Whole genome sequence-based molecular marker of wheat stripe rust SNP homozygous site and application thereof

Abstract

The invention discloses a molecular marker of a wheat stripe rust SNP homozygous site based on a whole genome sequence and application of the molecular marker. According to the invention, genomic sequences of 28 wheat stripe rust strains in the world are analyzed and compared with a reference genome, so that more than millions of SNP loci are mined. And through sequencing depth screening, linkage imbalance analysis and heterozygosity detection, 1076 SNP homozygous sites are identified. Furthermore, 37 core SNP markers are finally determined on the basis of secondary allele frequency, deletion rate and screening of adjacent simple repetitive sequences. The KASP-SNP molecular marker is developed by carrying out primer design on the SNP sites and adding a fluorescent linker, and can be used for carrying out accurate genotyping identification on a wheat stripe rust colony. The molecular marker developed on the basis of a global wheat stripe rust whole genome is suitable for wheat stripe rust population research in all regions in the world. On the basis of molecular marker development of a homozygous site, polymorphism difference caused by a heterozygous site can be effectively eliminated, and the accuracy of the detection site is ensured. The KASP-SNP molecular marker has high polymorphism, good repeatability and high detection efficiency, and can be widely applied to genetic research of wheat stripe rust colony.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and specifically relates to a molecular marker of a wheat stripe rust SNP homozygous site based on a whole genome sequence and an application thereof. Background Art

[0002] Wheat stripe rust is a catastrophic disease caused by Puccinia streakinensis that harms wheat production and food security. In epidemic years, the disease can cause a wheat yield reduction of more than 40%, or even a total crop failure. Wheat stripe rust has the characteristics of rapid subspecies variation, high epidemic frequency, rapid epidemic speed, large-scale outbreaks, and severe losses. Identifying the genotype of wheat stripe rust populations can monitor the population structure and dynamic changes of wheat stripe rust, clarify the communication and transmission relationship of wheat stripe rust in different regions, and provide a theoretical basis for the precise prevention and control of wheat stripe rust.

[0003] SNP stands for single nucleotide polymorphism. SNP molecular marker refers to a genetic marker formed by utilizing a single nucleotide variation in the genome. It has the characteristics of wide distribution in the genome, high stability, and rich polymorphism. It is widely used in molecular assisted breeding, germplasm resource identification, species population structure analysis, etc.

[0004] At present, the existing wheat stripe rust SNP markers were not developed using the reference genome spliced ​​to the chromosome level, resulting in inaccurate site information; the stripe rust genome used when detecting variant sites is limited, and the differences between stripe rust in different regions of the world are not fully considered; at the same time, the homozygosity of the site is not considered in the development of existing wheat stripe rust SNP markers, and the identified differential sites may be caused by the heterozygosity of the stripe rust itself.

[0005] Therefore, we used the stripe rust genome spliced ​​to the chromosome level as a reference genome and used the stripe rust genome sequences from different regions around the world to develop a set of molecular markers for SNP homozygous sites based on the whole genome sequence. These markers were then applied to the study of wheat stripe rust population genetics, which plays an important role in monitoring the dynamic changes of wheat stripe rust populations, analyzing population structure, and studying population genetic exchange relationships. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker of a wheat stripe rust SNP homozygous site based on a whole genome sequence and its application, thereby making up for the defects and shortcomings in the prior art.

[0007] To achieve the above objectives, the present invention adopts the following technical scheme: The present invention provides 37 SNP-specific primers, which can be applied to the genotype identification of wheat stripe rust. The primer information is shown in Table 1.

[0008] Table 1 Primer design for SNP homozygous sites of wheat stripe rust based on the whole genome sequence

[0009] The present invention also provides a method for identifying wheat stripe rust genotypes using the set of SNP molecular markers, the method comprising: (1) Extract genomic DNA of wheat stripe rust using the CTAB method; (2) Add the FAM fluorescent linker sequence GAAGGTGACCAAGTTCATGCT to the 5' end of the forward wildtype primer in Table 1, add the HEX fluorescent linker sequence GAAGGTCGGAGTCAACGGATT to the 5' end of the forward mutant primer, and synthesize the KASP-SNP molecular marker; (3) Using the DNA obtained in (1) as a template, the synthetic molecular markers in (2) were used to detect the wheat stripe rust genotype by PCR specific amplification method. The PCR reaction system was 5.07 μL: 2 μL of genomic DNA (dried at 65°C), 2×KASP mix 2.5 μL, primer mixture 0.07 μL, ddH 2 O 2.5 μL. The PCR reaction conditions were as follows: initial denaturation at 94°C for 15 minutes; 10 decreasing PCR cycles, each cycle including denaturation at 94°C for 20 seconds, annealing for 60 seconds, initial annealing temperature of 60°C, annealing temperature decreased by 0.8°C per cycle; followed by 32 extension cycles including denaturation at 94°C for 20 seconds and annealing at 57°C for 60 seconds; (4) The amplified product was read using a fully automatic multifunctional microplate reader for fluorescence data, and the genotype was detected using KlusterCaller software; (5) The phylogenetic tree of wheat stripe rust population was constructed using IQ-TREE 2.1.3 software and beautified using iTOL 6 software. The population structure was analyzed using STRUCTURE 2.3 software, and principal component discriminant analysis was performed using the adegenet package in R language.

[0010] The present invention also provides the use of the above-mentioned SNP molecular markers in wheat stripe rust genotype identification and population genetics analysis, characterized in that the set of molecular markers can quickly and accurately identify the genetic diversity and population structure of wheat stripe rust.

[0011] Compared with the prior art, the present invention has the following advantages: (1) The present invention selects CRY34 spliced ​​to the chromosome level as the reference genome, selects raw data of wheat stripe rust from different countries such as China, the United States, the United Kingdom, Australia, Denmark, France, and India for comparison, filtering, and screening to develop SNP molecular markers, which have higher polymorphism and applicability than existing markers; (2) The nucleus of wheat stripe rust is a binuclear structure with a high degree of heterozygosity. The SNP molecular markers in the present invention are developed based on the homozygous SNP sites on the genome of wheat stripe rust, which can effectively eliminate the differences caused by the heterozygosity of the sites of the stripe rust itself and ensure the accuracy of differential site detection; (3) In this set of SNP molecular markers, the PCR reaction system for each marker only requires 5.07 μL and can be completed in a 384-well PCR plate. A large number of samples can be tested simultaneously with high detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The phylogenetic tree is constructed based on 308 wheat stripe rust genotypes obtained by the molecular markers developed by the present invention. MG1-MG6 represent different molecular groups; bootstrap is the bootstrap value, which represents the support of the evolutionary tree branch.

[0013] Figure 2 This is a diagram of the structure of 308 wheat stripe rust populations constructed based on molecular marker genotypes. G1 is the eastern Qinghai population, G2 is the central Gansu population, G3 is the western Liupanshan population, G4 is the Longnan population, G5 is the Longdong population, and G6 is the western Guanzhong population.

[0014] Figure 3 This is the principal component discriminant analysis diagram of 308 wheat stripe rust populations constructed based on molecular marker genotypes. DETAILED DESCRIPTION

[0015] The advantages and features of the present invention are further illustrated by specific examples below, which are only examples and should not be regarded as any limitation to the scope of the present invention. It should be clear to those skilled in the art that the technical solution of the present invention may be modified or replaced in detail and form without departing from the spirit and scope of the present invention, but these modifications or replacements all belong to the protection scope of the present invention.

[0016] Example 1 Acquisition of SNP homozygous locus molecular markers for wheat stripe rust based on the whole genome The present invention selects wheat stripe rust CRY34 spliced ​​to the chromosome level as a reference genome, uses BWA-MEM and GATK HaplotypeCaller software to compare the original data of 28 wheat stripe rust genomes from China, the United States, the United Kingdom, Australia, Denmark, France, India, etc. with the reference genome, and detects 1,790,286 variant sites, and there are 1,381,576 double allele SNP sites with a sequencing depth between 20 and 1000 times; through linkage disequilibrium analysis, 100,749 independent SNP sites were obtained, of which 1,076 sites were identified as homozygous sites in 28 wheat stripe rusts; through further screening of minor allele frequency, deletion rate and other parameters, 113 SNP sites were finally obtained.

[0017] Example 2 Development of KASP-SNP markers for wheat stripe rust based on the whole genome Primers were designed for the above SNP sites using WASP software, and 37 SNP sites were suitable for primer design. The minor allele frequencies of these markers were 0.11-0.39, the gene diversity was 0.19-0.48, the polymorphism information content was 0.17-0.36, and the heterozygosity rate was 0. FAM 5'GAAGGTGACCAAGTTCATGCT 3' and HEX 5'GAAGGTCGGAGTCAACGGATT 3' fluorescent linkers were added to the forward Wildtype and Mutant primers in the primer design, respectively, to synthesize KASP-SNP molecular markers.

[0018] Example 3 Genotype detection method of wheat stripe rust markers based on whole genome DNA was extracted from summer spores of wheat stripe rust fungi to be tested using the CTAB method; PCR amplification was performed using 37 sets of specific KASP-SNP primers, and each set of primers could detect 384 stripe rust fungi samples at one time on the PCR plate. 2 μL DNA was first added to each PCR well, dried at 65°C for 40 minutes, and then 2.5 μL 2×KASP mix, 0.07 μL primer mixture, and 2.5 μL ddH2O were added; the PCR amplification program was: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, annealing at 60°C (-0.8°C / cycle) for 60 seconds, for a total of 10 cycles; denaturation at 94°C for 20 seconds, annealing at 57°C for 60 seconds, for 32 cycles. The amplified products were read using a FLUOstar Omega fully automatic multifunctional microplate reader (BMG LABTECH, Germany), and the SNP genotypes were identified using Kluster Caller software (LGC Biosearch Technologies, UK).

[0019] Example 4 Analysis of wheat stripe rust population structure based on SNP genotypes The phylogenetic tree of 308 wheat stripe rust populations was constructed using 37 SNPs, and a bootstrap analysis with 1000 replications was performed using the TVM+F+ASC+G4 model of IQ-TREE 2.1.3 software. The phylogenetic tree was visualized and annotated using iTOL 6 (https: / / itol.embl.de / ) ( Figure 1 Population structure analysis was performed using the STRUCTURE 2.3 program. For each simulated cluster size (K), five runs were performed, each consisting of 10,000 tests and 40,000 iterations. The optimal K value was determined using the STRUCTURE HARVESTER program (http: / / taylor0.biology.ucla.edu / structureHarvester). The resulting population structure data were processed using Clumpp 1.1.2 software and visualized using Distruct 1.1 ( Figure 2 The principal component analysis (DAPC) was performed using the adegenet package in R language to complete the clustering of wheat stripe rust samples ( Figure 3 ).

Claims

1. A primer set for detecting SNP molecular markers of wheat stripe rust, characterized in that: The primer set is composed of the following 37 primer combinations described in 1-37, wherein each primer combination is composed of a forward wildtype primer, a forward mutant primer and a reverse primer: 。 2. The primer set for detecting SNP molecular markers of wheat stripe rust according to claim 1, characterized in that: The primer combinations 1-37 are used to amplify the corresponding SNP sites, respectively. The reference genome is CYR34. The 37 SNP homozygous sites are distributed on 14 chromosomes of the reference genome. The site information is as follows: Chr1_277111 is located at position 277111 on chromosome 1, and the deoxynucleotide is G or A; Chr1_1514334 is located at position 1514334 on chromosome 1, and the deoxynucleotide is G or T; Chr1_5151405 is located at position 5151405 on chromosome 1, and the deoxynucleotide is C or G; Chr2_279415 is located at position 279415 on chromosome 2, and the deoxynucleotide is G or A; Chr2_896156 is located at position 896156 on chromosome 2, and the deoxynucleotide is A or G; Chr2_998173 is located at position 998173 on chromosome 2, and the deoxynucleotides are C or T; Chr2_1041509 is located at position 1041509 on chromosome 2, and the deoxynucleotide is G or C; Chr3_2205441 is located at position 2205441 on chromosome 3, and the deoxynucleotides are C or T; Chr3_2269449 is located at position 2269449 on chromosome 3, and the deoxynucleotides are C or T; Chr3_3970574 is located at position 3970574 on chromosome 3, and the deoxynucleotide is G or A; Chr4_2956131 is located at position 2956131 on chromosome 4, and the deoxynucleotides are C or T; Chr4_3402226 is located at position 3402226 on chromosome 4, and the deoxynucleotides are C or T; Chr4_5392145 is located at position 5392145 on chromosome 4, and the deoxynucleotides are C or T; Chr5_1499190 is located at position 1499190 on chromosome 5, and the deoxynucleotide is G or A; Chr5_4544872 is located at position 4544872 on chromosome 5, and the deoxynucleotide is A or G; Chr6_749630 is located at position 749630 on chromosome 6, and the deoxynucleotide is G or A; Chr6_1939399 is located at position 1939399 on chromosome 6, and the deoxynucleotides are C or T; Chr6_2733230 is located at position 2733230 on chromosome 6, and the deoxynucleotides are A or T; Chr7_717077 is located at position 717077 on chromosome 7, and the deoxynucleotides are C or T; Chr7_2276040 is located at position 2276040 on chromosome 7, and the deoxynucleotide is G or C; Chr7_3763260 is located at position 3763260 on chromosome 7, and the deoxynucleotide is G or A; Chr9_201188 is located at position 201188 on chromosome 9, and the deoxynucleotide is C or T; Chr9_843505 is located at position 843505 on chromosome 9, and the deoxynucleotides are T or A; Chr9_1370829 is located at position 1370829 on chromosome 9, and the deoxynucleotide is G or A; Chr9_1381122 is located at position 1381122 on chromosome 9, and the deoxynucleotides are C or T; Chr9_3149493 is located at position 3149493 on chromosome 9, and the deoxynucleotide is G or A; Chr10_230077 is located at position 230077 on chromosome 10, and the deoxynucleotides are C or T; Chr12_23929 is located at position 23929 on chromosome 12, and the deoxynucleotides are T or C; Chr12_2805263 is located at position 2805263 on chromosome 12, and the deoxynucleotide is A or G; Chr14_3096987 is located at position 3096987 on chromosome 14, and the deoxynucleotides are T or C; Chr16_106435 is located at position 106435 on chromosome 16, and the deoxynucleotides are C or T; Chr16_1855070 is located at position 1855070 on chromosome 16, and the deoxynucleotide is G or T; Chr16_2481069 is located at position 2481069 on chromosome 16, and the deoxynucleotide is G or A; Chr17_724947 is located at position 724947 on chromosome 17, and the deoxynucleotides are G or C; Chr17_1200207 is located at position 1200207 on chromosome 17, and the deoxynucleotides are C or T; Chr17_1279204 is located at position 1279204 on chromosome 17, and the deoxynucleotide is G or A; Chr18_30688 is located at position 30688 on chromosome 18, and the deoxynucleotide is G or T.

3. The primer set for detecting SNP molecular markers of wheat stripe rust according to claim 1, characterized in that: in each forward primer.

4. Use of the primer set for detecting SNP molecular markers of wheat stripe rust according to any one of claims 1 to 3 in genetic diversity analysis of wheat stripe rust. Add 5'GAAGGTGACCAAGTTCATGCT 3' to the Wildtype sequence; add 5'GAAGGTCGGAGTCAACGGATT 3' to the Mutant sequence of each forward primer.

5. Use of the primer set for detecting SNP molecular markers of wheat stripe rust according to any one of claims 1 to 3 in detecting the genotype of wheat stripe rust or determining whether a new strain of wheat stripe rust has appeared.

6. The use according to claim 4 or 5, characterized in that: The following steps are included: (1) The genomic DNA of wheat stripe rust summer spores was extracted using the CTAB method; (2) using the wheat stripe rust DNA as a template, performing specific PCR amplification using the primer set to obtain an amplified product; (3) Use an ELISA reader to detect the genotype of the amplified product and perform typing and identification of the genotype.

7. A KASP detection kit for detecting SNP molecules of wheat stripe rust, characterized in that: The KASP detection primer set is the primer set according to claim 1.

Images