Ratio fluorescent biosensor as well as preparation method and application thereof

Abstract

The invention provides a ratiometric fluorescent biosensor as well as a preparation method and application thereof, and belongs to the technical field of fluorescent biosensors and pathogenic bacterium detection. According to the invention, an Eu-MOF fluorescent material is combined with RPA-CRISPR / Cas12a, high-sensitivity and specific detection of staphylococcus aureus is realized through fluorescence characteristics of Eu-MOF and nucleic acid cleavage activity of Cas12a, and along with recognition and cleavage of target DNA, fluorescence signal change of the ratiometric fluorescent biosensor can be observed; the ratiometric fluorescent biosensor has a built-in calibration function, can reduce interference brought by the environment and instruments, has good selectivity to staphylococcus aureus and good anti-interference performance to other bacteria, and can be used for rapid detection in the field of food safety.

Description

Technical Field

[0001] The invention belongs to the technical field of fluorescent biosensors and pathogenic bacteria detection, and in particular relates to a ratio fluorescent biosensor and a preparation method and application thereof. Background Art

[0002] Eggs are one of the most important nutritional foods in the world and are susceptible to microbial contamination, leading to food safety issues. Staphylococcus aureus is a common pathogen in eggs, which can cause a variety of diseases ranging from minor skin infections to life-threatening diseases such as sepsis and pneumonia. Therefore, the rapid and accurate detection of Staphylococcus aureus has important clinical and public health significance.

[0003] At present, the detection methods of Staphylococcus aureus mainly include culture method, molecular biology method and immunological method. Among them, although the culture method has high specificity, it requires a long culture time and has insufficient detection sensitivity for samples with low initial bacterial counts; although molecular biology methods such as polymerase chain reaction (PCR) and nucleic acid hybridization technology are fast, the equipment cost is high, the operation is complicated, and it is easily affected by contaminants in the sample; immunological methods rely on specific antibodies, which are complicated to prepare and costly, and may affect the accuracy of the results due to cross-reactions. Therefore, the above methods are difficult to be widely used in actual detection processes, and it is necessary to develop a new Staphylococcus aureus detection method with high sensitivity, good specificity and strong stability. Summary of the invention

[0004] In view of some deficiencies in the prior art, the present invention provides a ratiometric fluorescent biosensor and a preparation method and application thereof; the present invention combines Eu-MOF fluorescent material with RPA-CRISPR / Cas12a, and realizes high-sensitivity and specific detection of Staphylococcus aureus through the fluorescence characteristics of Eu-MOF and the nucleic acid cleavage activity of Cas12a. With the recognition and cleavage of target DNA, the fluorescence signal change of the ratiometric fluorescent biosensor can be observed; the ratiometric fluorescent biosensor has a built-in calibration function, which can reduce the interference caused by the environment and instruments, and it has good selectivity for Staphylococcus aureus and good anti-interference performance for other bacteria, and can be used for rapid detection in the field of food safety.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0006] The present invention first provides a ratiometric fluorescent biosensor, which includes a fluorescent element Eu-MOF and a specific recognition element RPA-CRISPR / Cas12a;

[0007] The Eu-MOF presents a 2D quadrilateral sheet structure;

[0008] The specific recognition element is obtained by mixing and incubating the nucleic acid isothermal amplification (RPA) product, Cas12a protein, crRNA and ssDNA-FAM in a base solution 10XNEBuffer2.1 and enzyme-free water.

[0009] Preferably, the sequence of the RPA product is:

[0010] 5'-GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGT-3' (SEQ ID No: 1);

[0011] The sequence of the crRNA is:

[0012] 5'-UAAUUUCUACUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC-3'(SEQ IDNo:2);

[0013] The sequence of the ssDNA-FAM is: 5'-FAM-AAAAAAAAAAAAAAAAAAAAA-3' (SEQ ID No: 3).

[0014] The present invention also provides a method for preparing the ratiometric fluorescent biosensor, the method comprising:

[0015] (1) Preparation of Eu-MOF:

[0016] Dissolving europium nitrate hexahydrate and pyromellitic acid in an aqueous solution of N,N-dimethylformamide (DMF), and then subjecting the mixture to a hydrothermal reaction, washing and drying the mixture after the reaction is completed, thereby obtaining a europium-based metal organic framework, which is referred to as Eu-MOF.

[0017] (2) Preparation of ratiometric fluorescence biosensor:

[0018] The Cas12a protein and crRNA were preassembled in the base solution 10X NEBuffer2.1 and enzyme-free water. After the assembly, the RPA product and ssDNA-FAM were added and mixed and incubated. After the incubation, the specific recognition element RPA-CRISPR / Cas12a was obtained;

[0019] The specific recognition element RPA-CRISPR / Cas12a is mixed with the obtained Eu-MOF for reaction, and after the reaction is completed, the ratio fluorescence biosensor is obtained.

[0020] Preferably, in step (1), the molar concentration ratio of europium nitrate hexahydrate to pyromellitic acid is 1-3:1-3;

[0021] In the aqueous solution of N,N-dimethylformamide, the volume ratio of N,N-dimethylformamide to water is 3-7:0.5-5;

[0022] The hydrothermal reaction conditions are: reacting at 150-180° C. for 3-10 hours.

[0023] Preferably, in step (2), the volume ratio of the Cas12a protein, crRNA, RPA product and ssDNA-FAM is 0.5-2: 0.5-2: 1-4: 2-6; the volume ratio of the 10XNEBuffer2.1 and enzyme-free water is 1-5: 10-30; the concentration of the Cas12a is 0.5-2 μM; the concentration of the crRNA is 0.5-2 μM; the concentration of the ssDNA-FAM is 1-10 μM.

[0024] Preferably, in step (2), the pre-assembly conditions are: incubating at 20-50° C. for 1-20 min;

[0025] The mixed incubation conditions are: incubation at 20-50° C. for 1-50 min.

[0026] Preferably, in step (2), the volume ratio of the specific recognition element RPA-CRISPR / Cas12a and Eu-MOF is 10-40:30-80;

[0027] The concentration of the Eu-MOF is 10 to 200 μg / mL; the pH of the Eu-MOF solution is 3.01 to 11.00.

[0028] The mixing reaction is carried out at 20 to 50° C. for 1 to 30 minutes.

[0029] The present invention also provides application of the ratio fluorescence biosensor in detecting Staphylococcus aureus.

[0030] Preferably, the use comprises Staphylococcus aureus in food.

[0031] Preferably, the food product comprises eggs.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention combines Eu-MOF fluorescent material and RPA-CRISPR / Cas12a to prepare a ratio fluorescence biosensor, which utilizes the stable fluorescence performance of Eu-MOF and the high sensitivity and high specificity detection ability of the RPA-CRISPR / Cas12a system to quickly and accurately detect Staphylococcus aureus, and is easy to operate and low in cost. In addition, the sensor also has good anti-interference performance and can maintain a high degree of detection accuracy in a complex sample environment.

[0034] Compared with the prior art, the ratiometric fluorescent biosensor of the present invention has the following advantages:

[0035] (1) High sensitivity and high specificity:

[0036] The present invention combines the fluorescence properties of Eu-MOF and the single-base resolution ability of the CRISPR / Cas12a system, and can accurately detect extremely low concentrations of pathogenic bacteria by specifically identifying the nuc gene of Staphylococcus aureus and cutting ssDNA-FAM. Compared with traditional culture and PCR methods, this greatly improves the sensitivity of detection and reduces false positive results.

[0037] (2) Rapid detection capability:

[0038] Traditional culture methods take several days to get results, while the RPA technology used in the present invention can complete DNA amplification in just tens of minutes, and the CRISPR / Cas12a reaction time is 30 minutes, and the detection process can be completed within 80 minutes, greatly shortening the detection time.

[0039] (3) Easy operation and low cost:

[0040] Compared with the PCR technology that requires expensive equipment and professional operation, the RPA-CRISPR / Cas12a system used in the present invention is easy to operate and does not require high-end experimental equipment, which reduces the detection cost and is suitable for environments with limited resources.

[0041] (4) Built-in calibration function:

[0042] The present invention uses the stable fluorescence of Eu-MOF as an internal reference signal, which can effectively resist the influence of environmental changes and instrument differences, thereby improving the accuracy and reliability of the experimental results.

[0043] (5) Good anti-interference performance:

[0044] The sensor of the present invention can specifically identify the target DNA and maintain a high degree of detection specificity even in the presence of other bacteria, thereby avoiding cross-reaction and interference.

[0045] (6) Wide application potential:

[0046] The present invention can not only be used for pathogenic bacteria detection in the medical and health field, but can also be extended to multiple fields such as food safety and environmental monitoring, and has very broad market prospects and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Characterization diagram of Eu-MOF material; A is the SEM image of Eu-MOF; B is the EDX mapping image of Eu-MOF and the distribution diagram of C, N, O, and Eu elements; Figure C is the FT-IR image of Eu-MOF; Figure D is the XPS image of Eu-MOF; Figure E is the peak fitting of Eu3d, O 1s, C 1s, and Eu 4d.

[0048] Figure 2 Agarose gel electrophoresis (2%) was used to verify the RPA amplification effect of Staphylococcus aureus.

[0049] Figure 3 A in the middle is PAGE to verify the feasibility of CRISPR / Cas12a system cutting, and B is fluorescence characterization to verify the feasibility of CRISPR / Cas12a combined with EuMOF to detect Staphylococcus aureus.

[0050] Figure 4 For different concentrations of Staphylococcus aureus (7.9×10 0 -7.9×10 8 CUF / mL) under the conditions of FAM (A) and Eu-MOF (B) in the sensor.

[0051] Figure 5 is the fluorescence intensity ratio F 520 / F 617 Linear curve with S. aureus concentration.

[0052] Figure 6 Specificity of the ratiometric fluorescence biosensor.

[0053] Figure 7 This is a diagram showing the stability of the ratiometric fluorescence biosensor. DETAILED DESCRIPTION

[0054] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are followed. The reagents or instruments used are not indicated by the manufacturer and are conventional products that can be purchased on the market.

[0055] The sequences involved in the following embodiments include:

[0056] RPA products:

[0057] 5'-GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGT-3' (SEQ ID No: 1), obtained by amplifying Staphylococcus aureus using the DNA isothermal rapid amplification kit of Anpu Future (Changzhou) Biotechnology Co., Ltd.;

[0058] crRNA: 5′-UAAUUUCUACUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC-3′ (SEQ ID No: 2), synthesized by Qingke Biotechnology;

[0059] The sequence of the ssDNA-FAM is: 5'-FAM-AAAAAAAAAAAAAAAAAAAAA-3' (SEQ ID No: 3), which was synthesized by Sangon Biotechnology Co., Ltd., wherein FAM is fluorescein.

[0060] Example 1: Preparation of ratiometric fluorescence biosensor

[0061] (1) Preparation of Eu-MOF:

[0062] 0.15mM Eu(NO3)3·6H2O and 0.15mM PMA were weighed, 7mL DMF and 1mL H2O were added to fully dissolve them, and then transferred to a reactor and hydrothermally reacted in an oven at 160°C for 3 hours. After the reaction was completed, it was cooled to room temperature, centrifuged and washed three times with DMF, washed once with methanol, and finally dried in a vacuum drying oven at 60°C for 6 hours to obtain Eu-MOF solid powder.

[0063] Figure 1 Characterization diagram of Eu-MOF material. Figure 1It can be seen that the Eu-MOF material presents a 2D quadrilateral sheet structure ( Figure 1 A); C, N, O, and Eu elements are evenly distributed throughout the sample ( Figure 1 B); Figure 1 The changes in the peak positions and peak values ​​of the C ligand and Eu-MOF prove the effective synthesis of Eu-MOF; XPS results ( Figure 1 D) further proves the successful preparation of Eu-MOF. Peak fitting of Eu3d, O 1s, C 1s, and Eu 4d ( Figure 1 E) It shows that Eu(NO3)3·6H2O is successfully coordinated with the ligand PMA.

[0064] (2) RPA amplification of Staphylococcus aureus:

[0065] Staphylococcus aureus (CMCC 26003) was cultured in LB medium at 37°C in a shaker at 160 rpm, and a series of dilutions were prepared. 100 μL of the dilution was inoculated on a Hektoen enteric (HE) agar plate and incubated at 37°C for 24 hours. The number of colonies was counted on three parallel plates, and the plate with a concentration of 7.9 × 10 0 -7.9×10 8 CUF / mL of Staphylococcus aureus dilution was used for extraction and amplification.

[0066] The bacterial genomic DNA extraction kit (Tiangen Biotechnology (Beijing) Co., Ltd.) was used to extract the cultured Staphylococcus aureus genomic DNA, and the extracted Staphylococcus aureus genomic DNA was amplified using a DNA isothermal rapid amplification kit to obtain an RPA product. After sequencing, the nucleotide sequence of the RPA product is shown in SEQ ID No: 1.

[0067] Figure 2 The RPA amplification effect was verified. As can be seen from the figure, lane 1 is a marker, and lanes 2-5 are 7.9×10 3 -7.9×10 0 The RPA product of CFU / mL Staphylococcus aureus has an obvious band between 100bp and 150bp compared with the marker in lanes 2-5, which is consistent with the theoretical amplification size of 139bp designed by the primers. When some proteins in the purification system bind to the band, the molecular weight increases, and a dark band is observed above the target band, but it does not affect the experimental results. The bands observed below the target band may be due to low template concentration or low primer amplification efficiency.

[0068] (3) Preparation of ratiometric fluorescence biosensor:

[0069] 1 μL 1 μM Cas12a, 1 μL 1 μM crRNA, 3 μL 10X NEBuffer r2.1 and 20 μL nuclease-free water were preassembled at 25°C for 10 minutes, and 3 μL 5 μM ssDNA-FAM and 2 μL RPA amplification product were added thereto after the assembly, and incubated at 37°C for 30 minutes. After the incubation, the solution was heated to 65°C for 10 minutes to inactivate Cas12a to obtain RPA-CCRISPR / Cas12a. 50 μL of Eu-MOF with a pH of 7.23 and a concentration of 50 μg / mL was added to RPA-CCRISPR / Cas12a, and the reaction was carried out at 25°C for 10 minutes. After the reaction, the ratio fluorescence biosensor was obtained.

[0070] The ratiometric fluorescence biosensor was subjected to spectral analysis, and the analysis results were as follows: Figure 3 shown.

[0071] Figure 3 A As can be seen, in the case of only ssDNA-FAM (lane 1) and the system lacking RPA product (lane 2), the ssDNA-FAM band remains intact; after the addition of RPA product (lane 3), the ssDNA-FAM band disappears, indicating that Cas12a is activated in the presence of RPA product and shears ssDNA-FAM.

[0072] like Figure 3 As shown in the inset of B, when ssDNA-FAM is not cut by Cas12a, the fluorescence intensity of FAM decreases rapidly after the addition of Eu-MOF; when ssDNA-FAM is cut by Cas12a, the fluorescence intensity of FAM remains almost unchanged after the addition of Eu-MOF. Figure 3 As can be seen in B, Eu-MOF can effectively quench the fluorescence of ssDNA-FAM (red line), and after adding the RPA product, a significant increase in fluorescence intensity was observed. This not only shows the effectiveness of Eu-MOF as a fluorescence quencher, but also shows that after Cas12a is activated, it shears ssDNA-FAM, and short fragments of ssDNA-FAM will not be adsorbed and quenched by Eu-MOF, making the FAM fluorescence almost stable.

[0073] Example 2: Preparation of ratiometric fluorescence biosensor

[0074] (1) Preparation of Eu-MOF:

[0075] 0.15mM Eu(NO3)3·6H2O and 0.3mM PMA were weighed, 4mL DMF and 2mL H2O were added to fully dissolve them, and then transferred to a reactor and hydrothermally reacted in an oven at 170°C for 5 hours. After the reaction was completed, it was cooled to room temperature, centrifuged and washed three times with DMF, washed once with methanol, and finally dried in a vacuum drying oven at 60°C for 6 hours to obtain Eu-MOF solid powder.

[0076] (2) RPA amplification of Staphylococcus aureus:

[0077] Staphylococcus aureus (CMCC 26003) was cultured in LB medium at 37°C in a shaker at 160 rpm, and a series of dilutions were prepared. 100 μL of the dilution was inoculated on a Hektoen enteric (HE) agar plate and incubated at 37°C for 24 hours. The number of colonies was counted on three parallel plates, and the plate with a concentration of 7.9 × 10 0 -7.9×10 8 CUF / mL of Staphylococcus aureus dilution was used for extraction and amplification.

[0078] The bacterial genomic DNA extraction kit (Tiangen Biotechnology (Beijing) Co., Ltd.) was used to extract the cultured Staphylococcus aureus genomic DNA, and the extracted Staphylococcus aureus genomic DNA was amplified using a DNA isothermal rapid amplification kit to obtain the RPA product.

[0079] (3) Preparation of ratiometric fluorescence biosensor:

[0080] 1.5 μL 1.5 μM Cas12a, 1.5 μL 1.5 μM crRNA, 2 μL 10XNEBuffer r2.1 and 30 μL nuclease-free water were preassembled at 25°C for 10 minutes, and 1 μL 5 μM ssDNA-FAM and 2 μL RPA product were added thereto after the assembly, and incubated at 37°C for 30 minutes. After the incubation, the solution was heated to 65°C for 10 minutes to inactivate Cas12a to obtain RPA-CCRISPR / Cas12a. 40 μL of Eu-MOF with a pH of 5.03 and a concentration of 100 μg / mL was added to RPA-CCRISPR / Cas12a, and the reaction was carried out at 40°C for 5 minutes. After the reaction, the ratio fluorescence biosensor was obtained.

[0081] Example 3: Preparation of ratiometric fluorescence biosensor

[0082] (1) Preparation of Eu-MOF:

[0083] 0.2mM Eu(NO3)3·6H2O and 0.3mM PMA were weighed, 7mL DMF and 1mL H2O were added to fully dissolve them, and then transferred to a reactor and hydrothermally reacted in an oven at 160°C for 3 hours. After the reaction was completed, it was cooled to room temperature, centrifuged and washed three times with DMF, washed once with methanol, and finally dried in a vacuum drying oven at 60°C for 6 hours to obtain Eu-MOF solid powder.

[0084] (2) RPA amplification of Staphylococcus aureus:

[0085] Staphylococcus aureus (CMCC 26003) was cultured in LB medium at 37°C in a shaker at 160 rpm, and a series of dilutions were prepared. 100 μL of the dilution was inoculated on a Hektoen enteric (HE) agar plate and incubated at 37°C for 24 hours. The number of colonies was counted on three parallel plates, and the plate with a concentration of 7.9 × 10 0 -7.9×10 8 CUF / mL of Staphylococcus aureus dilution was used for extraction and amplification.

[0086] The bacterial genomic DNA extraction kit (Tiangen Biotechnology (Beijing) Co., Ltd.) was used to extract the cultured Staphylococcus aureus genomic DNA, and the extracted Staphylococcus aureus genomic DNA was amplified using a DNA isothermal rapid amplification kit to obtain the RPA product.

[0087] (3) Preparation of ratiometric fluorescence biosensor:

[0088] 1 μL 2μM Cas12a, 1 μL 2μM crRNA, 3 μL 10X NEBuffer r2.1 and 10 μL nuclease-free water were preassembled at 25°C for 10 minutes, and 3 μL 8μM ssDNA-FAM and 2μL RPA product were added thereto after the assembly, and incubated at 37°C for 30 minutes. After the incubation, the solution was heated to 65°C for 10 minutes to inactivate Cas12a to obtain RPA-CCRISPR / Cas12a. 30 μL of Eu-MOF with a pH of 8.98 and a concentration of 80 μg / mL was added to RPA-CCRISPR / Cas12a, and the reaction was carried out at 20°C for 20 minutes. After the reaction, the ratio fluorescence biosensor was obtained.

[0089] Example 4: Detection and performance evaluation of Staphylococcus aureus

[0090] This example investigates the detection capability of the ratiometric fluorescent biosensor prepared in Example 1 for Staphylococcus aureus, and the specific investigation is as follows:

[0091] (1) Drawing of standard curve:

[0092] The ratiometric fluorescence biosensor was used to detect 7.9×10 0 CUF / mL, 7.9×10 1 CUF / mL, 7.9×10 2 CUF / mL, 7.9×10 3 CUF / mL, 7.9×10 4 CUF / mL, 7.9×10 5 CUF / mL, 7.9×10 6 CUF / mL, 7.9×10 7 CUF / mL, 7.9×10 8 CUF / mL Staphylococcus aureus, and record the fluorescence intensity of FAM and Eu-MOF after adding different concentrations of Staphylococcus aureus. When measuring the fluorescence signal using a fluorescence spectrophotometer, when measuring Eu-MOF, set the excitation wavelength to 495nm and the scanning range to 510-600nm; when measuring FAM, set the excitation wavelength to 255nm and the scanning range to 560-660nm. The logarithmic concentration of Staphylococcus aureus (lg CFU / mL) and the corresponding fluorescence intensity difference are plotted into a scatter plot, and a standard curve for Staphylococcus aureus detection is established by regression analysis. The results are shown in Figure 2. Figure 4 and 5 shown.

[0093] from Figure 4 It can be seen that as the concentration of the amplified product of Staphylococcus aureus gradually increases, the fluorescence intensity of FAM at 520 nm in the ratiometric fluorescence sensor is significantly enhanced ( Figure 4 A). At the same time, the fluorescence intensity of Eu-MOF at 617 nm remained stable and was not affected by the change in the concentration of the amplified product ( Figure 4 B). This is because the fluorescence emission of Eu-MOF is independent of the presence of S. aureus, which acts as an internal reference signal and provides a stable baseline for correcting fluorescence fluctuations that may be caused by external environment or instrument differences.

[0094] Figure 5 The fluorescence ratio of the sensor to the amplified products of different bacterial concentrations is shown. S.aureus The logarithm of the linear equation is used to construct the linear equation. According to the linear regression curve, the regression equation y = 0.2249x + 2.6842 (R 2 =0.9871). Where y and x represent F 520 / F 617 and lg C S.aureusThe logarithm (log) value of the fluorescence ratio to the concentration of Staphylococcus aureus was 7.9×10 0 -7.9×10 8 There was a good linear relationship between the concentrations of 100 μg / mL and the detection limit (LOD) was 3 CFU / mL.

[0095] (2) Specificity assessment:

[0096] The mixtures of Escherichia coli (ATCC 26922), Listeria monocytogenes (ATCC 19115) and Staphylococcus aureus were respectively subjected to RPA amplification. Then, the RPA amplification products were used to detect the ratio fluorescence biosensor described in Example 1. The detection results are shown in FIG. Figure 6 shown.

[0097] from Figure 6 It can be seen that the ratiometric fluorescence biosensor of the present invention has excellent specificity for Staphylococcus aureus. It can be seen that the prepared sensor not only has a high specificity for Staphylococcus aureus, but can also effectively eliminate the interference of non-target pathogenic bacteria, greatly improving the accuracy and reliability of detection.

[0098] (3) Stability assessment:

[0099] In this step, the ratiometric fluorescence biosensor was used to detect the same concentration of Staphylococcus aureus for five consecutive days to evaluate the stability of the ratiometric fluorescence biosensor. Figure 7 shown.

[0100] from Figure 7 It can be seen that the ratiometric fluorescence biosensor exhibits extremely high stability in continuous measurement, and its relative standard deviation (RSD) in the detection of Staphylococcus aureus is less than 1.67%.

[0101] In summary, the ratiometric fluorescence biosensor of the present invention can detect Staphylococcus aureus with high sensitivity and high specificity at 7.9×10 0 to 7.9×10 8 The invention shows a wide linear response in the range of CFU / mL, and the detection limit is as low as 3CFU / mL; after adding the nucleic acid of Staphylococcus aureus, the ratio fluorescence biosensor can observe a significant change in the fluorescence signal; the sensor has a built-in calibration function, which can effectively reduce the influence of environmental variation and instrument error, has extremely high selectivity for Staphylococcus aureus, and has good anti-interference performance for other bacteria or common pollutants, can be used for rapid detection in clinical and food safety fields, and has good practicality.

[0102] The embodiments are preferred implementations of the present invention, but the present invention is not limited to the above-mentioned implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. A ratiometric fluorescence biosensor, characterized in that: The ratiometric fluorescent biosensor includes a fluorescent element Eu-MOF and a specific recognition element RPA-CRISPR / Cas12a; The Eu-MOF presents a 2D quadrilateral sheet structure; The specific recognition element is obtained by mixing and incubating the RPA product, Cas12a protein, crRNA and ssDNA-FAM in a base solution 10XNEBuffer2.1 and enzyme-free water.

2. The ratiometric fluorescence biosensor according to claim 1, characterized in that: The sequence of the RPA product is: 5'-GCATCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTAT ATAGTGCAACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTG ATGGTGATACGGTTAAATTAATGT-3' (SEQ ID No: 1); The sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUGUUGAAGUUGCACUAUAUAC-3'(SEQ IDNo:2); The sequence of the ssDNA-FAM is: 5'-FAM-AAAAAAAAAAAAAAAAAAAAA-3' (SEQ ID No: 3).

3. The method for preparing the ratiometric fluorescent biosensor according to claim 1, characterized in that: The preparation method comprises: (1) Preparation of Eu-MOF: Dissolving europium nitrate hexahydrate and pyromellitic acid in an aqueous solution of N,N-dimethylformamide, and then subjecting the mixture to a hydrothermal reaction, washing and drying the mixture after the reaction is completed, thereby obtaining a europium-based metal organic framework, which is referred to as Eu-MOF. (2) Preparation of ratiometric fluorescence biosensor: The Cas12a protein and crRNA were preassembled in the base solution 10X NEBuffer2.1 and enzyme-free water. After the assembly, the RPA product and ssDNA-FAM were added and mixed and incubated. After the incubation, the specific recognition element RPA-CRISPR / Cas12a was obtained; The specific recognition element RPA-CRISPR / Cas12a is mixed with the obtained Eu-MOF for reaction, and after the reaction is completed, the ratio fluorescence biosensor is obtained.

4. The method for preparing a ratiometric fluorescent biosensor according to claim 3, characterized in that: In step (1), the molar concentration ratio of europium nitrate hexahydrate to pyromellitic acid is 1-3:1-3; In the aqueous solution of N,N-dimethylformamide, the volume ratio of N,N-dimethylformamide to water is 3-7:0.5-5; The hydrothermal reaction conditions are: reacting at 150-180° C. for 3-10 hours.

5. The method for preparing a ratiometric fluorescent biosensor according to claim 3, characterized in that: In step (2), the volume ratio of the Cas12a protein, crRNA, RPA product and ssDNA-FAM is 0.5-2:0.5-2:1-4:2-6; The volume ratio of the 10X NEBuffer 2.1 to enzyme-free water is 1-5:10-30; The concentration of Cas12a is 0.5-2 μM; the concentration of crRNA is 0.5-2 μM; The concentration of the ssDNA-FAM is 1-10 μM.

6. The method for preparing a ratiometric fluorescent biosensor according to claim 3, characterized in that: In step (2), the pre-assembly conditions are: incubation at 20-50° C. for 1-20 min; The mixed incubation conditions are: incubation at 20-50° C. for 1-50 min.

7. The method for preparing a ratiometric fluorescent biosensor according to claim 3, characterized in that: In step (2), the volume ratio of the specific recognition element RPA-CRISPR / Cas12a and Eu-MOF is 10-40:30-80; The concentration of the Eu-MOF is 10 to 200 μg / mL; the pH of the Eu-MOF solution is 3.01 to 11.

00. The mixing reaction is carried out at 20 to 50° C. for 1 to 30 minutes.

8. Use of the ratiometric fluorescent biosensor according to claim 1 in detecting Staphylococcus aureus.

9. The use according to claim 8, characterized in that: The applications include Staphylococcus aureus in food.

10. The use according to claim 9, characterized in that: The food comprises eggs.

Images