Method and primer for directional high expression of 53BP1 mitochondria based on adenovirus vector

Abstract

The invention discloses an adenovirus vector-based 53BP1 mitochondrial directed high expression method and primers, and relates to the technical field of gene engineering. The method comprises the following steps: introducing a mitochondrial positioning signal peptide MTS to an N end of a 53BP1 gene sequence to obtain a 53BP1-MTS fusion gene; carrying out PCR (Polymerase Chain Reaction) amplification on the 53BP1-MTS fusion gene segment; cloning the amplified 53BP1-MTS fusion gene segment into an adenovirus vector to obtain a recombinant adenovirus vector; transfecting the recombinant adenovirus vector into a packaging cell line, culturing and amplifying the virus; and collecting virus suspension, concentrating and purifying, infecting target cells by using the purified adenovirus, and expressing the 53BP1 gene in the target cells. By adopting the method, the directional high-efficiency expression of the 53BP1 in mitochondria can be realized.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a method and primers for 53BP1 mitochondrial directional high expression based on an adenovirus vector. Background Art

[0002] 53BP1 (P53-binding protein 1) is a protein that plays a key role in DNA damage response (DDR), especially in double-strand break (DSB) repair. It is essential for maintaining genome stability by regulating the selection of DSB repair pathways. 53BP1 has the following functions:

[0003] DNA double-strand break repair: 53BP1 is responsible for sensing and responding to DNA double-strand breaks in cells, especially playing a key role in the non-homologous end joining (NHEJ) pathway. It promotes direct repair of DNA double-strand breaks by inhibiting excessive recombination of DNA ends and avoiding unstable DNA repair processes such as homologous recombination (HR).

[0004] DNA damage signaling: 53BP1 is a downstream protein of the ATM kinase pathway in DNA damage response. It can accumulate at damaged DNA sites and work in conjunction with other repair proteins to guide cells to repair damaged DNA through a series of signal cascade reactions.

[0005] Regulating the cell cycle: During the DNA damage repair process, 53BP1 can interact with the p53 protein, participate in the regulation of the cell cycle, promote DNA repair and prevent the replication of damaged DNA. It can prevent genomic instability by regulating cell cycle checkpoints and preventing damaged cells from entering mitosis.

[0006] Therefore, directing 53BP1 protein to the mitochondria of cells is helpful to repair mitochondrial DNA damage or study the role of mitochondrial DNA damage in mitochondrial function. In the related art, 53BP1 protein is expressed in cells by plasmid transfection method. However, the inventors found that: 53BP1 protein is mainly located in the cell nucleus and cannot be targeted to mitochondria; in addition, the plasmid transfection method also has problems such as low transfection efficiency, insufficient expression level or unstable expression, making it difficult to achieve efficient expression of 53BP1 protein. Summary of the invention

[0007] The present invention discloses a method and primers for mitochondrial-directed high expression of 53BP1 based on an adenovirus vector, so as to solve the technical problem that the 53BP1 protein cannot be targeted to the mitochondria when the 53BP1 protein is expressed in cells by a plasmid transfection method in the related art.

[0008] In order to solve the above problems, the present invention adopts the following technical solutions:

[0009] The first aspect of the present invention provides a primer for mitochondrial-directed high expression of 53BP1.

[0010] The primers for mitochondrial directional high expression of 53BP1 of the present invention include a primer pair used for PCR amplification of a 53BP1 gene fragment:

[0011] Upstream primer:

[0012] 5′-GCTAGCATGCTGAGCCTGCGCCAAAGCATCAGATTTTCTTCAAGCCCGCAACGCGGACCTGCTGCAGCAGCCGTTATCTGCTTATGGAGGCGGAGCTGGAG-3′;

[0013] Downstream primer: 5′-CTCGAGCTAGGAGATCAGCTTCAGGAGTTCTG-3′.

[0014] The second aspect of the present invention provides a method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector.

[0015] The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector of the present invention comprises the following steps:

[0016] Step 100: introducing the mitochondrial localization signal peptide MTS at the N-terminus of the 53BP1 gene sequence to obtain a 53BP1-MTS fusion gene;

[0017] Step 200: amplifying the 53BP1-MTS fusion gene fragment by PCR, and the primer pair used in the amplification process is the primer for mitochondrial-directed high expression of 53BP1 described in the present invention;

[0018] Step 300: cloning the amplified 53BP1-MTS fusion gene fragment into an adenovirus vector to obtain a recombinant adenovirus vector;

[0019] Step 400: transfecting the recombinant adenovirus vector into a packaging cell line, culturing and amplifying the virus;

[0020] Step 500: Collect the virus suspension and concentrate and purify it, use the purified adenovirus to infect target cells, and express the 53BP1 gene in the target cells.

[0021] According to an optional embodiment, the amino acid sequence of the mitochondrial localization signal peptide MTS is: MLSLRQSIRFFKPATRTLCSSRYLL;

[0022] The DNA sequence corresponding to the mitochondrial localization signal peptide MTS is: 5′-ATGCTGAGCCTGCGCCAAAGCATCAGATTTTCTTCAAGCCCGCAACGCGGACCTGCTGCAGCAGCCGTTATCTGCTT-3′.

[0023] According to an optional embodiment, in step 200, when the recombinant adenovirus vector is obtained, the amplified 53BP1-MTS fusion gene fragment is inserted into the multiple cloning site of the adenovirus vector.

[0024] According to an optional embodiment, the multiple cloning sites of the adenovirus vector are Nhel and Notl.

[0025] According to an optional embodiment, step 200 also includes a step of verifying the accuracy of the insertion site by sequencing.

[0026] According to an optional embodiment, PCR amplification is performed on both sides of the insertion site, and the presence and size of the insertion site are verified by electrophoresis analysis, and the primers used in the PCR amplification process are:

[0027] Tp53bp1-F: CGCAAATGGGCGGTAGGCGTG;

[0028] Tp53bp1-R: GTGAGAAACATAATCGTG.

[0029] According to an optional embodiment, the adenoviral vector is PDC316-mCMV-EGFP, and the adenoviral vector contains a CMV promoter, and the CMV promoter is used to drive the expression of the 53BP1 gene.

[0030] According to an optional embodiment, in step 300, the packaging cell line is a 293A cell, and the 293A cell can provide the helper plasmid required for adenovirus replication.

[0031] According to an optional embodiment, the helper plasmid provided by 293A cells is pBHGloxdelE13cre.

[0032] The technical solution adopted by the present invention can achieve the following beneficial effects:

[0033] First, the traditional 53BP1 expression system mainly focuses on its role in the cell nucleus. The present invention realizes the mitochondrial targeted expression of 53BP1 protein for the first time by introducing the mitochondrial localization signal peptide MTS at the N-terminus of the 53BP1 gene sequence, allowing researchers to explore the specific function of 53BP1 in mitochondria, expanding the potential role of 53BP1 in DNA damage repair and maintenance of cell homeostasis, and filling the gap in the functional research of 53BP1 in other subcellular organelles.

[0034] Secondly, the method of the present invention is also targeted and stable. Specifically, the present invention achieves specific localization of mitochondria by introducing the mitochondrial localization signal peptide MTS at the N-terminus of the 53BP1 gene sequence, and can accurately control the localization of the 53BP1 protein in specific subcellular structures. This targeting mechanism significantly improves the accuracy of functional research on the 53BP1 protein in cells, avoids the non-specific effects that may be caused by non-targeted proteins in cells, and thus improves the reliability and repeatability of the experimental results.

[0035] Thirdly, the method of the present invention can also achieve efficient gene transduction. Specifically, compared with traditional plasmid transfection methods, the present invention uses adenovirus vectors, which have higher gene transduction efficiency, especially in both dividing and non-dividing cells. Efficient gene expression can be achieved; in addition, the adenovirus system has a large gene carrying capacity, can carry large gene insertion fragments, and stably express them without integrating into the host genome; furthermore, compared with other viral vectors such as lentivirus, the vector of the present invention can achieve efficient exogenous gene expression in a short time, reducing the problem of unstable expression.

[0036] Fourthly, the adenovirus vector system used in the present invention has good scalability and is not only suitable for the expression of 53BP1 protein, but also can be applied to other mitochondrial-related protein research. Through simple modifications, other mitochondrial functional proteins, regulatory factors, markers, etc. can also be efficiently expressed in mitochondria through this system, and a variety of functional research models can be constructed, providing a wide range of application prospects for mitochondrial biology, metabolic regulation and pathological research.

[0037] Fifthly, compared with previous plasmid transfection technology or lentiviral vectors, the method of the present invention has the advantages of simple operation and stable experimental process; the packaging, amplification and purification of adenovirus are relatively mature, and the experimental operation has good repeatability, which is suitable for large-scale experiments or long-term gene function research, especially in cell types that are difficult to transfect.

[0038] Sixthly, the method of the present invention is not limited to basic research, but also provides a new tool for the study of mitochondrial-related diseases; through the efficient mitochondrial localization expression of 53BP1, its role in diseases related to mitochondrial dysfunction, such as neurodegenerative diseases, metabolic disorders, tumors, etc., can be further explored, providing new ideas for the study of the pathogenesis of these diseases and the discovery of potential therapeutic targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0040] Figure 1 This is the plasmid map of PDC316-mCMV-EGFP in the present application example;

[0041] Figure 2 This is the electrophoresis diagram of PCR amplification of TP53BP1 gene in the embodiment of the present application;

[0042] Figure 3 This is a schematic diagram of the sequencing results of 53BP1 sequence in Example 5 of the present application;

[0043] Figure 4 This is the result of double enzyme digestion identification of the 53BP1 recombinant plasmid in Example 5 of the present application;

[0044] Figure 5 It is a Western blot test result diagram of the comparative example of the present application;

[0045] Figure 6 This is a diagram of the Western blot test results of Example 1 of the present application;

[0046] Figure 7 This is a diagram of the mitochondrial function test results of Example 2 of the present application. DETAILED DESCRIPTION

[0047] To make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0048] The terms "first", "second", etc. in the specification and claims of the present application are used to distinguish similar objects, and are not used to describe a specific order or sequence. It should be understood that the data used in this way can be interchangeable under appropriate circumstances, so that the embodiments of the present application can be implemented in an order other than those illustrated or described here, and the objects distinguished by "first", "second", etc. are generally of one type, and the number of objects is not limited. For example, the first object can be one or more. In addition, "and / or" in the specification and claims represents at least one of the connected objects, and the character " / " generally indicates that the objects associated with each other are in an "or" relationship.

[0049] In the related art, the expression of 53BP1 protein in cells is achieved by plasmid transfection method. In this expression mode, 53BP1 protein is mainly located in the cell nucleus and cannot be targeted to mitochondria. In addition, the plasmid transfection method also has problems such as low transfection efficiency, insufficient expression level or unstable expression, making it difficult to achieve efficient expression of 53BP1 protein. Specifically, the plasmid transfection method is to clone the TP53BP1 gene downstream of the promoter of the eukaryotic expression vector. Since the length of the TP53BP1 gene is 5934bp, the recombinant plasmid formed after cloning into the eukaryotic expression vector is a large plasmid with more than 10,000 copies. Large plasmids are difficult to be brought into cells by transfection reagents. After a small amount of plasmids enter the cells, TP53BP1 protein will be expressed in the cells. These plasmids entering the cells will be lost as the cells proliferate; and the expressed TP53BP1, without the guidance of the signal peptide, is impossible to reach the mitochondria.

[0050] It can be seen that the existing methods mostly focus on studying its nuclear function, while the method of the present invention successfully achieves the directional expression of 53BP1 protein in mitochondria by introducing the mitochondrial targeting signal (MTS), expanding the research on its mitochondrial related functions. This provides a new research tool for exploring the potential function of 53BP1 in mitochondria.

[0051] The method of the present invention achieves the targeted expression of 53BP1 by designing a specific mitochondrial localization signal. The method of the present invention is not limited to the 53BP1 protein, but can also be extended to the targeted expression research of other proteins, providing a universal gene targeting tool suitable for the needs of specifically expressing proteins in other subcellular regions (such as mitochondria, endoplasmic reticulum, etc.).

[0052] In the related art, the expression of 53BP1 protein in cells is achieved by plasmid transfection method, but there are still problems such as low transfection efficiency, insufficient expression level or unstable expression, which makes it difficult to achieve efficient expression of 53BP1 protein. The method of the present invention uses adenovirus vector to provide an efficient 53BP1 expression pathway, which is suitable for a variety of mammalian cell lines and ensures high and stable expression of the target gene.

[0053] Specifically, adenovirus vectors have high transduction capacity, and the method of the present invention overcomes the problems of low transfection efficiency and unstable expression in conventional transfection methods by using an adenovirus vector system. Adenovirus has the characteristics of not integrating into the host genome and being able to achieve high expression in both dividing and non-dividing cells, so it is possible to achieve high efficiency of 53BP1 gene expression in different cell types and maintain high experimental repeatability in research.

[0054] The following is combined with Figures 1 to 7 The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector provided in the present application is described in detail through specific examples and application scenarios.

[0055] The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector of the present invention comprises the following steps:

[0056] Step 100: Introduce the mitochondrial localization signal peptide MTS at the N-terminus of the 53BP1 gene sequence to obtain a 53BP1-MTS fusion gene.

[0057] For example, the 53BP1 gene sequence can be designed using molecular biology software, and the mitochondrial localization signal peptide MTS can be introduced into the N-terminus of the 53BP1 gene sequence to obtain a 53BP1-MTS fusion gene. The mitochondrial localization signal peptide MTS is used to guide the 53BP1 protein to target mitochondria.

[0058] Exemplarily, the amino acid sequence of the mitochondrial localization signal peptide MTS is:

[0059] MLSLRQSIRFFKPATRTLCSSRYLL;

[0060] The DNA sequence corresponding to the mitochondrial localization signal peptide MTS is: 5′-ATGCTGAGCCTGCGCCAAAGCATCAGATTTTCTTCAAGCCCGCAACGCGGACCTGCTGCAGCAGCCGTTATCTGCTT-3′.

[0061] Step 200: Amplify the 53BP1-MTS fusion gene fragment using PCR. The primer pairs used in the amplification process are as follows:

[0062] Upstream primer:

[0063] 5′-GCTAGCATGCTGAGCCTGCGCCAAAGCATCAGATTTTCTTCAAGCCCGCAACGCGGACCTGCTGCAGCAGCCGTTATCTGCTTATGGAGGCGGAGCTGGAG-3′;

[0064] Downstream primer: 5′-CTCGAGCTAGGAGATCAGCTTCAGGAGTTCTG-3′.

[0065] The above primer pair takes into account the fusion site of MTS and 53BP1, which can ensure that the reading frame is consistent and the amplified product has no mutation.

[0066] For example, the process parameters for amplifying the 53BP1-MTS fusion gene using PCR can refer to conventional PCR amplification without special requirements.

[0067] Figure 2 The electrophoresis diagram of the PCR-amplified 53BP1-MTS fusion gene fragment is shown. Figure 2 It can be seen that specific amplified fragments can be obtained after PCR amplification.

[0068] Exemplarily, the amplified 53BP1-MTS fragment is detected by gel electrophoresis and purified and recovered.

[0069] Step 300: Clone the amplified 53BP1-MTS fusion gene fragment into an adenovirus vector to obtain a recombinant adenovirus vector.

[0070] Exemplarily, the adenoviral vector is PDC316-mCMV-EGFP. The adenoviral vector contains a CMV promoter, which is used to drive the efficient expression of the 53BP1 gene.

[0071] In the method of this embodiment, the adenovirus vector selected is PDC316-mCMV-EGFP, wherein GFP is a green fluorescent protein, which can be used as a reporter gene to help monitor and verify the expression and mitochondrial localization of the 53BP1 gene; on the other hand, PDC316-mCMV-EGFP provides multiple restriction sites, which increases the flexibility and accuracy of the cloning process.

[0072] As is known, the gene sequence of adenovirus vector PDC316-mCMV-EGFP and CMV promoter has been disclosed in related technologies and will not be described in detail in this application. Figure 1 shown.

[0073] Exemplarily, when obtaining a recombinant adenoviral vector, the amplified 53BP1-MTS fusion gene fragment is inserted into the multiple cloning site MCS of the adenoviral vector.

[0074] Exemplarily, the multiple cloning sites of adenovirus vectors are Nhel and Notl. The recognition site of Nhel is C^CATG^G, that is, DNA is cut at the CATG sequence to produce a 5' protruding sticky end. The recognition site of Notl is GC^GGCCGC, that is, DNA is cut at the GGCCGC sequence to produce a blunt end.

[0075] Exemplarily, after the amplified 53BP1-MTS fusion gene fragment is inserted into the multiple cloning site MCS of the adenovirus vector, a step of sequencing to verify the accuracy of the insertion site is also included. Figure 3 The schematic diagram of the results of sequencing verification of 53BP1 sequence is shown. Figure 4 The results of double enzyme digestion of 53BP1 recombinant plasmid are shown. Figure 3 and Figure 4 It can be seen that the 53BP1 gene was correctly inserted into the plasmid.

[0076] The method of this embodiment verifies the accuracy of the insertion site by sequencing, which can ensure that the 53BP1-MTS fusion gene fragment is accurately inserted into the expected position of the adenovirus vector to avoid dislocation or deletion, and can also avoid unexpected mutations or errors to ensure the safety and functionality of the vector.

[0077] Exemplarily, PCR amplification is performed on both sides of the insertion site, and the presence and size of the insertion site are verified by electrophoresis analysis, and the primers used in the PCR amplification process are:

[0078] Tp53bp1-F: CGCAAATGGGCGGTAGGCGTG;

[0079] Tp53bp1-R: GTGAGAAACATAATCGTG.

[0080] Specifically, amplification is performed according to the PCR program, and after adding the indicator to the amplified product, electrophoresis analysis is performed. The electrophoresis conditions are: 120v, 20min. By comparing the bands on the electrophoresis spectrum with the expected DNA fragment size, the existence and size of the insertion site are verified. If the electrophoresis spectrum of the PCR product shows a band of the expected size, it indicates that the insertion site exists and the size is in line with expectations.

[0081] The method of this embodiment verifies the existence and size of the insertion site through PCR amplification, and can accurately amplify the target DNA sequence, so that it has high specificity when verifying a specific insertion site; in addition, it also has the advantages of low cost, fast speed and high sensitivity.

[0082] Without being limited thereto, other methods in the prior art may also be used to verify the accuracy of the insertion site.

[0083] Step 400: Transfect the recombinant adenovirus vector into a packaging cell line, and culture and amplify the virus.

[0084] Exemplarily, the recombinant adenovirus vector is transfected into 293A cells. 293A cells are a subclone of the human embryonic kidney cell HEK293 cell line, derived from human kidney fibroblasts. 293A cells are a packaging cell line that can provide the auxiliary plasmid required for adenovirus replication. Exemplarily, the auxiliary plasmid provided by 293A cells is pBHGloxdelE13cre. After transfection, the cells are cultured and the virus is amplified, and after the virus is fully replicated in the cells, the virus particles are released by lysing the cells.

[0085] The method of this embodiment uses 293A cells as the packaging cell line, and cultures and amplifies the virus in the packaging cell line, thereby avoiding the problems of low recombination efficiency and unstable recombinant products that may result from recombination in bacteria; in addition, 293A cells can provide the auxiliary plasmid pBHGloxdelE13cre required for adenovirus replication, and a higher virus yield can be obtained through the action of the auxiliary plasmid pBHGloxdelE13cre.

[0086] Step 500: Collect the virus suspension and concentrate and purify it, use the purified adenovirus to infect target cells, and express the 53BP1 gene in the target cells.

[0087] Exemplarily, the virus suspension is collected, and the virus particles are purified by CsCl gradient centrifugation or ion exchange chromatography to remove cell debris and impurities. The purified virus can be titered by immunofluorescence, qPCR or virus plaque assay to ensure that the virus has sufficient infectivity.

[0088] For example, the purified adenovirus is used to infect target cells, such as HeLa or other mammalian cell lines, and the expression of 53BP1 is detected after an appropriate period of time. Western blot and immunofluorescence methods are used to verify whether the 53BP1 protein is successfully expressed and whether it is directed to the mitochondria.

[0089] For example, the localization of 53BP1 in mitochondria is detected by immunofluorescence co-localization analysis. A mitochondrial marker such as COX IV antibody is used for co-staining with 53BP1 antibody to observe the co-localization of the two in cells. In addition, subcellular component separation technology can be used to further verify whether 53BP1 is successfully targeted to mitochondria.

[0090] The following is combined with Figures 1 to 7 The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector provided in the present application is described in detail through specific examples and application scenarios.

[0091] Comparative Example

[0092] This comparative example is a 53BP1 expression experiment based on a plasmid transfection system.

[0093] Experimental purpose: To achieve the expression of 53BP1 in HeLa cells by traditional plasmid transfection method and detect its protein expression in cells.

[0094] Experimental Materials:

[0095] Plasmid vector: pCMV-53BP1 plasmid;

[0096] Cell line: BEAS2B cells;

[0097] Culture medium: DMEM, 10% FBS, penicillin / streptomycin;

[0098] Transfection reagent: Lipofectamine 3000;

[0099] Western blot reagents and antibodies: 53BP1 antibody, VDAC1 antibody;

[0100] Instrument: Fluorescence microscope.

[0101] Experimental steps:

[0102] Cell culture: BEAS2B cells were seeded in 6-well plates and transfected when the cell density reached 70%-80%.

[0103] Plasmid transfection: pCMV-53BP1 plasmid was transfected into HeLa cells using Lipofectamine 3000 according to the instruction manual at a ratio of 5 μg DNA / well.

[0104] Culture and detection: 24 to 48 hours after transfection, cells were collected and protein expression was detected.

[0105] Protein expression detection: Western blot was performed using 53BP1 antibody to detect protein expression, and GAPDH was used as an internal reference.

[0106] result:

[0107] Protein expression level: Western blot results are as follows Figure 5 As shown, from Figure 5 It can be seen that 53BP1 has a moderate expression level in the transfected cells, but the overall expression level is not high.

[0108] Summary: Through the plasmid transfection method, 53BP1 protein was expressed in cells, but the expression efficiency was limited.

[0109] Example 1

[0110] This example is a 53BP1 mitochondrial targeting experiment based on adenovirus vector.

[0111] Experimental purpose: To achieve efficient expression of 53BP1 in HeLa cells using adenovirus vectors, and to achieve targeted localization of 53BP1 in mitochondria using mitochondrial localization signal peptides.

[0112] Experimental Materials:

[0113] Adenovirus vector: PDC316-mCMV-EGFP plasmid;

[0114] Cell lines: 293A cells (for virus packaging), BEAS2B cells (for expression);

[0115] Culture medium: DMEM, 10% FBS, penicillin / streptomycin;

[0116] Adenovirus packaging kit;

[0117] Western blot reagents and antibodies: 53BP1 antibody, mitochondrial marker antibody, GAPDH antibody;

[0118] Mitochondrial dye: MitoTracker;

[0119] Instrument: Fluorescence microscope.

[0120] Experimental steps:

[0121] Adenovirus packaging: PDC316-mCMV-EGFP plasmid was transfected into 293A cells and recombinant adenovirus was produced using an adenovirus packaging kit. Viral particles were collected 48 hours later and purified by CsCl gradient centrifugation.

[0122] Cell infection: HeLa cells were infected with purified adenovirus particles with a virus titer of 1×10^9 PFU / ml. The infection lasted for 24 to 48 hours.

[0123] Protein expression detection: The expression levels of mitochondrial and total protein 53BP1 were analyzed by Western blot.

[0124] result:

[0125] Protein expression level: Western blot results are as follows Figure 6 As shown, from Figure 6It can be seen that the expression level of 53BP1 was significantly increased and the expression was stable.

[0126] Summary: Adenoviral vector significantly improved the expression efficiency of 53BP1.

[0127] Embodiment 2:

[0128] This example is a functional study experiment of 53BP1 in an adenovirus system.

[0129] Experimental purpose: To achieve targeted expression of 53BP1 in mitochondria using adenoviral vectors and explore its effect on cellular stress response.

[0130] Experimental Materials:

[0131] Adenovirus vector: PDC316-mCMV-EGFP plasmid;

[0132] Cell line: BEAS2B cells;

[0133] Mitochondrial stress agent: Antimycin A;

[0134] Western blot reagents and antibodies: 53BP1 antibody, mitochondrial stress-related protein antibody, GAPDH antibody;

[0135] Mitochondrial function detection reagents: ATP assay kit, reactive oxygen species (ROS) detection kit;

[0136] Instrument: Fluorescence microscope.

[0137] Experimental steps:

[0138] Adenovirus infection: BEAS2B cells were infected with adenovirus and 24 hours after infection, cells were treated with antimycin A to induce mitochondrial stress response.

[0139] Mitochondrial function assay: ATP assay kit was used to detect mitochondrial function.

[0140] result:

[0141] Mitochondrial Function: Figure 7 A line graph of cellular oxygen consumption rate is shown, wherein the blue is a schematic diagram of the control group, and the green and purple are schematic diagrams of different 53BP1 targeted transfection concentrations. Figure 7 It can be used to evaluate the mitochondrial function and energy metabolism status of cells. Figure 7 It can be seen that after 53BP1 is targeted to mitochondria, it can significantly enhance the cell response to mitochondrial stress and increase ATP production; and the higher the concentration of 53BP1 targeted transfection, the more significant the effect of increasing ATP production.

[0142] summary:

[0143] Using an adenoviral system, 53BP1 was successfully targeted to mitochondria in BEAS2B cells and affected the mitochondrial stress response, demonstrating its potential function in mitochondria.

[0144] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0145] In addition, it should be noted that the scope of the methods and devices in the embodiments of the present application is not limited to performing functions in the order shown or discussed, and may also include performing functions in a substantially simultaneous manner or in a reverse order according to the functions involved. For example, the described methods may be performed in an order different from that described, and various steps may be added, omitted, or combined. In addition, features described with reference to certain examples may be combined in other examples.

[0146] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A primer for mitochondrial directional high expression of 53BP1, characterized in that: The primer pairs used to amplify the 53BP1 gene fragment by PCR are as follows: Upstream primer: 5′-GCTAGCATGCTGAGCCTGCGCCAAAGCATCAGATTTTCTTCAAGCCCGCAACGCGGACCTGCTGCAGCAGCCGTTATCTGCTTATGGAGGCGGAGCTGGAG-3′; Downstream primer: 5′-CTCGAGCTAGGAGATCAGCTTCAGGAGTTCTG-3′.

2. A method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector, characterized in that: The steps include: Step 100: introducing the mitochondrial localization signal peptide MTS at the N-terminus of the 53BP1 gene sequence to obtain a 53BP1-MTS fusion gene; Step 200: amplifying the 53BP1-MTS fusion gene fragment by PCR, and the primer pair used in the amplification process is the primer for mitochondrial-directed high expression of 53BP1 as described in claim 1; Step 300: cloning the amplified 53BP1-MTS fusion gene fragment into an adenovirus vector to obtain a recombinant adenovirus vector; Step 400: transfecting the recombinant adenovirus vector into a packaging cell line, culturing and amplifying the virus; Step 500: Collect the virus suspension and concentrate and purify it, use the purified adenovirus to infect target cells, and express the 53BP1 gene in the target cells.

3. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 2, characterized in that: The amino acid sequence of the mitochondrial localization signal peptide MTS is: MLSLRQSIRFFKPATRTLCSSRYLL; The DNA sequence corresponding to the mitochondrial localization signal peptide MTS is: 5′-ATGCTGAGCCTGCGCCAAAGCATCAGATTTTCTTCAAGCCCGCAACGCGGACCTGCTGCAGCAGCCGTTATCTGCTT-3′.

4. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 2 or 3, characterized in that: In step 200, when the recombinant adenovirus vector is obtained, the amplified 53BP1-MTS fusion gene fragment is inserted into the multiple cloning site of the adenovirus vector.

5. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 4, characterized in that: The multiple cloning sites of adenovirus vectors are Nhe1 and Not1.

6. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 4, characterized in that: Step 200 also includes a step of verifying the accuracy of the insertion site by sequencing.

7. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 6, characterized in that: PCR amplification was performed on both sides of the insertion site, and the presence and size of the insertion site were verified by electrophoresis analysis. The primers used in the PCR amplification process were: Tp53bp 1-F: CGCAAATGGGCGGTAGGCGTG; Tp53bp 1-R:GTGAGAAACATAATCGTG.

8. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 4, characterized in that: The adenoviral vector is PDC316-mCMV-EGFP, and the adenoviral vector contains a CMV promoter, and the CMV promoter is used to drive the expression of the 53BP1 gene.

9. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 2 or 3, characterized in that: In step 300, the packaging cell line is a 293A cell, and the 293A cell can provide the helper plasmid required for adenovirus replication.

10. The method for mitochondrial-directed high expression of 53BP1 based on adenovirus vector according to claim 9, characterized in that: The helper plasmid provided by 293A cells is pBHGloxdelE13cre.

Images