Molecular marker for detecting wheat pre-harvest germination resistance and application

Abstract

The invention relates to the technical field of biology, and particularly provides a molecular marker for detecting wheat pre-harvest sprouting resistance and application of the molecular marker. Genotype data are obtained by utilizing a Wheat55K wheat high-throughput gene chip, a QTL locus Qphs.caas-3DS related to the pre-harvest germination resistance and derived from a resistant material is detected, and a KASP marker and a detection primer group thereof are developed and are used for efficiently screening the pre-harvest germination resistance. The primer group is used for performing PCR amplification on wheat genome DNA, whether the pre-harvest sprouting resistance gene is carried or not can be directly judged through KASP typing, the detection method is easy to operate, the detection result is very visual, and the detection effect is obvious and effective; when the molecular marker is used for screening, the working efficiency of molecular marker-assisted selection of wheat breeding with pre-harvest sprouting resistance can be greatly improved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a molecular marker for detecting wheat ear germination resistance and an application thereof. Background Art

[0002] Pre-harvest Sprouting (PHS) refers to the phenomenon that mature but unharvested grains sprout on the mother plant due to high humidity in the late stage of wheat growth. It is a global natural disaster. Major wheat producing countries such as France, the United States, Canada, and Australia have suffered from spike sprouting to varying degrees. Australia is the most serious, with spike sprouting in 20% of the area in 1984. In recent years, with global warming and frequent extreme weather, several wheat areas in my country, such as the Yangtze River Basin, the Northeast Spring Wheat Area, and the Northern Winter Wheat Area, have also suffered from spike sprouting to varying degrees. The wheat areas affected by spike sprouting account for about 83% of the total wheat area in the country. In 1992, wheat spike sprouting in the Guanzhong region of Shaanxi alone caused a production reduction of more than 4 million tons, with direct economic losses of 260 million yuan. In 2009, about 205,300 hm2 of wheat in Xiangyang City, Hubei Province alone was damaged. 2 Wheat spike sprouts account for 66% of the local wheat harvest area, and the quality of about 1.2 billion kg of wheat has deteriorated. The wheat spike sprout damage in Jiangsu, Sichuan, Henan and other provinces in 2016 and 2018 also caused serious wheat production reductions. The sprouted wheat is easy to deteriorate, which will cause the starch molecules in the flour to degrade and hydrolyze, leading to the release and increase of glucose concentration, which can easily induce drastic fluctuations and increases in blood sugar, which is harmful to human health and can easily cause the growth of mold and bacteria, thus causing food safety problems. In addition, the enzymes in sprouted wheat will also destroy starch molecules, making the powder sticky, which is not conducive to food processing and production. Therefore, cultivating and planting wheat varieties that are resistant to spike sprouting is the most economical and effective way.

[0003] Wheat spike sprouting is a quantitative trait regulated by multiple genes. At present, 60 QTLs related to spike sprouting resistance have been reported. Many studies have located spike sprouting-related QTLs on 21 chromosomes of wheat through different genetic mapping populations, mainly on the third and fourth homologous chromosome groups. In common wheat, except for chromosome 1D, genes related to spike sprouting resistance have been identified on other chromosomes. With the support of genomic technology and molecular biology, the positioning and identification of wheat spike sprouting resistance genes are constantly deepening, providing new scientific basis and methods for breeding wheat varieties with higher resistance levels. At present, 8 wheat spike sprouting resistance genes have been identified by map-based cloning or homologous cloning methods, including TaMFT-3A, TaVP-1, TaMKK3, PM19-A1, PM19-A2, Tasdr, TaDFR and Tamyb10 genes. In the past few decades, we have generally improved the agronomic traits of wheat based on traditional breeding methods. Although some progress has been made, this method is time-consuming and laborious, especially for quantitative traits that are easily affected by the environment. Wheat ear sprout resistance is a complex quantitative trait controlled by multiple genes. Simple phenotypic screening is easily affected by environmental conditions and has low selection efficiency. Therefore, for this type of trait, combining certain molecular marker-assisted selection to explore new ear sprout resistance genes (QTLs) and develop molecular markers can greatly improve the selection efficiency of traditional breeding and shorten the breeding process, which is of great significance to wheat breeding.

[0004] Genome-wide association analysis (GWAS) is a method of identifying and genotyping target traits in the whole genome, using statistical methods to detect the association between the two, so as to achieve the purpose of identifying genes and locating genes. It has been widely used in the genetic study of quantitative traits of various crops such as wheat, rice and corn. The principle is to perform association analysis between molecular data and phenotypic traits based on mixed linear models (MLM), and calculate the linear regression relationship between genotype and phenotype by using principal component analysis (PCA) and kinship matrix (K) as covariates. With the continuous development of high-throughput SNP marker typing technology and high-throughput sequencing technology, the cost of wheat genotyping has gradually decreased. At the same time, the gradual improvement of the phenotypic identification system has promoted the phenotypic data to be more and more accurate. Whole genome association analysis (GWAS) is increasingly widely used in the genetic study of various complex traits of wheat, such as spike germination, spike germination, stripe rust, yield and quality. By obtaining individual genotype data and many years of phenotypic data, this analysis method can be used to identify a large number of related genes / QTLs that control complex traits, and has become an important tool in the study of crop genetic improvement.

[0005] Molecular marker-assisted breeding has accelerated the progress of traditional breeding. Single nucleotide polymorphisms (SNPs) are caused by the replacement, deletion or addition of a single base pair in the genome, thereby changing the base sequence and causing DNA sequence polymorphism. SNPs are widely distributed in the genome and have high stability. With the rapid development of molecular biology technology, they have higher use value and greater development space, and people can use them for molecular marker-assisted selection. Therefore, the competitive allele-specific PCR (kompetitive allele specific PCR, KASP) technology used to detect SNPs has shown good development prospects, mainly because the KASP marker has the advantages of high throughput, high stability and high accuracy. At present, the KASP marker technology is very mature and is widely used in wheat genetic breeding. Summary of the invention

[0006] The purpose of the present invention is to overcome the defects in the prior art and provide a molecular marker for detecting the anti-ear sprouting QTL Qphs.caas-3DS and its application. The present invention uses the Wheat55K wheat high-throughput gene chip to obtain genotype data, and detects a stable QTL site Qphs.caas-3DS related to ear sprouting resistance in combination with 331 natural population phenotypic data, and accordingly develops a KASP marker and primer set for efficient screening of ear sprouting resistance.

[0007] In one aspect, the present invention provides a KASP molecular marker that is associated with a stable QTL Qphs.caas-3DS for wheat ear sprouting resistance, and the nucleotide sequence of the KASP molecular marker is shown in SEQ ID No.4.

[0008] On the other hand, the present invention provides a primer set for detecting whether the 25th allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C, the primer set comprising two upstream primers and one downstream primer;

[0009] The upstream primer is designed according to the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is T, and the 3' terminal deoxyribonucleotide of the other upstream primer is G;

[0010] The downstream primer is designed according to the downstream sequence of the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome.

[0011] Furthermore, the nucleotide sequence of one of the upstream primers is shown as SEQ ID No.1, the nucleotide sequence of another upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.3.

[0012] Furthermore, the 5' end of one of the upstream primers is connected to a fluorescent label sequence FAM, and the 5' end of the other upstream primer is connected to a fluorescent label sequence HEX.

[0013] The substance for detecting the molecular marker of wheat ear sprouting resistance also belongs to the protection scope of the present invention.

[0014] The substance for detecting the molecular marker of wheat ear sprouting resistance can be a kit.

[0015] The DNA molecule shown in SEQ ID No. 4 also falls within the protection scope of the present invention.

[0016] The present invention also provides any of the following uses of the wheat ear sprout resistance molecular marker or the DNA molecule shown in SEQ ID No.4:

[0017] X1) Detecting or assisting in detecting wheat ear sprout resistance;

[0018] X2) Compare the ear sprout resistance of different wheat varieties;

[0019] X3) Breeding wheat with strong resistance to ear sprouting;

[0020] X4) Screening or eliminating wheat with weak ear sprout resistance;

[0021] X5) Wheat breeding.

[0022] The present invention also provides any of the following applications of the substance for detecting the molecular marker of wheat ear sprouting resistance:

[0023] Y1) preparing a product for detecting or assisting in detecting wheat ear germination resistance;

[0024] Y2) Compare the ear sprout resistance of different wheat varieties;

[0025] Y3) preparing a product for comparing the ear sprout resistance of different wheats;

[0026] Y4) Breeding wheat with strong ear sprout resistance;

[0027] Y5) preparing a product for breeding wheat with strong ear sprouting resistance;

[0028] Y6) Screening or eliminating wheat with weak ear sprout resistance;

[0029] Y7) preparing a product for screening or removing wheat with weak ear sprouting resistance;

[0030] Y8) Wheat breeding.

[0031] On the other hand, the present invention also provides any of the following methods:

[0032] Method A: A method for detecting whether the 25th allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C, comprising the following steps (A1) or (A2):

[0033] (A1) Direct sequencing;

[0034] (A2) using the primer set or kit to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanning data, and then determining whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat gene to be tested is AA, CC, or A and C as follows:

[0035] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the genome of the wheat to be tested is a homozygous C;

[0036] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as blue, then the 25th deoxyribonucleotide in the nucleotide sequence shown in chromosome 3D SEQ ID No. 4 in the genome of the wheat to be tested is a homozygous A;

[0037] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as green, then the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the genome of the wheat to be tested is a hybrid of A and C;

[0038] Method B: A method for comparing the germination resistance of wheat spikes to be tested, comprising the following steps:

[0039] (B1) detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C;

[0040] (B2) Determine the wheat spike sprout resistance as follows: SEQ ID No. 4 on chromosome 3D in the genome

[0041] The ear sprouting resistance of the wheat to be tested in which the 25th deoxyribonucleotide in the nucleotide sequence is C is stronger than the ear sprouting resistance of the wheat to be tested in which the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 3D in the genome is A or a heterozygote of A and C;

[0042] Method C: A method for breeding or screening wheat plants, strains, lines or varieties with relatively strong ear sprouting resistance, comprising the following steps:

[0043] (C1) detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C;

[0044] (C2) selecting a wheat plant to be tested in which the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the genome is C as a parent for breeding, and selecting a wheat plant in which the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the genome is C in each breeding generation, and finally obtaining a wheat plant or plant line or strain or variety with relatively strong ear germination;

[0045] Method D: A method for breeding or screening wheat plants, strains, lines or varieties with relatively weak ear sprouting resistance, comprising the following steps:

[0046] (D1) detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C;

[0047] (D2) selecting a wheat plant to be tested that is homozygous for A at the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 3D in the genome as a parent for breeding, and selecting wheat plants that are homozygous for A at the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 3D in the genome in each breeding generation, and ultimately obtaining wheat plants, lines, varieties or varieties with relatively weak ear sprouting resistance.

[0048] Furthermore, in the method B, the method C and the method D, the method for detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C is the method A.

[0049] On the other hand, the present invention also provides the use of the primer set or the method in wheat molecular marker-assisted breeding.

[0050] Beneficial effects of the present invention:

[0051] The present invention uses the Wheat55K wheat high-throughput gene chip to obtain genotype data, detects a major QTL site Qphs.caas-3DS related to ear sprouting resistance from a disease-resistant variety on the 3D chromosome, and further develops a KASP marker and a special primer set KASP-3DS-Phs. Experiments have shown that the KASP molecular marker of the present invention can be used for molecular marker-assisted selection breeding of the major QTL Qphs.caas-3DS of wheat ear sprouting resistance. The present invention provides a good tool for the effective use of the QTL site Qphs.caas-3DS for ear sprouting resistance in breeding. This marker can quickly screen wheat ear sprouting resistance, provide convenience for screening wheat materials carrying excellent allelic variations, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 Manhattan plot of association analysis for 331 wheat varieties based on 55K microarray.

[0053] Figure 2 This is a quantile plot (QQ plot) of 331 wheat varieties based on 55K chip association analysis.

[0054] Figure 3 The results of the KASP marker amplification test for the spike sprout resistance genotypes of 331 varieties and 63 wheat lines in Example 1 and Example 2 were verified. DETAILED DESCRIPTION

[0055] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0056] Example 1 Screening for stable SNP loci significantly associated with ear sprouting resistance

[0057] 1. Acquisition of phenotypic data

[0058] This example uses 331 main wheat varieties cultivated from 1964 to 2020 as materials, including 20 varieties in the northern wheat region, 263 varieties in the Huanghuai winter wheat region, 29 varieties in the middle and lower reaches of the Yangtze River winter wheat region, 17 varieties in the southwest winter wheat region, and 2 varieties introduced from abroad. The natural population was planted at the Xinxiang Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences in the three wheat growing seasons of 2018-2019, 2019-2020, and 2020-2021. Each material was planted in 2 rows, with a row length of 2m and a row width of 0.2m. Before sowing, apply compound fertilizer equivalent to 200kg hm of pure N -2 , P2O5 191 kg hm -2 and K2O 41kg hm -2 . Other field management is carried out in accordance with local field production management. All materials are sampled at the physiological maturity of wheat (about 35 days after flowering), then naturally air-dried and threshed. The threshed seeds are stored in a -20℃ freezer for later use. Place two sterile filter papers or germination papers in a sterile culture dish and add an appropriate amount of distilled water. Rinse the seeds disinfected with 5% sodium hypochlorite solution with distilled water 3 to 5 times, then count 50 seeds and place them neatly on the filter paper with the ventral groove facing down, and place them in an incubator or indoors at 25℃ for incubation, keeping the filter paper moist during the period. Count the germinated grains every day and pick out the germinated seeds. The germination index is calculated using the following formula:

[0059] Germination index = [(7 × n1 + 6 × n2 + 5 × n3 + 4 × n4 + 3 × n5 + 2 × n6 + 1 × n7) / (7 × N)] × 100%, where n1, n2 ... n7 are the number of seeds germinated every day from the 1st day to the 7th day, and N represents the total number of seeds used for germination. The experiment was repeated 3 times.

[0060] 2. Genome-wide association analysis

[0061] Genomic DNA was extracted by PVP-40 method, and wheat 55K SNP chip typing was completed by Beijing Zhongyujin Marker Biotechnology Co., Ltd. The chip contains 53063 single nucleotide polymorphism (SNP) sites. Genotyping analysis was performed using AffymetriAxiom software. The physical position of SNPs was referenced to the Chinese Spring reference genome IWGSCRefSeqv1.0 data. SNP markers with missing data exceeding 20% ​​and a minimum allele frequency of less than 5% were not used for subsequent analysis. GWAS analysis of the MLM model was performed using Tassel software with principal component analysis (PCA) and kinship matrix (K) as covariates. In the results, markers with -log10(p)>3 were considered to be important markers significantly associated with the phenotype.

[0062] The experiment obtained a relatively stable locus Qphs.caas-3DS related to ear sprouting resistance, which can explain 3.77-4.61% of the phenotypic variation.

[0063] Table 1 Stable anti-ear sprouting sites

[0064]

[0065] 3. Design and use of KASP primers

[0066] 1. Design of KASP primers

[0067] like Figure 1 and Figure 2 As shown, the present application locates a significant SNP site Qphs.caas-3DS associated with ear sprouting resistance through association analysis (GWAS), located at 5.41Mb of the wheat reference genome (3D chromosome) Chinese Spring RefSeq v1.0 (reference genome website

[0068] https: / / urgi.versailles.inra.fr / blast_iwgsc / ). The KASP marker primer sequence was designed according to the antisense strand of the SNP site, and the KASP primer was designed using Polymarker (http: / / polymarker.tgac.ac.uk / ). The primer was synthesized by Sangon Biotech Co., Ltd. Finally, it was successfully transformed into the KASP marker KASP-3DS-Phs, and its corresponding mutation site was A / C, which is the 25th position in the nucleotide sequence shown in SEQ ID No.4. The specific nucleotide sequence is:

[0069] GTCTGTTCATTTCTAACCATGCAT[Y]GACCGTGTATTTTCATGTGCACCAAC ATACCTGGTAAGTCTTTCTCCAGAATTTTCCATTCCTTTTGCACCGTTTTGG CCCAACTCTTCCCTCGACTAGCGCCTTGCATTTCCTTGAAAAAGAGAGGAT TGATTGAAGTTCTACATTTAG (Y represents A / C).

[0070] In this embodiment, a KASP-3DS-Phs primer set is designed for the SNP site. The primer set includes an upstream primer with a nucleotide sequence F1: 5'-GAAGGTGACCAAGTTCATGCTGTCTGTTCATTTCTAACCATGCATT-3'

[0071] (SEQ ID No.1); the nucleotide sequence of another upstream primer F2: 5'-GAAGGTCGGAGTCAACGGATTGTCTGTTCATTTCTAACCATGCATG-3' (SEQ ID No.2); the shared downstream primer nucleotide sequence R: 5'-TCCTCTCTTTTTCAAGGAAATGCAA-3' (SEQ ID No.3). At the same time, the 5' end of the upstream primer SEQ ID No.1 is connected to the fluorescent label sequence FAM, and the 5' end of the other upstream primer SEQ ID No.2 is connected to the fluorescent label sequence HEX. The 3' end of the upstream primer is the allelic variant base T / G of the site, and the downstream primer ensures the 3D chromosome specificity of PCR amplification.

[0072] 2. Establishment of KASP detection method

[0073] The principle of KASP: two forward competitive primers (the 5' end of the primer has a base sequence that is complementary to the fluorescent groups HEX and FAM, and the other sequences differ only at the SNP at the 3' end) and a reverse common primer; the PCR reaction system contains a universal sequence modified with fluorescent groups and quenching groups (MasterMix provided by LGC). The two forward primers can emit two different colors of light. If the site is homozygous, a single fluorescence is emitted, and if it is heterozygous, two fluorescences can be emitted simultaneously. KASP amplification is performed on a Bio-RAD C1000 Thermal CyclerPCR instrument (Bio-Rad, Hercules, USA). The reaction system is 5μL, including 2μL DNA template (50-100ngμL –1 ), 2.5μL 2×KASP MasterMix, Primer Mix0.056μL and Mg 2+ 0.004 μL. The KASP amplification program was 94°C pre-denaturation for 15 min, 94°C denaturation for 20 s, 65-57°C (Touch-down) annealing for 1 min, 10 cycles, 94°C extension for 20 s, 57°C post-extension for 1 min, 30 cycles. After the reaction was completed, the final fluorescence data was read using a Fluostar Omega fluorescence scanner (BMG Labtech, Durham, NC, USA), and then the data was imported into Klustercallerv3.4 (LGC, Hoddesdon, UK) for genotyping.

[0074] For KASP-3DS-Phs marker: if the fluorescence signal data of the amplified product is close to the Y-axis (FAM fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is CC homozygous; if the fluorescence signal data of the amplified product is close to the X-axis (HEX fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is AA homozygous; if the fluorescence signal data of the amplified product is located between the X-axis and the Y-axis (with both FAM and HEX signals) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is AC heterozygous.

[0075] 3. KASP detection:

[0076] The experimental material is a genetic population constructed by hybridizing the susceptible wheat variety Lunxuan 13 with the resistant wheat variety Lunxuan 061 through single seed transmission, and the genetic population includes 199 F5RIL families. See Table 2 for details.

[0077] 199 RIL families were planted in the 2021-2022 growing season at the Xinxiang Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Each material was planted in 2 rows, with a row length of 2m and a row width of 0.2m. Before sowing, compound fertilizer equivalent to pure N 200kg hm -2 , P2O5 191 kg hm -2 and K2O 41kg hm -2 (Zhang et al. 2020). Other field management was carried out in accordance with local field production management.

[0078] Samples were taken at the physiological maturity of wheat (about 35 days after flowering) to evaluate the spike germination phenotype and obtain phenotypic data. The genomic DNA of all experimental materials was extracted and used as a template to detect the KASP primers designed in step 2. For specific operations, see step 2. The results are shown in Tables 2 and Figure 3 Among the 199 RIL families, 92 families were CC homozygous, 93 families were AA homozygous, and 14 families were AC heterozygous. The average spike germination index of CC homozygous wheat materials was 4.93% lower than that of AA homozygous wheat materials. The spike germination index of the two homozygous genotypes was significantly different at the 0.001 level (Table 3), indicating that the KASP-3DS-Phs marker of the present invention is related to wheat spike germination resistance.

[0079] Table 2 Qphs.caas-3DS229 RIL families

[0080]

[0081]

[0082]

[0083]

[0084]

[0085] Table 3. T test results of spike germination index of two homozygous genotypes carrying Qphs.caas-3DS locus

[0086]

[0087] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of a substance for detecting molecular markers of wheat ear sprouting resistance in detecting or assisting in detecting wheat ear sprouting resistance; The wheat spike sprouting resistance molecular marker is the nucleotide at position 25 on the wheat chromosome 3D corresponding to SEQ ID No. 4 in the sequence list, which is A or C.

2. The use according to claim 1, characterized in that: The substance for detecting the molecular marker of wheat ear sprouting resistance comprises: a primer set capable of amplifying the DNA fragment shown at position 25 of SEQ ID No. 4 in the sequence table.

3. The use according to claim 2, characterized in that: The primer set consists of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 is a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of SEQ ID No.1, the upstream primer F2 is a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of SEQ ID No.2, and the downstream primer R is a single-stranded DNA whose nucleotide sequence is SEQ ID No.

3.

4. The use according to claim 3, characterized in that: The upstream primer F1 is a single-stranded DNA with a nucleotide sequence of SEQ ID No.1, and the upstream primer F2 is a single-stranded DNA with a nucleotide sequence of SEQ ID No.

2.

5. A method for detecting wheat ear germination resistance, comprising: The nucleotide at position 25 corresponding to SEQ ID No.4 in the sequence list is detected in the genomic DNA of the wheat to be tested. The ear sprouting resistance of the homozygous wheat to be tested whose nucleotide at position 25 corresponding to SEQ ID No.4 in the sequence list is C is higher than or has a candidate higher resistance than that of the homozygous wheat to be tested whose nucleotide at position 25 corresponding to SEQ ID No.4 in the sequence list is A.

6. The method according to claim 5, characterized in that: The nucleotide at position 25 corresponding to SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested is detected using the substance for detecting the wheat ear sprouting resistance molecular marker as claimed in any one of claims 1 to 4.

7. The substance for detecting the wheat ear sprouting resistance molecular marker according to any one of claims 1 to 4, or the DNA molecule shown in SEQ ID No.

4.

8. Any of the following uses of the wheat spike sprout resistance molecular marker of claim 1 or the DNA molecule shown in SEQ ID No. 4: X1) Detecting or assisting in detecting wheat ear sprout resistance; X2) Compare the ear sprout resistance of different wheat varieties; X3) Breeding wheat with strong resistance to ear sprouting; X4) Screening or eliminating wheat with weak ear sprout resistance; X5) Wheat breeding.

9. Any of the following uses of the substance for detecting the molecular marker of wheat ear sprouting resistance according to any one of claims 1 to 4: Y1) preparing a product for detecting or assisting in detecting wheat ear germination resistance; Y2) Compare the ear sprout resistance of different wheat varieties; Y3) preparing a product for comparing the ear sprout resistance of different wheats; Y4) Breeding wheat with strong ear sprout resistance; Y5) preparing a product for breeding wheat with strong ear sprouting resistance; Y6) Screening or eliminating wheat with weak ear sprout resistance; Y7) preparing a product for screening or removing wheat with weak ear sprouting resistance; Y8) Wheat breeding.

10. A wheat breeding method comprising: The nucleotide at position 25 corresponding to SEQ ID No. 4 in the sequence list is detected in the wheat genomic DNA, and the homozygous or heterozygous wheat whose genomic DNA is C and whose genomic DNA is C in the sequence list is selected as a parent for breeding. The homozygous wheat whose genomic DNA is C and whose genomic DNA is C in the sequence list is screened in the offspring to obtain wheat with ear sprout resistance.

Images