Application of methylation site CG06087988 in type 2 diabetes detection

Abstract

The invention relates to the technical field of gene detection, in particular to application of a DNA methylation site in diagnosis of type 2 diabetes mellitus, a kit and a method thereof. Clinical detection proves that the methylation site cg06087988 has significant difference between a type 2 diabetes mellitus patient and a non-type 2 diabetes mellitus individual, and can act on diagnosis / prediction of type 2 diabetes mellitus.

Description

Technical Field

[0001] The present application relates to the field of gene detection technology, and specifically to the application, product and method of the methylation site CG06087988 in the diagnosis / prediction of type 2 diabetes. Background Art

[0002] Type 2 diabetes is the most common subtype of diabetes. About 90% of diabetic patients worldwide have type 2 diabetes. The main symptom of type 2 diabetes is an increase in blood sugar levels. Its pathogenesis is the relative insufficiency of insulin synthesis and secretion by the pancreatic islets, which leads to reduced insulin sensitivity in the blood and induces insulin resistance in peripheral organs. The long-term compensatory work of pancreatic β cells eventually leads to functional failure and loss of insulin secretion capacity. Type 2 diabetes may cause serious damage to patients' blood vessels, eyes, kidneys and nerves, leading to a series of complications, seriously endangering the lives and health of residents. Early and accurate prediction and diagnosis of type 2 diabetes is of great significance for the early prevention and treatment of patients with type 2 diabetes.

[0003] DNA methylation refers to the covalent bond of a methyl group to the 5' carbon atom of cytosine in genomic cytosine-phosphate-guanine (CpG) dinucleotides under the action of DNA methyltransferase. DNA methylation is an important epigenetic modification of genes. More than 98% of CpG dinucleotides in the human genome are distributed in repetitive sequences with transcription-dependent transposition potential. As a new type of biomarker, DNA methylation has shown great application potential in the risk prediction, disease diagnosis and prognosis evaluation of human diseases. DNA methylation is in a dynamic state of change during the life process of the human body and can record the influence of environmental factors like tree rings. As a new type of biomarker, DNA methylation has shown great application potential in the risk prediction, disease diagnosis and prognosis evaluation of human diseases. In addition, methylation site detection can also be used to study important issues such as epigenetic regulation, gene expression regulation and the influence of environmental factors on the genome. For example, Chinese invention patent CN105861644A proposed DNA methylation markers for predicting the risk of lung cancer and their detection methods and kits; Chinese invention patent CN110982907B proposed thyroid nodule-related DNA methylation markers and their applications.

[0004] Existing studies have shown that DNA methylation levels are closely related to type 2 diabetes. For example, Ling et al. found that the methylation level of the promoter region of the PPARGC1A gene in the pancreatic islet tissue of patients with type 2 diabetes was significantly lower than that in healthy individuals. Barres et al. further found that the methylation level of the promoter region of the PPARGC1A gene was significantly lower in the skeletal muscle of patients with type 2 diabetes than in healthy individuals. In peripheral blood, multiple DNA methylation markers were also found to be significantly different between patients with type 2 diabetes and healthy individuals. For example, in peripheral blood, DNA methylation sites on the ABCG1, LOXL2, TXNIP, SLC1A5 and SREBF1 genes were found to be significantly different between patients with type 2 diabetes and healthy individuals. Therefore, by monitoring the level of DNA methylation in peripheral blood, it is expected to provide earlier and more accurate prediction and diagnosis for type 2 diabetes. At present, there are few research reports on the level of DNA methylation in peripheral blood of people with type 2 diabetes in China. Based on this, this application is proposed. Summary of the invention

[0005] In order to solve the above technical problems, this application recruited two type 2 diabetes case-control populations in multiple hospitals in Guangzhou (population 1: recruited from January to December 2022; population 2: recruited from January to December 2023). The samples of population 1 were detected using Illumina's methylation chip Infinium MethylationEPIC BeadChip (referred to as 850k chip) to detect 850,000 DNA methylation sites in the whole genome; population 2 used methylation specific PCR (MSP) to verify the candidate DNA methylation sites. Through the study of clinical cases, it was found that the methylation site cg06087988 was highly methylated in the peripheral blood of patients with type 2 diabetes. Based on the above research, this application includes at least the following two purposes:

[0006] The first purpose of this application is to seek a new method for diagnosing or predicting type 2 diabetes;

[0007] The second purpose of the present application is to seek a new methylation marker for detecting type 2 diabetes and a detection kit thereof.

[0008] In order to achieve the above objectives, this application specifically provides the following technical solutions:

[0009] The present application first provides a DNA methylation marker for type 2 diabetes, wherein the DNA methylation marker is a DNA methylation site, specifically cg06087988; wherein cg represents the number of the site in the CpG locus database of Illumina. The marker is suitable for diagnosing type 2 diabetes, and the methylation degree or level of the DNA methylation site is used to diagnose or predict type 2 diabetes, providing a basis for the diagnosis of type 2 diabetes.

[0010] Furthermore, the diagnosis or prediction includes early prediction, screening (including early screening), auxiliary diagnosis, diagnosis (determining whether the disease exists), judging the severity of the disease, assessing disease activity, monitoring treatment, etc.; preferably, the diagnosis or prediction described in this application includes early screening, auxiliary diagnosis or diagnosis, etc.

[0011] The present application also provides a use of a detection agent for obtaining the level of methylation site CG06087988 in a sample in the preparation of a product for diagnosing or predicting type 2 diabetes.

[0012] The present application also provides an application of a detection agent for obtaining the level of methylation site CG06087988 in a sample in the diagnosis or prediction of type 2 diabetes.

[0013] The present application also provides an application of a methylation site CG06087988 as a diagnostic marker for type 2 diabetes.

[0014] Furthermore, in the aforementioned applications, the diagnosis or prediction includes early prediction, screening (including early screening), auxiliary diagnosis, diagnosis (determining whether the disease exists), judging the severity of the disease, assessing disease activity, monitoring treatment, etc.; preferably, it includes early prediction, early screening or diagnosis, etc.

[0015] Further, in the aforementioned application, the detection agent is used for detection at the nucleic acid level;

[0016] In some embodiments, the detection agent is used to perform any of the following methods: polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid sequencing, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method.

[0017] In some embodiments, the detection agent performs a polymerase chain reaction;

[0018] Preferably, the polymerase chain reaction uses the following specific primers:

[0019] Detection primer pairs for unmethylated

[0020] F:TAGTTGGGTTGGGGAGTTTAC (SEQ ID NO: 1);

[0021] R:AAAAAAAAACAACAAATTCGAT(SEQ ID NO:2);

[0022] Primer pairs for methylation detection:

[0023] F: TTTAGTTGGGTTGGGGAGTTTAT (SEQ ID NO: 3);

[0024] R:AAAAAAAAACAACAAATTCAAT (SEQ ID NO:4).

[0025] The primer pair can be used to effectively detect the methylation level or degree of the DNA methylation marker described herein using a methylation-specific PCR method.

[0026] Further, in the aforementioned application, the sample may be selected from at least one of blood, serum, plasma, tissue or tissue lysate, urine or saliva;

[0027] In some preferred aspects, the sample is selected from blood, serum or plasma.

[0028] The present application also provides a product for the diagnosis or prediction of type 2 diabetes, wherein the product comprises a reagent for detecting the level of methylation site CG06087988;

[0029] In some aspects, the product is in the form of a kit.

[0030] In some specific embodiments, the kit may include the primer pair described above.

[0031] Furthermore, the kit may also contain other reagents for detecting known markers that can be used for the diagnosis of type 2 diabetes, thereby improving the diagnostic or predictive performance through the combined detection of multiple markers.

[0032] The present application also provides a method for diagnosing or predicting type 2 diabetes, which comprises the step of detecting the level of methylation site cg10364040 in a sample.

[0033] Furthermore, the method may include the following steps:

[0034] (i) obtaining the level of methylation site cg10364040 in the test sample;

[0035] (ii) compared with a control sample; wherein the significant difference in the level of cg10364040 between the subject sample and the control sample is a possible indication that the subject will suffer from type 2 diabetes in the future, or an indication that the subject suffers from type 2 diabetes, or,

[0036] (ii) comparing with a set threshold absolute amount; wherein, the level of the subject's sample is higher than the threshold absolute amount, which is an indication that the subject may suffer from type 2 diabetes in the future, or an indication that the subject suffers from type 2 diabetes.

[0037] The present application also provides a method for detecting a marker in a subject having or suspected of having type 2 diabetes in vivo or in vitro, the method comprising determining or detecting the level of the methylation site cg10364040 in a sample from the subject.

[0038] The present application also provides a method for evaluating or screening diagnostic markers for type 2 diabetes, comprising the step of performing correlation or consistency analysis on potential biomarkers and the methylation site CG06087988. It can be understood that on the basis of believing that CG06087988 can be used as a diagnostic marker for type 2 diabetes, those skilled in the art can evaluate or screen other potential diagnostic markers for type 2 diabetes accordingly, and usually evaluate the correlation between the potential biomarker and CG06087988, and when a positive correlation conclusion is obtained, the diagnostic value of the potential diagnostic marker can be proved. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0040] Figure 1 , box plot of the methylation ratio of cg06087988 site in the type 2 diabetes patient group and the control group in Example 1. There were 223 patients in the case group and 204 patients in the control group. The methylation level difference analysis of DNA methylation sites between the case group and the control group used multiple linear regression, correcting for gender, age and body mass index.

[0041] Figure 2 , box plot of the methylation ratio of the cg06087988 locus in the type 2 diabetes patient group and the control group in Example 2. There were 252 patients in the case group and 236 patients in the control group. The difference in methylation levels of DNA methylation sites between the case group and the control group was analyzed using multiple linear regression, correcting for gender, age and body mass index; Figure 3 , the evaluation results of the prediction performance of clinical samples. DETAILED DESCRIPTION

[0042] The embodiments of the present application will be described in detail below in conjunction with the examples, but those skilled in the art will understand that the following examples are only used to illustrate the present application and should not be considered to limit the scope of the present application. If no specific conditions are specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer.

[0043] The following basic terms or definitions are provided only to help understand the application. These definitions should not be construed as having a scope less than that understood by those skilled in the art. Unless defined otherwise hereinafter, the meaning of all technical terms and scientific terms used in the specific embodiments of the application is intended to be the same as that commonly understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the application.

[0044] As used in this application, the terms "comprises", "comprising", "having", "containing" or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0045] When referring to a singular noun an indefinite or definite article e.g. "a" or "an", "the" or "an" is used, this includes a plural of that noun.

[0046] The terms "approximately" and "substantially" in this application represent the accuracy range that can be understood by those skilled in the art to still ensure the technical effect of the feature in question. The term usually represents ±10% deviation from the indicated value, preferably ±5%.

[0047] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0048] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present application. It will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment. Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features, and aspects of the present application are disclosed in or apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0049] The details of this application include at least the following aspects:

[0050] 1. Application

[0051] This application records in the embodiments of the specification that nucleic acid samples were extracted from clinical type 2 diabetes case samples collected in 2022. Through methylation sequencing and statistical tests of sample DNA, the methylation level of the methylation site cg10364040 was screened to have diagnostic potential in type 2 diabetes; then type 2 diabetes cases were collected again the following year, and these samples were used as independent populations to verify whether there was a significant difference between cases and controls in cg06087988. The applicant used the PCR method to detect the methylation level of the cg06087988 site, and used multiple linear regression to correct for gender, age and body mass index. It was found that the DNA methylation site was significantly higher in the case group than in the control group. The average methylation level of the site in the control group was 75.4%, and the average methylation level in the case group was 80.1%. Therefore, it can be confirmed that cg06087988 is a methylation marker for type 2 diabetes.

[0052] Therefore, in various aspects of this application, at least the following applications are provided:

[0053] 1) Application of methylation site CG06087988 as a diagnostic marker for type 2 diabetes;

[0054] 2) Application of methylation site CG06087988 in the diagnosis of type 2 diabetes;

[0055] 3) Use of a detection agent for obtaining the level of methylation site CG06087988 in a subject's sample in the diagnosis of type 2 diabetes;

[0056] 4) Use of a detection agent for obtaining the level of methylation site CG06087988 in a subject's sample in the preparation of a diagnostic product for type 2 diabetes.

[0057] The terms "type 2 diabetes", "type 2 diabetes" and "type 2 diabetes" used in this article are interchangeable and have the same meaning. They refer to a chronic disease caused by insufficient or inefficient use of insulin, which is common in adults and is also called adult-onset diabetes. This disease is caused by a combination of genetics and environmental factors such as lifestyle, overnutrition, and lack of physical activity.

[0058] The term "diagnosis" as used herein refers to the process of identifying a medical condition or disease (such as type 2 diabetes) through its signs, symptoms, and especially the results of various diagnostic processes (including detecting the level of cg06087988 in a biological sample (such as serum) obtained from an individual). Moreover, the term "diagnosis" as used herein includes early prediction of the disease, screening (including early screening), auxiliary diagnosis, diagnosis (determining whether the disease exists), judging the severity of the disease, evaluating the activity of the disease, monitoring treatment, such as monitoring the deterioration or recurrence of the disease during treatment, evaluating the therapeutic efficacy of the disease, and the selection of a given treatment regimen, etc. Without limitation, in some specific embodiments, the present application has fully demonstrated that the level of cg06087988 can be used to determine whether a subject has type 2 diabetes, and can then be used for screening (early screening), auxiliary diagnosis or diagnosis, etc.

[0059] The terms "individual," "subject," "subject," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly a human, in need of diagnosis, treatment, or therapy.

[0060] As used herein, the term "sample", "sample", "test sample", "subject sample" etc. include various sample types obtained from a patient, individual or subject and can be used for diagnosis or monitoring determination. Patient samples can be obtained from healthy subjects, sick patients or patients with type 2 diabetes related symptoms. In addition, the sample obtained from the patient can be divided into parts, and only a part can be used for diagnosis. In addition, the sample or a part thereof can be stored under the condition of keeping the sample for subsequent analysis. This definition specifically includes other liquid samples of blood and biological origin (including but not limited to tissue, cell (such as PMBC cell, T cell, etc.), body fluid, serum, plasma, whole blood, urine, semen, saliva, pleural effusion, ascites, cerebrospinal fluid, feces and synovial fluid, etc.). In a specific embodiment, the sample includes a blood sample. This definition also includes a sample that is manipulated in any way after the sample is obtained, for example, by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washing or enrichment of certain cell colonies. These terms also include clinical samples, and also include cells in culture, cell supernatants, tissue samples, organs, etc.

[0061] In some embodiments of the present application, the detection agent is detected at the nucleic acid level. It is understood that the nucleic acid level may include the DNA level. There are many ways to detect DNA levels in the art, including but not limited to sequencing technology, nucleic acid amplification technology, nucleic acid hybridization technology, electrophoresis technology, biological mass spectrometry technology or chromatography technology, which can be used in the present application, such as including but not limited to any of the following specific methods: gene sequencing, polymerase chain reaction, isothermal amplification reaction, gene chip method, probe hybridization method, gel electrophoresis, Northern blotting, nucleic acid mass spectrometry or liquid chromatography.

[0062] In some specific methods of the present application, gene sequencing is used, specifically using the methylation chip of Illumina; in other specific methods of the present application, polymerase chain reaction is used, specifically using primer F:TAGTTGGGTTGGGGAGTTTAC (SEQ ID NO: 1), primer R:AAAAAAAACAACAAATTCGAT (SEQ ID NO: 2) and primer F:TTTAGTTGGGTTGGGGAGTTTAT (SEQ ID NO: 3) and primer R:AAAAAAAACAACAAATTCAAT (SEQID NO: 4). The specific sequencing method or primer sequence used here is not limited, and can be conventionally selected in the art.

[0063] In addition, according to the experimental data of the present application, the methylation site CG06087988 can be used as an independent indication for the diagnosis of type 2 diabetes, and an effective diagnosis of type 2 diabetes can be achieved based only on the level or degree of CG06087988.

[0064] It is also understandable that in order to further enhance the diagnostic effect of type 2 diabetes, the detected biomarkers can also be other biological materials that can be used as markers, such as nucleic acid fragments, proteins, metabolites, etc., which have diagnostic effects and are known to those skilled in the art. In this way, a combination of multiple biomarkers can be used, and they cooperate with each other to achieve a better diagnostic effect on patients with type 2 diabetes, thereby achieving a more effective diagnostic evaluation. Therefore, in addition to being an independent indication for the diagnosis of type 2 diabetes, the CG10364040 can also be detected in combination with other existing known diagnostic markers to improve the diagnostic efficiency.

[0065] 2. Products

[0066] According to the core diagnostic use of this application, the process for detecting the level of methylation site cg10364040 can be configured into a corresponding product form, and then used for the diagnosis or prediction of type 2 diabetes. The product includes a reagent for detecting the level of methylation site cg10364040. It is understood that such product forms are diverse, including but not limited to kit forms.

[0067] Kit Format

[0068] In some embodiments of the present application, a kit for detecting or analyzing the level of methylation site cg10364040 to achieve type 2 diabetes diagnosis or prediction is also disclosed herein. Such a kit may include a reagent for detecting the level of methylation site cg10364040 and instructions for predicting the disease based on the detected level.

[0069] As mentioned above, when the detection agent is detected at the nucleic acid level, it can be understood that there are many ways of nucleic acid detection in the art, including but not limited to sequencing technology, nucleic acid amplification technology, nucleic acid hybridization technology, electrophoresis technology, biological mass spectrometry technology or chromatography technology, all of which can be used in this application. In some specific embodiments of the present application, it includes but is not limited to any of the following specific methods: gene sequencing, polymerase chain reaction, isothermal amplification reaction, gene chip method, probe hybridization method, gel electrophoresis, Northern blotting, nucleic acid mass spectrometry or liquid chromatography. Therefore, the corresponding reagent or detection reagent can be a primer for the polymerase chain reaction method, or various sequencing methods or panels, etc., without limitation.

[0070] 3. Diagnostic methods

[0071] Methods for diagnosing or predicting type 2 diabetes

[0072] The core of the diagnostic or predictive method of the present application includes the step of detecting the methylation level of the cg10364040 site in the sample.

[0073] In some embodiments, the method specifically includes the steps of detecting the level of methylation site cg10364040 in the sample;

[0074] Furthermore, the method may include the following steps:

[0075] (i) obtaining the level of methylation site cg10364040 in the test sample;

[0076] (ii) compared with a control sample; wherein the significant difference in the level of cg10364040 between the subject sample and the control sample is a possible indication that the subject will suffer from type 2 diabetes in the future, or an indication that the subject suffers from type 2 diabetes, or,

[0077] (ii) comparing with a set threshold absolute amount; wherein, the level of the subject's sample is higher than the threshold absolute amount, which is an indication that the subject may suffer from type 2 diabetes in the future, or an indication that the subject suffers from type 2 diabetes.

[0078] In some embodiments, the diagnosis includes early prediction, screening, auxiliary diagnosis, diagnosis (determining whether the disease exists), determining the severity of the disease, assessing disease activity, monitoring treatment, etc.; in some preferred embodiments, the diagnosis includes early prediction, early screening and diagnosis.

[0079] It is understandable that the control sample can be selected according to actual needs. For example, in early screening or diagnosis of a disease, the control sample is a sample from a normal population; when used for prognosis assessment, it can be a control sample of different prognostic conditions.

[0080] In some specific embodiments, for example, subjects with a high degree of methylation of cg06087988 generally have a higher risk of developing type 2 diabetes; in a specific embodiment, another set value of the methylation level of cg10364040 can be given, and the set value can be determined based on the methylation level of cg10364040 in normal people and / or normal samples without cancer, for example, the average value of the methylation level of cg10364040 of normal samples of a suitable number of samples is selected, or a reasonable multiple is set based on the average value, such as 0.9 times, 0.8 times, 0.7 times, 0.6 times, 0.5 times, etc. When the methylation level of cg10364040 of the subject is higher than the set value, it is judged to be type 2 diabetes. It can be understood that the set value determined based on the average value or the multiple of the average value needs to have good classification significance, and the known samples can be tested by using a commonly used statistical test method through the classification based on the set value. When the result is statistically significant, it indicates that the set value can be used as a judgment standard.

[0081] The implementation scheme of the present application is described in detail below with reference to examples.

[0082] Example 1 Collection of clinical samples to screen for type 2 diabetes methylation markers

[0083] 1. Materials and methods

[0084] 1.1 Research subjects

[0085] This study included 223 type 2 diabetes cases and 204 controls from multiple hospitals in Guangzhou, and these individuals were recruited from January to December 2022.

[0086] The diagnostic criteria for recruited type 2 diabetes cases are: fasting blood glucose higher than 7.0mmol / L; or blood glucose values ​​measured at any time of the day higher than 11.1mmol / L and combined with typical diabetes symptoms. Controls are healthy individuals with normal blood sugar. The population information used in this study can be found in Table 1 below. There is no significant difference in gender and age between cases and controls. Peripheral blood was collected from the above individuals and DNA was extracted.

[0087] Table 1. Population information used for genome-wide association studies

[0088] Classification Cases (n=223) Control (n=204) Age, years Mean(Standard Deviation) 57.2(13.2) 56.8(12.9) <60，n(％) 118(52.9) 109(53.4) ≥60，n(％) 105(47.1) 95(46.5) Gender, n (%) male 115(51.6) 101(49.5) female 108(48.4) 103(50.5)

[0089] 1.2 DNA methylation detection and quality control

[0090] Illumina's Infinium MethylationEPIC BeadChip (850k chip) was used to detect 850,000 DNA methylation sites in the whole genome.

[0091] Quality control is divided into sample quality control and methylation site quality control

[0092] Sample quality control was performed as follows: Initial quality control of sample data was performed using GenomeStudio software, methylation module (version 1.9.0), to determine staining, extension, hybridization, target removal, bisulfite conversion, specificity, non-polymorphic, and negative controls (no background correction or normalization). Only samples with detection rates exceeding 95% were subsequently retained.

[0093] The quality control of methylation sites was as follows: First, DNA methylation sites with signal values ​​below 3 in at least 5% of the samples were excluded. Then, the wateRmelon R package was used to calculate and remove CpG sites with a P value > 0.05 accounting for more than 1% of the total number of samples. To avoid the influence of single nucleotide polymorphisms on DNA methylation measurement and gender bias, if the single nucleotide polymorphism exists in the probe and on the CpG site, then this CpG site will be removed. In addition, probes for non-CpG sites and sex chromosome probes were also removed.

[0094] 1.3 Statistical tests

[0095] The difference in methylation levels of DNA methylation sites between the case group and the control group was analyzed using multiple linear regression, correcting for gender, age, and body mass index. P values ​​were expressed as 1×10 -4 as a genome-wide significance threshold.

[0096] 2. Results and statistics

[0097] After the above screening process, 733,252 CpG sites were retained. Using multiple linear regression, correcting for gender, age, and body mass index, a series of DNA methylation sites significantly associated with type 2 diabetes were identified (P < 1 × 10 -4 ), among which cg06087988 deserves attention. The DNA methylation site in the case group was significantly higher than that in the control group (P = 1.4 × 10 -5 For details, please refer to the attached Figure 1 The average methylation level of this site in the control group was 77.6%, and the average methylation level in the case group was 83.0%, with a difference of >5%.

[0098] The above results suggest that cg06087988 is a candidate peripheral blood DNA methylation marker associated with type 2 diabetes.

[0099] Example 2: Collection of clinical samples to verify type 2 diabetes methylation markers

[0100] 1. Materials and methods

[0101] 1.1 Research subjects

[0102] The validation study included 252 type 2 diabetes cases and 236 controls recruited and collected by Guangzhou Hospital. The case individuals were recruited from January to December 2023.

[0103] The diagnostic criteria for the corresponding cases are: fasting blood glucose higher than 7.0mmol / L; or blood glucose values ​​measured at any time of the day higher than 11.1mmol / L and combined with typical symptoms of diabetes. The controls are healthy individuals with normal blood glucose. The population information used in this study can be found in Table 2. Peripheral blood was collected from the above individuals and DNA was extracted. These samples were used as an independent population to verify whether cg06087988 was significantly different between cases and controls.

[0104] Table 2. Population information table used for verification phase

[0105] Classification Cases (n=252) Control (n=236) Age, years Mean(Standard Deviation) 55.6(9.6) 56.6(11.1) <60，n(％) 141(56.0) 127(53.8) ≥60，n(％) 111(44.0) 109(46.2) Gender, n (%) male 128(50.8) 121(51.3) female 124(49.2) 115(48.7)

[0106] 1.2 DNA methylation detection

[0107] During the verification process, the applicant used a methylation-specific PCR method to detect the methylation level of the cg06087988 site.

[0108] First, the DNA was treated with sodium sulfite, desulfurized and purified using a reaction column, and the purified DNA was used for subsequent PCR reactions. Methylated and unmethylated primers were designed for the cg06087988 site. Among them, the unmethylated primer pair: TAGTTGGGTTGGGGAGTTTAC (SEQ ID NO: 1) and AAAAAAAACAACAAATTCGAT (SEQ ID NO: 2). SEQ ID NO: 1 is a forward primer, and SEQ ID NO: 2 is a backward primer. The methylated primer pair: TTTAGTTGGGTTGGGGAGTTTAT (SEQ ID NO: 3) and AAAAAAAACAACAAATTCAAT (SEQ ID NO: 4). SEQID NO: 3 is a forward primer, and SEQ ID NO: 4 is a backward primer. Finally, a PCR reaction was performed.

[0109] 1.3 Statistical tests

[0110] The difference in methylation levels of DNA methylation sites between the case group and the control group was analyzed using multiple linear regression, correcting for gender, age, and body mass index. The P value was set at 0.05 as the significant threshold.

[0111] 2. Experimental results

[0112] To verify whether there is a significant difference in cg06087988 between diabetic cases and controls, the applicant used a methylation-specific PCR method to detect the methylation level of the cg06087988 site. The statistical results showed that the DNA methylation site in the case group was also significantly higher than that in the control group (P = 2.7 × 10 -4 , see attached Figure 2 ). The average methylation level of this site in the control group was 75.4%, and the average methylation level in the case group was 80.1%. The validation results were statistically significant, confirming that cg06087988 is a peripheral blood DNA methylation marker associated with type 2 diabetes and can be used to distinguish between patients with and without type 2 diabetes.

[0113] Example 3: Combined clinical samples to evaluate prediction performance

[0114] 1. Materials and methods

[0115] 1.1 Research subjects

[0116] A total of 915 samples were included in Example 1 and Example 2, including 475 cases of type 2 diabetes and 440 cases of control group. Specific information of the research subjects is described in Example 1 and Example 2.

[0117] 1.2 Statistical tests

[0118] The receiver operator characteristic curve (ROC curve) was plotted and the area under the curve (AUC) was calculated using the “pROC” package in R.

[0119] 2. Experimental results

[0120] All samples of the research subjects have completed the detection of cg06087988 methylation status, and the β value is used to characterize the methylation level. In order to study the performance of cg06087988 methylation level in predicting type 2 diabetes, the applicant draws the ROC curve and calculates the AUC.

[0121] It can be seen (see Appendix Figure 3 ), for all samples, cg06087988 was used to predict type 2 diabetes, and the AUC value was 0.631, indicating that the methylation level of cg06087988 used in this study can be used to predict type 2 diabetes (and currently there are few methods that can effectively predict type 2 diabetes based on a single methylation site). In addition, to determine the optimal diagnostic limit, the applicant also used the "pROC" package to calculate the optimal cutoff value, and the result was 0.752, suggesting that when the cutoff value is selected as 0.752, positive samples can be more effectively identified and negative samples can be avoided from being misjudged as positive.

[0122] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application is described in detail with reference to the above embodiments, a person skilled in the art should understand that the technical solutions described in the above embodiments can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. Use of a detection agent for obtaining the level of methylation sites in a sample in the preparation of a diagnostic or predictive product for type 2 diabetes, or in the diagnosis or prediction of type 2 diabetes.

2. The use according to claim 1, characterized in that: The methylation site is the methylation site cg06087988.

3. The use according to claim 1, characterized in that: The detection agent is used for detection at the nucleic acid level; preferably, the detection agent is used to perform any of the following methods: nucleic acid sequencing, polymerase chain reaction, denaturing gradient gel electrophoresis, nucleic acid typing chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry and HRM method.

4. The use according to any one of claims 1 to 3, characterized in that: The sample is selected from at least one of blood, serum, plasma, tissue or tissue lysate, urine or saliva; preferably, the sample is selected from blood, serum or plasma.

5. A DNA methylation marker for detecting type 2 diabetes, characterized in that: The DNA methylation marker is the DNA methylation site cg06087988.

6. A product for diagnosing or predicting type 2 diabetes, characterized in that: The product comprises a reagent for detecting the level of methylation site CG06087988; preferably, the product is a kit.

7. Application of methylation site CG06087988 as a diagnostic marker for type 2 diabetes.

8. A method for evaluating or screening candidate predictive markers for type 2 diabetes, characterized in that: The method comprises the step of performing correlation or consistency analysis on the potential biomarker and the methylation site CG06087988; preferably, when there is a positive correlation between the potential biomarker and the methylation site CG06087988, it indicates that the potential biomarker can be used as a candidate predictive marker.

9. A method for diagnosing type 2 diabetes, characterized in that: The method includes the steps of detecting the level of methylation site cg10364040 in a sample; Preferably, the method comprises the following steps: (i) obtaining the level of methylation site cg10364040 in the test sample; (ii) compared with a control sample; wherein the significant difference in the level of cg10364040 between the subject sample and the control sample is a possible indication that the subject will suffer from type 2 diabetes in the future, or an indication that the subject suffers from type 2 diabetes, or, (ii) comparing with a set threshold absolute amount; wherein, the level of the subject's sample is higher than the threshold absolute amount, which is an indication that the subject may suffer from type 2 diabetes in the future, or an indication that the subject suffers from type 2 diabetes.

10. A method for detecting markers in a subject suffering from or suspected of suffering from type 2 diabetes in vivo or in vitro, characterized in that, The method includes determining or detecting the level of methylation site cg10364040 in a sample from a subject.

Images