Method for obtaining spodoptera frugiperda DDC gene function-deleted individuals by using multiple sgRNAs

Abstract

The invention belongs to the technical field of insect gene editing, and particularly relates to a method for obtaining spodoptera frugiperda DDC gene function-deleted individuals by using multiple sgRNAs. In view of no research on successful knockout of the DDC gene in the Spodoptera frugiperda at present, the Lepidoptera insect Spodoptera frugiperda is used as a research object, sgRNA is designed on a fifth exon of dopa decarboxylase (DDC) through a CRISPR / Cas9 technology, the DDC gene is successfully knocked out to obtain a larva mutant, and the larva mutant is used as a larva mutant. And the feasibility of knocking out the DDC gene in the spodoptera frugiperda by using multiple sgRNAs is fully verified. The method for constructing the Spodoptera frugiperda DDC mutant is beneficial to destroying the defense mechanism of insects for resisting natural enemy invasion, provides theoretical and application basis for green prevention and control of Spodoptera frugiperda, and has important theoretical research value and practical application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of insect gene editing, and specifically relates to a method for obtaining individuals with DDC gene function deficiency in fall armyworm by using multiple sgRNAs. Background Art

[0002] Insects are the most species-rich eukaryotic group in nature, with more than 1 million species of insects discovered. Insects have rich and varied morphologies and living habits, and play a vital role in the food chain. In nature, insects are constantly exposed to potential pathogens and parasites, which easily trigger immune responses involving physiological, developmental and behavioral changes. In order to effectively resist infection by bacteria, fungi, parasites, viruses, etc., insects will quickly and effectively activate their innate immune system, which mainly relies on humoral immunity and cellular immunity. Among them, humoral immunity includes the recognition of different pathogens in the insect hemocoel, the activation of serine protease cascade reactions in the hemolymph, the induction of fat bodies to produce and secrete hemolymph effector molecules (such as antimicrobial peptides, etc.), the activation of melanization reactions and their intermediates with antimicrobial activity (such as phenoloxidase). The humoral immunity of insects relies on increasing the concentration of immune substances in the hemolymph to exert immune ability. The main humoral immune factors are lysozyme, phenoloxidase and antimicrobial peptides. The strength of the insect immune response is reflected in the activity of lysozyme and phenoloxidase, the production and expression of antimicrobial peptides, etc. in humoral immunity. Cellular immunity mainly relies on the phagocytosis, nodulation and encapsulation of pathogenic microorganisms and foreign invading substances by blood cells in the hemolymph. Among them, phagocytosis is a mechanism for clearing invading pathogens and cell apoptosis remnants. It includes the recognition, phagocytosis and intracellular destruction of pathogens. The whole process is completed by a single blood cell. Nodules involve the aggregation of multicellular blood cells to trap large numbers of bacteria. Encapsulation refers to the binding of blood cells to larger targets, such as parasites, protozoa and nematodes.

[0003] Both humoral immunity and cellular immunity involve the synthesis of melanin. Melanin is synthesized by a tyrosine-mediated metabolic pathway. Tyrosine is usually used as the raw material for synthesizing melanin. The first step is to use the initial rate-limiting enzyme tyrosine hydroxylase (TH) to catalyze tyrosine to produce L-3,4-dihydroxyphenylalanine, i.e., DOPA; then DOPA undergoes a decarboxylation reaction under the action of DOPA decarboxylase (Dopadecaboxylase, DDC) to produce dopamine. DOPA and dopamine are key melanin precursors in insects and can be oxidized by phenol oxidase to produce DOPA melanin and dopamine melanin.

[0004] DOPA decarboxylase is a key enzyme in the synthesis of melanin in insect cuticles. The phagocytosis, melanization and ossification processes of insects may all depend on the activity of DDC. The melanin in insects is usually deposited in the cuticle in the form of randomly dispersed or clear particles. The molting and eclosion periods of insect larvae are the two peak periods of DOPA decarboxylase activity. DOPA decarboxylase plays an important role in the molting process of insects. Insect epidermal cells absorb DOPA from the hemolymph, which is then converted into dopamine by DOPA decarboxylase. The dopamine converted in the epidermal cells and the dopamine absorbed from the hemolymph are transported to the premelanin granules in the cuticle and then converted into melanin under the action of phenoloxidase (PO).

[0005] In insects, different hormones enhance or inhibit immune responses and integrate individual (usually collective) physiological and behavioral responses, depending on the physiological environment. Insect development is mainly regulated by juvenile hormone (JH) and molting hormone (MH). Among them, 20E and JH can regulate the expression of DDC in the insect cuticle, and the synthesis of dopamine depends on the presence of DDC. DDC, also known as aromatic L-amino acid decarboxylase, was first discovered in mammalian kidney tissue and can promote the synthesis of adrenaline. Later, it was found that DDC is widely present in organisms and plays a key role in various mechanisms. In plants, DDC synthesizes aromatic alkaloids, which are precursors of drug-active molecules. In mammals, this enzyme is present in neural and non-neural tissues and is an important enzyme in the melanin synthesis pathway, which plays an important role in resisting ultraviolet rays. In insects, DDC plays a very critical functional role in the growth and development of the insect body. It is involved in the ossification, phagocytosis and melanization of innate immunity during the formation of the insect cuticle, and is related to the insect molting process.

[0006] At present, there are two hot spots in the research on DDC: (1) DDC has a certain correlation with the occurrence of nervous system diseases. For example, DDC is related to the occurrence of diseases such as Parkinson's syndrome and borderline personality disorder. (2) DDC participates in various biological regulatory mechanisms of insects. DDC is a key enzyme in the formation of insect cuticles, promoting the production of melanin, thereby darkening the cuticle body color, which is beneficial for resisting natural enemies and other invasions. Studies on the formation mechanism of black and white stripes on the cuticle of oriental armyworms have shown that DDC contributes to the formation of black stripes (Ninomiya, Y.; Tanaka, K.; Hayakawa, Y., Mechanisms of black and white stripe pattern formation in the cuticles of insect larvae. J Insect Physiol 2006, 52 (6), 638-45). Research by Noguchi et al. showed that the activity of DDC is highest during insect molting (Noguchi, H.; Tsuzuki, S.; Tanaka, K.; Matsumoto, H.; Hiruma, K.; Hayakawa, Y., Isolation and characterization of a dopa decarboxylase cDNA and the induction of its expression by an insect cytokine, growth-blocking peptide in Pseudaletiaseparata. Insect Biochem Mol Biol 2003, 33(2), 209-17.). In addition, after feeding silkworms with molting hormone, the expression level of DDC increased significantly, indicating that the expression of dopa decarboxylase gene is regulated by molting hormone (Wang, MX; Cai, ZZ; Lu, Y.; Xin, HH; Chen, RT; Liang, S.; Singh, CO; Kim, JN; Niu, YS; Miao, YG, Expression and functions of dopa decarboxylase in the silkworm, Bombyx mori was regulated by molting hormone. Mol Biol Rep 2013, 40(6), 4115-22.).Studies have shown that the magnitude of DDC activity may affect the strength of insect innate immunity (Sideri, M.; Tsakas, S.; Markoutsa, E.; Lampropoulou, M.; Marmaras, VJ, Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes. Immunology 2008, 123 (4), 528-37.). Melanization is a key link in some lepidopteran and dipteran insects to resist a large number of pathogens and participate in the formation of nodules and cysts. Nappi et al.'s study on Drosophila showed that the lack of DDC caused the inhibition of dopamine synthesis, thereby reducing the body's melanin immunity (Nappi, AJ; Vass, E., Melanogenesis and the generation of cytotoxic molecules during insect cellular immune reactions. Pigment Cell Res 1993, 6 (3), 117-26.). Studies have found that DDC gene polymorphism may affect the melanization encapsulation reaction of parasitic wasp eggs by changing the level of dopamine (Hodges, TK; Laskowski, KL; Squadrito, GL; De Luca, M.; Leips, J., Defense traits of larval Drosophila melanogaster exhibit geneticallybased trade-offs against different species of parasitoids. Evolution 2013, 67(3), 749-60.).Paskewitz et al. silenced the DDC gene of Anopheles gambiae for 24 hours and found that the melanization reaction in its dextran gel beads was significantly weakened (Paskewitz, SM; Andreev, O., Silencing the genes for dopa decarboxylase or dopachrome conversion enzyme reduces melanization of foreign targets in Anopheles gambiae. Comp Biochem Physiol B Biochem Mol Biol 2008, 150(4), 403-8.). Zhang Yuanyuan et al. expressed, purified and established a high-throughput inhibitor screening model for human DDC (Zhang Yuanyuan; Qiu Junqiang; Zhou Yueyang; Wu Fang; Zhang Qinghua, Expression, purification and establishment of a high-throughput inhibitor screening model for human dopa decarboxylase. Journal of Biology 2014, 31(06), 6-10.); Cui Ting et al. studied the effect of abnormal expression of DDC on depressive behavior in rats9 Cui Ting; Xie Wei; Fu Xiaoyan; Li Haiyan; Jiang Xinhui; Qiu Hongmei, Experimental study on abnormal expression of TPH2, DDC and MAO-A in CUS-induced depressive behavior in rats. Chinese Pharmacological Bulletin 2016, 32(12), 1677-1683.; Xu Qiuwen studied Effects of cypermethozide and methoprene on the expression of DDC gene in Asian corn borer larvae (Xu Qiuwen. Effects of sublethal concentrations of cypermethozide and methoprene on the expression of dopa decarboxylase gene in Asian corn borer larvae. Master, Yangzhou University, 2017.); Wang Huijuan et al. conducted a low-temperature induced expression analysis on the DDC gene sequence of Harmonia axyridis (Wang Huijuan; Shi Zuokun; Xu Fengjiao; Shen Qida; Xu Yanxia; Wang Shigui; Tang Bin, Harmonia axyridis dopa decarboxylase gene sequence and low-temperature induced expression analysis. Journal of Environmental Entomology, 2016, 38(02), 271-279. However, there has been no report on the successful knockout of the DDC gene in Spodoptera frugiperda. Summary of the invention

[0007] In order to overcome the shortcomings of the above-mentioned prior art, the present invention takes the lepidopteran insect Spodoptera frugiperda as the research object, and knocks out the dopa decarboxylase (DDC) gene through CRISPR / Cas9 technology to obtain larval mutants, and explores the feasibility of knocking out DDC with multiple sgRNAs.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] The present invention provides a method for knocking out DDC by multiple sgRNAs to construct a mutant of Spodoptera frugiperda, the method comprising the following steps:

[0010] S1. Designing sgRNA on the fourth exon as shown in SEQ ID No: 5 and / or the fifth exon as shown in SEQ ID No: 6 in the DDC gene, amplifying by PCR to synthesize the sgRNA template, and then in vitro transcribing the obtained sgRNA template to synthesize the sgRNA;

[0011] S2. Mix sgRNA and Cas9 protein to form a mixed solution, and then inject it into the eggs laid by Spodoptera frugiperda. After hatching, feed them with artificial feed until the 4th-5th instar larvae, and then determine the mutation type through phenotypic screening, mutation detection, and T7E1 enzyme cutting detection to obtain individuals with DDC gene function deficiency in Spodoptera frugiperda.

[0012] Preferably, the sgRNA synthesized in S1 includes at least one of SEQ ID Nos: 7-10.

[0013] Preferably, the PCR amplification system for PCR amplification of the sgRNA template in S1 is as follows: 10 μL 5×PrimeSTARGXL Buffer, 4 μL dNTP Mixture, 2 μL upstream sgRNA primer, 2 μL downstream sgRNA primer, 1 μL PrimeSTARGXL DNA Polymerase, and 31 μL ddH2O.

[0014] More preferably, the upstream sgRNA primer is as shown in SEQ ID No: 13 or SEQ ID No: 14 or SEQ ID No: 15 or SEQ ID No: 16, and the downstream sgRNA primer is as shown in SEQ ID No: 17.

[0015] Preferably, the PCR amplification system for PCR amplification of the sgRNA template in S1 is as follows: the reaction procedure is as follows: pre-denaturation at 98°C for 10s, followed by 35 cycles, the cycle conditions are 98°C for 10s, 55°C for 15s, 68°C for 1min, and finally 68°C for 5 minutes.

[0016] Preferably, S1 uses a MAXIscript T7 in vivo Transcription Kit to synthesize sgRNA by in vitro transcription.

[0017] Preferably, in the mixed solution S2, the concentration of sgRNA is 130-170 ng / μL, and the concentration of Cas9 protein is 190-220 ng / μL.

[0018] Preferably, in S2, when sgRNA and Cas9 protein are mixed to form a mixed solution, the mixture is incubated at 37° C. for 10-30 minutes before injection.

[0019] Preferably, in S2, the injection dose per egg is 0.8-2 nL.

[0020] Preferably, the fall armyworm DDC gene mutant is a fall armyworm albino mutant.

[0021] Preferably, the PCR amplification system for mutation detection in S2 is: 10 μL 5× PrimeSTAR GXL Buffer, 4 μL dNTPMixture, 2 μL upstream primer, 2 μL downstream primer, 1 μL PrimeSTAR GXL DNA Polymerase, 31 μL ddH 2 O. The PCR reaction program is as follows: 98°C pre-denaturation for 10 s, followed by 35 cycles, with the cycle conditions being 98°C for 10 s, 55°C for 15 s, 68°C for 1 min, and finally 68°C for 5 min.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention takes the lepidopteran insect fall armyworm as the research object, and designs sgRNA on the fifth exon of dopa decarboxylase (DDC) by CRISPR / Cas9 technology, successfully knocks out the DDC gene to obtain a DDC gene function-deficient larvae mutant, and fully verifies the feasibility of using multiple sgRNAs to knock out the DDC gene in fall armyworm. The method for constructing the fall armyworm DDC mutant of the present invention is not only conducive to destroying the defense mechanism of insects against natural enemies, but also provides a theoretical and application basis for the green prevention and control of fall armyworm. And it can provide a research basis for the research on the regulation of dopa decarboxylase (Dopa decaboxylase, DDC) in insects to synthesize dopamine (Dopamine), and also provides a feasible research means for the research of insect phagocytosis, melanization and ossification and other processes, which has important theoretical research value and practical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is the mass of the synthesized sgRNA (M: 2000 bp Marker, lanes 1-4 are sgRNA1-4, respectively);

[0025] Figure 2The knockout results of the DDC gene: (A) DDC gene structure diagram and the location of the sgRNA target site; the rectangular box represents the exon, and the sgRNA target site is located on the 4th and 5th exons, which are indicated by the gray background. (B) Phenotype of the fifth instar larvae of the G0 generation DDC mutant, WT: wild type, MT: mutant. (C) Enzyme digestion detection of the G0 generation chimeric mutant larvae, and genomic DNA was extracted for enzyme digestion detection; M: 5000bp marker; WT: wild type; D1-6: G0 generation DDC albino larvae. (D) CRISPR / Cas9 system-mediated chimeric mutation of the DDC gene G0 generation individual; the wild-type sequence is shown at the top, and the target position is marked with red letters; in the mutant sequence, deletions are indicated by dashes and substitutions are indicated by yellow letters; the net change in length is marked on the right side of each sequence (+, insertion; -, deletion). DETAILED DESCRIPTION

[0026] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0028] Example:

[0029] This example uses multiple sgRNAs to knock out the DDC gene to construct an albino mutant of Spodoptera frugiperda, including the following steps:

[0030] (1) Experimental Materials

[0031] 1) Test insect source:

[0032] The fall armyworm used in this experiment was purchased from Jilin Haokang Biotechnology Co., Ltd. It is an artificial population raised by the company for a long time. The purchased fall armyworm pupae have been raised in this laboratory for more than 2 years. The fall armyworm was raised in a constant temperature incubator in the Green Control Laboratory of the College of Agriculture and Biotechnology, Sun Yat-sen University, Shenzhen, Guangdong Province. The temperature was 26±1℃, the relative humidity was 60%, and the light: dark cycle was 16:8h. The larvae were fed with artificial feed until pupation, and the adults after emergence were fed with 10% honey water.

[0033] 2) Instruments: microinjection system, pipette, etc.

[0034] (2) Experimental methods

[0035] 1) In vitro synthesis of sgRNA

[0036] The cDNA sequence of the DDC gene (NCBI ID: LOC 118272996) was imported into the CRISPR optimal target finder website (http: / / targetfinder.flycrispr.neuro.brown.edu) to screen all potential target sites of the gene. One site was selected as the target site from all potential target sites. The T7 promoter sequence TAATACGACTCACTATA (SEQ ID No: 11) was added to the 5' end of the target site, and the downstream was the sgRNA universal sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG TGGCACCGAGTCGGTGCTTTT (SEQ ID No: 12). Finally, sgRNAs were designed on the fourth and fifth exons of the DDC gene (one sgRNA for the fourth exon and three sgRNAs for the fifth exon).

[0037] DDC genome sequence (the gray background is five exon sequences, from top to bottom are the first to fifth exons, the underlined bold font is four sgRNA sequences, from top to bottom are sgRNA1-4; DDC corresponds to SEQ ID No: 1 in the nucleotide sequence table, the first to fifth exons correspond to SEQ ID No: 2-6, and sgRNA1-4 correspond to SEQ ID No: 7-10):

[0038]

[0039]

[0040]

[0041]

[0042] The sgRNA template was synthesized by PCR amplification. The PCR amplification system was as follows: 10 μL 5× PrimeSTAR GXL Buffer, 4 μL dNTP Mixture, 2 μL upstream sgRNA primer, 2 μL downstream sgRNA primer (primer name and sequence are shown in Table 1), 1 μL PrimeSTAR GXL DNA Polymerase, 31 μL ddH2O. The PCR reaction procedure was as follows: 98°C pre-denaturation for 10 s, followed by 35 cycles, with the cycling conditions being 98°C for 10 s, 55°C for 15 s, 68°C for 1 min, and finally 68°C for 5 min. After the PCR was completed, the PCR product was detected by agarose gel electrophoresis, and the product was recovered using the Omega Clean Recovery Kit (Cat. No.: D6429-02).

[0043] Table 1: DDC-sgRNA synthesis primer sequences

[0044]

[0045] sgRNA was synthesized by in vitro transcription using the MAXIscript T7 in vivo Transcription Kit. The synthesis method is as follows:

[0046] Prepare in vitro transcription system: add sgRNA template 2.0μL, 10×Transcription Buffer 2.0μL, 10mM ATP 1.0μL, 10mM CTP1.0μL, 10mM GTP1.0μL, 10mM UTP 1.0μL, Enzyme Mix 2.0μL, Nuclease-free water 12μL. After gently pipetting to mix, place in a PCR instrument and incubate at 37°C for 2 hours; after the incubation, add 1.0μL TURBO DNase I, mix thoroughly, and incubate at 37°C for 15 minutes to remove possible residual template DNA; after the incubation, add 29μL RNase-free ddH2O to the centrifuge tube, add 5μL 5mM ammonium acetate, pipette to mix, add 2.5 times the volume of anhydrous ethanol, refrigerate at -20°C to assist precipitation for more than 2 hours; centrifuge at 12000g, 4°C for 15 minutes; discard the supernatant and add 1.0mL 75% alcohol, wash by inversion, let stand for 15 minutes, centrifuge at 4°C, 12000g for 15 minutes, remove the supernatant, and repeat this step once; ventilate and dry for 5 minutes and add an appropriate amount of DEPC water.

[0047] Take 1.0 μL of the obtained sgRNA and add 9.0 μL of RNase-free water to dilute it 10 times; take another 1.0 μL to detect the sgRNA concentration, and use the remaining 9.0 μL for agarose gel electrophoresis to detect the sgRNA quality. Figure 1 As shown, the synthesized sgRNA1-4 bands are clear and complete, meeting the requirements of subsequent experiments.

[0048] 2) Embryo microinjection

[0049] 10 male and female fall armyworms 2 days old after emergence were selected and placed in an insect cage with kitchen paper pasted on the top. The kitchen paper was used for the fall armyworm to lay eggs and the fall armyworms were fed with 10% honey water. The fall armyworm egg masses produced less than 2 hours ago were collected and placed in a culture dish filled with sterilized water. The fall armyworm egg masses were gently dispersed with a fine brush. After disinfecting the slide with alcohol, the eggs were arranged in a vertical row on the slide with a fine brush under a microscope for later use; for embryo injection, sgRNA (Table 2) and Cas9 protein (purchased from Thermo Fisher Scientific, catalog number: 2912885) were mixed into a mixed solution (150 / 200 ng / μL) using an Eppendorf microinjector. After incubation at 37°C for 15 minutes, the mixed solution was transferred to a capillary glass tube and injected into the eggs. The injection dose for each egg was approximately 1 nL; after injection, the slide was placed in a disposable sterile culture medium and transferred to the insect breeding room for incubation.

[0050] Table 2: DDC-sgRNA concentrations

[0051] sgRNA Concentration ng / μL FAW-DDC-sgRNA1 5123.4 FAW-DDC-sgRNA2 1612.8 FAW-DDC-sgRNA3 2713.8 FAW-DDC-sgRNA4 1000.6

[0052] 3) Phenotypic screening

[0053] The hatched larvae were fed with artificial diet. The mutant phenotype of the DDC gene was identified at the 4th instar larvae and the phenotype was photographed using a Nikon stereo microscope ( Figure 2 B).

[0054] Wherein, the fall armyworm feed formula is prepared by the following method:

[0055] ① Weigh 450g of soybean powder and 250g of wheat germ powder, put them in a pot, add 1200mL of pure water, stir evenly (be sure to stir evenly), and then sterilize in an autoclave at 120℃ for 20 minutes (about 1.5h).

[0056] ②Weigh and add the auxiliary materials shown in the following table into a beaker:

[0057]

[0058]

[0059] ③ Weigh 60g of agar strips, add 1100mL of pure water, heat in a microwave to melt (about 10 minutes), then pour into the soybean powder and wheat germ powder in the sterilizer and stir.

[0060] ④ Add 500mL of 65℃ pure water to the beaker containing auxiliary materials to dissolve, and when the temperature in the pot drops below 65℃, pour it into the pot.

[0061] ⑤Finally, add 3 mL of formaldehyde, mix thoroughly and dispense into aluminum lunch boxes, blow dry in a clean bench, and store at 4°C.

[0062] 4) Mutation Detection

[0063] After injection, six fourth-instar larvae with mutant phenotypes were selected to extract genomic DNA. PrimeSTAR GXLDNA Polymerase high-fidelity enzyme PCR was used to amplify the fragment containing the target site. The fragment was amplified according to the following PCR amplification system: 10μL 5× PrimeSTAR GXLBuffer, 4μL dNTP Mixture, 2μL upstream primer, 2μL downstream primer (primer name and sequence see Table 3), 1μL PrimeSTAR GXL DNA Polymerase, 30μL ddH2O, DNA template 200ng. The PCR reaction program is as follows: 98℃ pre-denaturation for 10s, followed by 35 cycles, with the cycling conditions of 98℃ for 10s, 55℃ for 15s, 68℃ for 1min, and finally 68℃ for 5min.

[0064] Table 3: Primer sequences for detecting DDC mutants

[0065] Primer name Sense(5'-3') FAW-DDC-Check-F (SEQ ID No: 18) TGTGTTTTGTTTCATTGTAGAG FAW-DDC-Check-R (SEQ ID No: 19) TGAAGCGCGAGCAAATAGCTAAC

[0066] 5) T7E1 enzyme digestion detection

[0067] After PCR, the PCR product was detected by electrophoresis. If a single band of the correct size (about 1000 bp) appeared, the PCR product was recovered. 500 ng of the recovered PCR product was taken for T7E1 digestion detection to determine whether a mutation occurred. The digestion results were detected by agarose gel electrophoresis: ① T7E1 digestion system is as follows: Template 200 ng, 10×NEBBuffer 2.0μL, ddH2O To 19.5μL. ② Incubation and digestion: 95℃5min; 95℃-85℃: -2℃ / s; 85℃-25℃: -0.1℃ / s. After the incubation, 0.5 μL T7E1 enzyme was added and digested at 37°C for 15 min. The product was then checked by agarose gel electrophoresis. If the PCR product was successfully cut, the uncut PCR product was recovered and connected to the pMD 19-T vector, transformed into Fast-T1 chemically competent cells, and cultured in a medium containing ampicillin. After 12 hours of culture, a single clone was picked and sent to Genewise Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the wild type to determine the mutation type.

[0068] (3) Experimental results

[0069] By comparing the cDNA and genomic DNA sequences of the DDC gene, the positions of its exons and introns were distinguished. According to the sgRNA site selection rules, a target site was selected in the 5th exon of the DDC gene. Then, according to the selected target site, the template sequence for sgRNA in vitro transcription was designed ( Figure 2 A). Then, sgRNA was synthesized by in vitro transcription and the sgRNA / Cas9 mixture was injected into eggs of Spodoptera frugiperda, with an injection volume of about 1 nL per egg.

[0070] After microinjection, the larvae were incubated in the insectary room until hatching, and the phenotype of the hatched larvae was observed. When the injected larvae grew to the fourth instar, their body color was lighter than that of the wild type, and was light yellow ( Figure 2 B), 6 larvae with obvious phenotypes of albino were selected for genomic DNA extraction, followed by PCR amplification. The products were detected by agarose gel electrophoresis and showed a single band with the correct size ( Figure 2 C), the PCR product was purified by Cycle Pure Kit (Omega) and then digested with T7 endonuclease I. The digestion results showed a cut band ( Figure 2 C), indicating that a mutation occurred in the albino larvae. To further determine which mutations were caused, the PCR products were recovered and purified, cloned into the T vector, and 14 single clones were randomly selected. After sequencing by the company, they were compared with the wild-type sequence and found that there was a 420bp base deletion near the target site sgRNA2, 3, and 4 regions, and an AAGGTTAACAG sequence was inserted near the target site sgRNA1 region, and base substitutions of GC, GA, and TC occurred ( Figure 2 D). Enzyme digestion results and monoclonal sequencing results showed that CRISPR / Cas9 successfully knocked out the DDC gene and caused a mutation.

[0071] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs, characterized in that: The following steps are involved: S1. Designing sgRNA on the fourth exon as shown in SEQ ID No: 5 and / or the fifth exon as shown in SEQ ID No: 6 in the DDC gene, amplifying by PCR to synthesize the sgRNA template, and then in vitro transcribing the obtained sgRNA template to synthesize the sgRNA; S2. Mix sgRNA and Cas9 protein to form a mixed solution, and then inject it into the eggs laid by Spodoptera frugiperda. After hatching, feed them with artificial feed until the 4th-5th instar larvae, and then determine the mutation type through phenotypic screening, mutation detection, and T7E1 enzyme cutting detection to obtain individuals with DDC gene function deficiency in Spodoptera frugiperda.

2. A method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: The sgRNA synthesized in S1 includes at least one of SEQ ID Nos: 7-10.

3. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: The PCR amplification system for synthesizing the sgRNA template by PCR amplification described in S1 is as follows: 10 μL 5× PrimeSTARGXL Buffer, 4 μL dNTP Mixture, 2 μL upstream sgRNA primer, 2 μL downstream sgRNA primer, 1 μL PrimeSTARGXL DNA Polymerase, and 31 μL ddH2O.

4. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 3, characterized in that: The upstream sgRNA primer is shown as SEQ ID No: 13 or SEQ ID No: 14 or SEQ ID No: 15 or SEQ ID No: 16, and the downstream sgRNA primer is shown as SEQ ID No:

17.

5. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: The PCR amplification system for synthesizing the sgRNA template in S1 is as follows: the reaction procedure is as follows: pre-denaturation at 98°C for 10s, followed by 35 cycles, the cycling conditions are 98°C for 10s, 55°C for 15s, 68°C for 1min, and finally 68°C for 5min.

6. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: S1 sgRNA was synthesized by in vitro transcription using the MAXIscript T7 in vivo Transcription Kit.

7. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: In the S2 mixed solution, the concentration of sgRNA is 130-170 ng / μL, and the concentration of Cas9 protein is 190-220 ng / μL.

8. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: In S2, when sgRNA and Cas9 protein are mixed to form a mixed solution, it is incubated at 37°C for 10-30 minutes before injection.

9. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: In S2, the injection dose per egg was 0.8-2 nL.

10. The method for obtaining individuals with DDC gene functional deficiency in fall armyworm using multiple sgRNAs according to claim 1, characterized in that: The fall armyworm DDC gene mutant is a fall armyworm albino mutant.

Images