as a template and C601-F: CAGGAAACAGCTATGACC C601-R: TGTAAAACGACGGCCAGTG as primer, use Green Taq Mix to amplify the junction, the amplification system is: Green Taq Mix 15mL; C601-F 2mL; C601-R 2mL; template 3mL; ddH2O 3mL; amplification conditions: 95℃ 30 min; 95℃ 30 s, 53℃ 30 s, 72℃ 3 min, 30 cycles; 72℃ 5 min; Tiangen plasmid mini-extraction was used to extract C601-NS5 plasmid and pEGFP-N3 plasmid; 7. Double restriction enzyme digestion of C601-NS5 plasmid and pEGFP-N3 plasmid, the restriction enzyme digestion systems are: Hind III 2mL; Bm Ⅰ2mL; K Buffer 4 mL; Plasmid C601-NS5 1.5 mL; ddH2O 30.5 mL; Hind III 2 mL; Bm I 2 mL; K Buffer 4 mL; plasmid pEGFP-N3 8 mL; ddH2O 24 mL; metal bath 37℃ enzyme digestion for 10 h; Tiangen agarose gel recovery kit was used to purify the double enzyme digestion product; 8. Use T4 DNA ligase to connect C601-NS5 and pEGFP-N3, react in a 16℃ metal bath for 5h, and then transform. Take 20μL of the product and add it to 100μL E. coli DH5α. After ice bathing for 30min, transfer it to a 42℃ water bath for heat shock for 90s, then place it on ice for 5min, and then make up to 1mL with liquid LB medium. Then place it on a shaker at 37℃ and 200 rpm for 1h. Finally, take out the culture medium, centrifuge it at 4000 rpm for 5min, discard 900mL of culture medium, resuspend the cells with the remaining culture medium, apply the cell suspension to solid LB medium containing kanamycin resistance, and culture it at 37℃ overnight. 9. Use the transformed bacterial solution as a template and pEGFPN3-F: GACGCAAATGGGCGGTAGG pEGFPN3-R: CGTAGGTCAGGGTGGTCACG as primer, use Green Taq Mix to amplify the junction, the amplification system is: Green Taq Mix 15 mL; pEGFPN3-F 2 mL; pEGFPN3-R 2 mL; template 3 mL; ddH2O 3 mL; amplification conditions: 95℃ 30 min; 95℃ 30 s, 54℃ 30 s, 72℃ 3 min, 30 cycles; 72℃ 5 min; amplification results are shown in Figure 2 As shown, the electrophoresis results preliminarily confirmed that the NS5 gene fragment was successfully connected to the pEGFPN3 vector, and the sequencing results confirmed that the plasmid pEGFPN3-NS5 was successfully constructed, and then the Tiangen Endotoxin-Free Plasmid Midi Extraction Kit was used to extract the endotoxin-free plasmid.

[0014] Example 2: Construction of dengue virus type 2 RNA-dependent RNA polymerase activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) The 5' non-coding DNA sequence, 3' non-coding DNA sequence (GenBank: KM204118.1) and firefly luciferase gene sequence of dengue virus type 2 were downloaded from NCBI and sent to Sangon Biotechnology for full gene synthesis. They were then connected to pCMV-c-flag to obtain the plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2).

[0015] Example 3: Screening of inhibitors using RNA-dependent RNA polymerase activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) 1. Set up the control group NC: no treatment was given to HEK-293T cells; Co-transfection group (pEGFPN3-NS5 + pCMV-5' UTR-LUC-3' UTR (DENV-2)): activity reporter plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2) and expression plasmid pEGFPN3-NS5 were co-transfected into HEK-293T cells at a mass ratio of 1:4; Single transfection group (pCMV-5' UTR-LUC-3' UTR (DENV-2)): single transfection of activity reporter plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2); 2. One day before transfection, the density was 2×10 5 cells / mL HEK-293T cells were plated in 12-well plates; 3. After the cells were cultured at 37°C and 5% CO2 until they adhered to the wall, transfection was performed according to different treatment groups. The transfection was performed using the LipofectamineTM3000 transfection kit. The transfection system was as follows: Reagent A: 50 mL serum-free DMEM + 1 mg plasmid DNA + 2 mL p3000; Reagent B: 50 mL serum-free DMEM + 1.5 mL lip3000; After reagents A and B are prepared, incubate at room temperature for 5 minutes, transfer solution A to solution B, mix well, and incubate at room temperature for 15 minutes; add the mixed solution to the cell culture medium, 100 mL per well; continue to culture for 6 hours after transfection, then replace the DMEM medium containing 10% serum, and then continue to culture for 48 hours before collecting the cells; 4. Use the dual luciferase detection kit of Biyuntian to detect the firefly luciferase activity according to its instructions. The specific steps are as follows: (1) Cell lysis: After thoroughly mixing the reporter gene cell lysis buffer, add 300 mL of reporter gene cell lysis buffer to each well to fully lyse the cells. Centrifuge at 12,000 g for 5 minutes and take the supernatant for determination. (2) Add the supernatant solution to be tested in step (1) to a 96-well ELISA plate, 50 mL per well, with two replicate wells for each sample, and then add 100 mL of firefly luciferase detection reagent, mix well with a gun, and measure the RLU (Relative Light Unit); Results Figure 3 The experimental results showed that the firefly luciferase activity of the co-transfection group was higher than that of the single transfection group, proving that the expression level of firefly luciferase expressed by the pCMV-5' UTR-LUC-3' UTR (DENV-2) activity reporter plasmid can indicate the activity of RdRp.

[0016] 5. Drug screening Set up the experimental group (co-transfection of the activity reporter plasmid pCMV-5' UTR-LUC-3' UTR (DENV-2) and the expression plasmid pEGFPN3-NS5 at a ratio of 1:4, and addition of the compound MK-0608 (7DMA, TargetMOI); Control group (co-transfection of activity reporter plasmid pCMV-5'UTR-LUC-3'UTR (DENV-2) and expression plasmid pEGFPN3-NS5 at a ratio of 1:4, without adding MK-0608) The results are as follows Figure 4As shown, the firefly luciferase activity of the control group was significantly higher than that of the experimental group. The experimental results showed that the amount of firefly luciferase expressed by the activity reporter plasmid pCMV-5'UTR-Luc-3'UTR can indicate the activity of RdRp and can screen out anti-type II dengue virus drugs.

[0017] The above experimental results indicate that the activity reporter plasmid of the dengue virus type 2 RNA-dependent RNA polymerase RdRp of the present invention has the potential to screen anti-dengue virus type 2 drugs.

Claims

1. A dengue virus type 2 RNA-dependent RNA polymerase activity reporter plasmid, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. Use of the dengue virus type 2 RNA-dependent RNA polymerase activity reporter plasmid according to claim 1 in screening anti-dengue virus type 2 drugs.

3. The use according to claim 2, characterized in that: When in use, the activity reporter plasmid and the expression plasmid pEGFPN3-NS5 are used together to screen anti-type II dengue virus drugs. The two plasmids are transfected into HEK-293T cells at the same time, and the drugs to be screened are added. At the same time, a control group without drug addition is set up. After transfection, the firefly luciferase activity is detected using an ELISA instrument. When the firefly luciferase activity of the drug-added group cells is lower than that of the control group cells, the drug to be screened has inhibitory activity and is an anti-type II dengue virus drug.

4. The use according to claim 3, characterized in that: The nucleotide sequence of the expression plasmid pEGFPN3-NS5 is shown in SEQ ID NO:2.

Images