CRISPR / Cas12a-based porcine rotavirus type A lateral chromatography detection test strip

Abstract

The invention discloses a CRISPR / Cas12a (clustered regularly interspaced short palindromic repeats / CRISPR associated 12a)-based sequence combination for porcine rotavirus type A detection. The CRISPR / Cas12a-based sequence combination comprises an RAA (Regularly Amplified Amplification) amplification primer, crRNA The RAA amplification primer has a base sequence as shown in SEQ. ID. No.3-8 in the sequence table; the crRNA has a base sequence as shown in SEQ. ID. No.9 in the sequence table; the ssDNA reporter molecule is 5 '-FAM-TTATT-Biotin-3', and the ssDNA reporter molecule is 5 '- Accordingly, the inventor also develops a corresponding detection kit, test paper and the like, and establishes a CRISPR / Cas12a-based porcine rotavirus type A lateral chromatography detection method on the basis of the detection kit, the test paper and the like. According to the method, specific primers are designed aiming at a conserved structural domain of a VP6 gene, a CRISPR / Cas12a system is combined with a recombinase-mediated isothermal amplification technology and a lateral chromatography test strip, and the method is an efficient method for rapidly detecting the porcine rotavirus type A. The kit has the advantages of normal-temperature reaction, simplicity and convenience in operation, short time consumption, convenience in carrying, high detection efficiency and lower cost, also has the outstanding advantages of strong specificity, high sensitivity, good repeatability and the like, provides a highly reliable solution for on-site rapid real-time detection of the porcine rotavirus type A, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology and molecular diagnosis, and in particular relates to a lateral flow test strip for porcine rotavirus type A based on CRISPR / Cas12a. Background Art

[0002] Porcine rotavirus (PoRV) of group A is one of the common enteroviruses in the global pig industry, especially causing acute gastroenteritis in piglets, leading to severe diarrhea and high mortality. PoRV belongs to the Reoviridae family, and its genome consists of 11 double-stranded RNA segments encoding a variety of structural and non-structural proteins. Based on different antigens, PoRV is mainly divided into several groups, such as A, B, and C. Among them, group A rotavirus (RVA) is the most common and is the main cause of diarrhea in piglets. Rotavirus consists of three concentric protein shells, and the middle protein layer is composed of 260 trimers of VP6. VP6 is the most abundant protein in the virion, and is also involved in virion assembly. It has the ability to interact with VP2, VP4, and VP7, which can accurately distinguish group A porcine rotavirus at the molecular level, making it an ideal target gene. The VP6 protein is a group antigen and a common antigen for rotavirus of any species in the same serogroup. It is highly conserved within the same group, and the amino acid homology in different mammalian populations is greater than 87%. The VP6 gene is often used for typing and epidemiological studies.

[0003] The VP6 gene was searched in NCBI and found to be in the range of 1-396bp as the conserved domain. Multiple sequence alignment was performed with reference to the conserved domain to select highly conserved sequences for designing primers. At present, the epidemiological characteristics of PoRV are constantly changing. New virus strains have been found in many countries and regions, especially strains recombined with human rotavirus, which increases the risk of cross-species transmission of the virus. For example, in recent years, many outbreaks caused by human-recombined RVA have been reported in East Asia. In surveys in southern China, the infection rate of PoRV fluctuated between 60% and 67.3%, showing differences in different regions and breeding conditions. A study in Guangdong Province, China, found a human-pig recombined G9P

[19] strain, which caused 60% morbidity and 20.99% mortality. In addition, rotavirus has different infection rates in pigs at different stages, and piglets are a high-risk group for infection, especially piglets aged 3 to 5 weeks. In order to control and prevent PoRV, rapid and accurate detection is essential.

[0004] Traditional detection methods include RT-qPCR and ELISA. Although they have high sensitivity and specificity, they have high requirements for laboratory environment and personnel skills, and the detection process is time-consuming and costly, making it difficult to apply in resource-limited areas or on-site. There is an urgent need for an on-site rapid detection tool that can efficiently, accurately and sensitively identify PoRV to facilitate the timely implementation of epidemic prevention work. In recent years, emerging gene editing technologies such as CRISPR / Cas12a have also been applied to the detection of porcine diarrhea virus, especially in improving the sensitivity and specificity of detection. It is an emerging, rapid, simple and highly sensitive virus detection tool. One end of the lateral flow test strip is labeled with biotin (Biotin), and the other end is labeled with fluorescein isothiocyanate (FITC) or 6-carboxyfluorescein (6-FAM). The test strip can be used to detect the Cas enzyme cleavage product after the target gene is amplified by loop-mediated isothermal amplification (LAMP), recombinase-mediated isothermal amplification (RAA) or recombinase polymerase amplification (RPA) technology. It is a convenient and low-cost on-site rapid detection tool that can be widely used in agriculture, medical care, food safety and other fields.

[0005] For porcine rotavirus type A, there is currently a lack of highly sensitive and specific test strip detection methods. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a CRISPR / Cas12a-based lateral flow test strip for porcine rotavirus type A with high sensitivity and strong specificity.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] The sequence combination for detecting porcine rotavirus type A based on CRISPR / Cas12a includes RAA amplification primers, crRNA, ssDNA, and ssDNA reporter molecules; the RAA amplification primers have the base sequences of SEQ.ID.No.3-8 in the sequence list; the crRNA has the base sequence of SEQ.ID.No.9 in the sequence list; the ssDNA is 5'-FAM-TTCCCCCTT-BHQ1-3'; and the ssDNA reporter molecule is 5'-FAM-TTATT-Biotin-3'.

[0009] RAA amplification primers were used for RAA isothermal amplification of the conserved domain of porcine rotavirus type A VP6.

[0010] A porcine rotavirus type A detection kit based on CRISPR / Cas12a comprises RAA amplification primers, crRNA, ssDNA, ssDNA reporter molecules or a combination thereof in the above sequence combination.

[0011] The above-mentioned CRISPR / Cas12a-based porcine rotavirus type A detection kit includes Cas12a protein, crRNA, ssDNA, ssDNA reporter molecule, sterile enzyme-free water and RAA reaction product; the RAA reaction product is obtained by amplification of RAA amplification primers.

[0012] A CRISPR / Cas12a-based lateral flow test strip for porcine rotavirus type A, comprising a ssDNA reporter molecule in the above sequence combination.

[0013] The above sequence combination, detection kit and detection test strip are used for the detection of porcine rotavirus type A, which is used for non-diagnostic and therapeutic purposes.

[0014] A CRISPR / Cas12a-based lateral flow detection method for porcine rotavirus type A using the above kit is used for non-diagnostic therapeutic purposes.

[0015] The above detection method comprises the following steps:

[0016] (1) adding the sample DNA to be tested into the RAA system for RAA isothermal amplification to obtain RAA amplification products;

[0017] (2) adding the RAA amplification product of step (1) to the CRISPR / Cas12a detection system for reaction;

[0018] (3) The CRISPR / Cas12a detection system in step (2) is used to interpret the results using a Cas12 / 13-specific nucleic acid detection test strip to determine the quality control line (C) and the detection line (T).

[0019] In step (2): Cas12a protein concentration is 250nM, crRNA concentration is 250nM.

[0020] In step (1): RAA isothermal amplification temperature is 37°C and the reaction time is 30 min.

[0021] In response to the problems existing in the detection of group A porcine rotavirus, the inventors developed a sequence combination for the detection of porcine rotavirus type A based on CRISPR / Cas12a, including RAA amplification primers, crRNA, ssDNA, and ssDNA reporter molecules; RAA amplification primers have base sequences of SEQ.ID.No.3-8 in the sequence list; crRNA has the base sequence of SEQ.ID.No.9 in the sequence list; ssDNA is 5'-FAM-TTCCCCCTT-BHQ1-3'; ssDNA reporter molecules are 5'-FAM-TTATT-Biotin-3'. Based on this, the inventors also developed corresponding detection kits, test strips, etc., and based on this, established a lateral flow detection method for porcine rotavirus type A based on CRISPR / Cas12a. This method designs specific primers for the conserved domain of the VP6 gene, combines the CRISPR / Cas12a system with recombinase-mediated isothermal amplification technology (RAA) and lateral flow test strips, and is an efficient method for rapid detection of porcine rotavirus type A. The VP6 target DNA sequence is rapidly amplified at room temperature using RAA technology, and then combined with the CRISPR / Cas12a system, it can accurately identify and cut the specific target sequence, triggering the fluorescent signal to read the test results through the test strip, thereby achieving detection. This method introduces the CRISPR / Cas12a system into the test strip detection process, through the targeted activation and nonspecific cleavage of the Cas12a enzyme, and optimizes the conditions to trigger the color reaction, successfully and specifically detect porcine rotavirus type A, solving the problem of insufficient sensitivity of traditional test strips. This dual mechanism improves the sensitivity and accuracy of detection. It not only has the advantages of room temperature reaction, simple operation, short time consumption, easy carrying, efficient detection and low cost, but also has outstanding advantages such as strong specificity, high sensitivity and good repeatability. It provides a highly reliable solution for rapid and real-time detection of porcine rotavirus type A on site and has good application prospects.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. By combining CRISPR / Cas12a test strip detection technology, virus detection can be completed within 30 minutes to quickly obtain test results. The entire reaction is incubated at a constant temperature of 37°C, and is not limited by large and expensive instruments. It is suitable for scenarios that require rapid judgment of infection status, such as epidemic screening in emergency events, rapid clinical diagnosis, etc.

[0024] 2. The combination of RAA and CRISPR / Cas12a ensures that the test strip can detect extremely low concentrations of viral nucleic acid, has high detection sensitivity, and can still accurately detect low viral loads.

[0025] 3. The present invention has low requirements on the operating environment and does not require special experimental equipment. Testing can be carried out at room temperature, which is convenient for large-scale deployment.

[0026] 4. The CRISPR / Cas12a system can adjust crRNA according to the gene sequence of the target virus. By replacing crRNA, the test strip can quickly adjust the detection target to meet the detection needs of different viruses or pathogens. This feature enables it to respond quickly to emerging infectious diseases, has wide adaptability, and has extremely high promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The present invention is a flow chart of the detection technology of the porcine rotavirus type A lateral flow test strip based on CRISPR / Cas12a.

[0028] Figure 2 This is a graph of RT-RAA primer screening results. In the graph, lanes 1, 3, 5, 7, 9, 11, 13, 15 and 17 are primers: F1 / R1; F1 / R2; F1 / R3; F2 / R1; F2 / R2; F2 / R3; F3 / R1; F3 / R2 and F3 / R3; lanes 2, 4, 6, 8, 10, 12, 14, 16 and 18 are all negative controls, and M is DL1000.

[0029] Figure 3 This is the electrophoresis diagram of target gene amplification, in which: M is DL2000, 1 is the negative control, and 2 is PoRV.

[0030] Figure 4 It is a diagram of the verification results of the Cas12a reaction system, in which: 1 is a negative control; 2 is a reaction system lacking a Cas12a component system; 3 is a reaction system lacking a crRNA component system; 4 is a reaction system lacking an ssDNA component; 5 is a full-component reaction system lacking an RAA amplification product as a template; 6 is a full-component reaction system of PoRV RAA-CRISPR / Cas12a.

[0031] Figure 5 It is a graph of the optimization results of Cas12a protein and crRNA concentration, in which: Figure a is a fluorescence curve graph of the optimal concentration of Cas12a protein, and the Cas12a protein concentrations of 1, 2, 3, and 4 in Figure a are 250nM, 200nM, 150nM, 100nM, and 50nM, respectively; Figure b is a fluorescence curve graph of the optimal concentration of crRNA, and the crRNA concentrations of 1, 2, 3, 4, and 5 in Figure b are 250nM, 200nM, 150nM, 100nM, and 50nM, respectively; Figure c is a chessboard graph comparing the two.

[0032] Figure 6This is a diagram showing the verification results of the CRISPR / Cas12a final detection system based on test strip detection. In the figure: a is the fluorescence irradiation diagram, and b is the test strip detection diagram.

[0033] Figure 7 Graphs showing specificity test results, in which: a is a test strip detection graph, b is a fluorescence irradiation graph, and c is a bar graph showing image density measurement of fluorescence intensity using ImageJ.

[0034] Figure 8 Figure 1 is a sensitivity test result diagram, in which a is a test strip detection diagram, b is a fluorescence irradiation diagram, and c is a bar graph of image density measurement of fluorescence intensity using ImageJ.

[0035] Fig. 9 These are clinical sample detection diagrams, a is the RT-qPCR result of the PoRV clinical sample, and b is the RAA-CRISPR / Cas12a test strip detection result of the PoRV clinical sample. DETAILED DESCRIPTION

[0036] The experimental materials used in the present invention are as follows:

[0037] Strains, plasmids and serum samples: Group A porcine rotavirus (PoRV), porcine enterovirus type G (EV-G), porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and positive samples are all preserved by the applicant.

[0038] Experimental instruments and reagents: Viral RNA nucleic acid extraction kit was purchased from Shanghai Baisai Biotechnology Co., Ltd., agarose gel DNA recovery kit and plasmid extraction kit were purchased from Nanning Yikesong Biological Co., Ltd. pMD18-T vector was purchased from Baori Medical Biology (Beijing) Co., Ltd. RT-RAA nucleic acid amplification reagent was purchased from Nanning Zhuangbo Biotechnology Co., Ltd., and Cas12 / 13 special nucleic acid detection strips were purchased from Guangzhou Bolais Biotechnology Co., Ltd.

[0039] Main experimental instruments: Roche 96 fluorescence quantitative PCR instrument (Wuhan Bomei Biotechnology Co., Ltd.), water bath (Beijing Liuyi Biotechnology Co., Ltd.); gel imaging system (Shanghai Tianlong Technology Co., Ltd.), biological safety cabinet (Qingdao Haier Biomedical Co., Ltd.), constant temperature fluorescence signal collection device (Nanning Zhuangbo Biotechnology Co., Ltd.).

[0040] 1. Experimental Methods

[0041] 1.1 Primer design and crRNA design

[0042] Download 60 VP6 gene sequences of PoRV strains from NCBI, and screen high nucleic acid homology regions as target sequences through MEGA 7.0 according to the VP6 conserved domain region on NCBI. According to the principle that Cas12a recognizes PAM sites and activates cutting, search for PAM sequences (TTTN) in the target sequence, and design crRNA and 3 upstream and downstream RAA primers corresponding to the Protospacer sequence (Table 1), designed using Primer Premier 5.0, and verified by BLAST. According to the principle that Cas12a cuts ssDNA after activation, synthesize ssDNA reporter molecules modified with biotin (Table 1). The above-mentioned PoRV primers and RAA primers are synthesized by Nanning Qingke Biotechnology Co., Ltd., and crRNA and ssDNA reporter molecules are synthesized by Guangzhou Bolais Biotechnology Co., Ltd.

[0043] Table 1PoRV RT-RAA primers and crRNA sequences

[0044]

[0045] 1.2 Construction of PoRV standard plasmid

[0046] According to the method of Axy Prep Body Fluid Viral DNA Miniprep Mix, PoRV total viral RNA was extracted as a template, and RNA was reverse transcribed into cDNA, and the cDNA obtained with primers PoRV-F / R was amplified. The PCR reaction system was: 2×Taq Master Mix 25μL, PoRV-F and PoRV- / R 1μL each, ddH2O 17μL, cDNA 6μL, total system 50μL. The program was as follows: 95℃2min; 95℃15s, 53℃30s, 72℃30s, a total of 35 cycles; 72℃10min, 4℃ storage.

[0047] The obtained target fragment (TTCAGATTGTGGAGCTATTCCATTTCGTTGCGATTCTCTAGCCATTTCATCCAT ACACACATTATCTATAAAATCAATGAAATATCCAATGGTAGTTCTAGCGTTTTCAACATAATTTGCATCTATGTTAAGTAAAGTAGTACCAAGTAATCCGAAATCAAAATTCCAATTCCTGATTGGCAAATTTCCTATTCCTCCTGTCTGAAAATCATTTCCATTCATAGTAACTATCATTTGATTAAATTGCTGAATTAAATCACTTATATTTGAGTATAATGTACCTTCAACAATTTTGTCCCTAGCATCTTT) (SEQ.ID.No.10) was recovered from gel, cloned into the pMD18-T vector, and after transformation, shaking and plasmid extraction, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis. The recombinant plasmid with the correct sequence was used for nucleic acid concentration determination, and the plasmid with OD260 / OD280 value between 1.80 and 1.90 was selected as the standard and stored at -80°C for future use. The copy number was calculated based on the measured plasmid concentration, using the formula: copy number (copies / μL) = 6.02×10 23 × concentration (ng / μL) × 10 -9 / (number of bases × 660) to calculate the copy number of the recombinant plasmid pMD18-T-PoRV.

[0048] 1.3 Establishment of experimental method for detecting porcine rotavirus group A using RAA-Cas12a

[0049] 1.3.1 RAA amplification and primer screening

[0050] The RAA reaction system consists of Buffer A, Buffer B, upstream and downstream primers, and target templates. Before the reaction begins, you first need to prepare a premix. Mix 25μL Buffer A, 13.5μL ddH2O, 2μL upstream primer (10μM), and 2μL downstream primer (10μM) together, then add them to the unit tube containing the nucleic acid amplification reagent. Then add 5μL of the target template and 2.5μL of B Buffer to the detection unit tube, cover the tube, turn it upside down and shake it gently for 5-6 times to mix it thoroughly, and centrifuge it at low speed for 10s. Place the mixed reaction tube in the PCR instrument, set the reaction program, and react at 39℃ for 30min. After the reaction is completed, take out the reaction tube, add an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) 50μL to each reaction tube, cover the lid, vortex and centrifuge, and centrifuge until the liquid in the tube is separated. If the upper layer of liquid is transparent, it proves that the extraction is complete. Take an appropriate amount of the upper solution for agarose gel electrophoresis at 120V for 20-25min, and finally use a gel imager to analyze the size of the amplified band and the amplification effect. Cross-combination of the designed 6 primers (Table 1) was performed at a concentration of 5.84×10 5 The pMD18-T-PoRV plasmid standard with 100 copies / μL was used as a template, RT-RAA amplification was performed according to the reaction system established above, and primer pairs with brighter bands were selected for subsequent applications.

[0051] 1.3.2 RAA-Cas12a reaction system verification

[0052] PoRV RNA was amplified by RT-RAA using RAA-F2 / R2 primers to obtain linearized double-stranded DNA containing the PAM site and the crRNA complementary region as the target dsDNA. After the amplification, electrophoresis was performed to verify whether the correct target fragment was obtained. The Cas12a reaction system includes Cas12a protein, crRNA, amplified target dsDNA, 1×NEB Buffer2.1 and fluorescent ssDNA reporter molecules. Six groups of variables were designed, and the complete reaction system of components was configured using RAA amplification products, as well as reaction systems lacking Cas12a protein, crRNA, ssDNA, and RAA amplification products, and negative control groups were configured to verify the integrity of the Cas12a reaction system. Add the corresponding reaction components to the PCR tube and mix thoroughly, place it in the PCR instrument at 37°C for 30 minutes, and then place it under a gel imager to observe the fluorescence state. When Cas12a / crRNA / target dsDNA combines to form a ternary complex, ssDNA of any sequence in the system can be indiscriminately cut. Therefore, adding ssDNA reporter molecules labeled with FAM biotin groups to the reaction system can verify the cutting activity of Cas12a protein and the required components of the CRISPR detection system.

[0053] 1.3.3 Screening of optimal Cas12a and crRNA concentrations

[0054] Based on fluorescence detection, the initial detection system of CRISPR / Cas12a is Cas12a protein (1μM) 2μL, crRNA (1μM) 2μL, ssDNA (5'-FAM-TTCCCCCTT-BHQ1-3') 5μM 2μL, NEBuffer 2μL, RAA amplification product 2μL, supplemented to 20μL with enzyme-free sterile water, through a thermostat, select the FAM channel, react at 37℃ for 30min, and then place it under a gel imager to observe the fluorescence state. In order to obtain the best detection effect, the fluorescence value of the Cas12a protein and crRNA in this experiment was detected through the initial system to screen the optimal crRNA and Cas12a protein concentrations. The Cas12a protein concentration in the detection system was set to 250nM, 200nM, 150nM, 100nM, and 50nM, and the crRNA concentration was set to 250nM, 200nM, 150nM, 100nM, and 50nM for orthogonal experiments, and the fluorescence values ​​were detected to determine the optimal Cas12a protein and crRNA usage.

[0055] 1.3.4 Establishment of RAA-CRISPR / Cas12a test strip detection platform

[0056] The above screening obtains the best ratio of Cas12a and crRNA detection system, which is the best detection system of CRISPR / Cas12a based on fluorescence detection. In addition, the ssDNA in the best detection system of CRISPR / Cas12a based on fluorescence detection is changed from 5'-FAM-TTCCCCCTT-BHQ1-3' to 5'-FAM-TTATT-Biotin-3', which is the best detection system of CRISPR / Cas12a based on test strip detection. The reaction system is as follows: Cas12a protein (250nM) 2μL, crRNA (250nM) 2μL, ssDNA (5'-FAM-TTCCCCCTT-BHQ1-3') (400nM) 5μM 2μL, NEBuffer 2μL, RAA amplification product 2μL, and make up to 20μL with enzyme-free sterile water. Insert the pad end of the test strip into the sample to be tested. The liquid level should not exceed the uppermost end of the pad. The area to be judged should be completely soaked. Observe the display of the test line (T) and the quality control line (C). Interpretation of results: A clear display of the test line (T) indicates a positive result; a display of only the quality control line (C) indicates a negative result.

[0057] 1.4 Research on the technical capabilities of RAA-CRISPR / Cas12a test strips

[0058] 1.4.1 Sensitivity test

[0059] Determine the concentration of the recombinant plasmid pMD18-T-RV, calculate the copy number according to the corresponding formula, and then perform a 10-fold gradient dilution to obtain 10 4 ~10 -1 For the sample to be tested with 100 copies / μL, perform the RAA reaction according to the steps in 1.3, and set up ddH2O-treated water as a negative control. Use the determined optimal reaction system to react in a water bath at 37°C for 30 minutes, perform fluorescence detection of different gradients of the target, and then place it on a gel imager to observe the fluorescence state. Add ddH2O to make up the reaction tube to 50μL, insert the pad end of the test strip into the test sample, and fully infiltrate the area to be read. Determine the display of the test strip test line (T) and the quality control line C) to determine the LOD of the RAA-CRISPR / Cas12a test strip detection technology.

[0060] 1.4.2 Specificity test

[0061] In the specificity evaluation, PoRV, PEDV, PDCoV, EV-G, TGEV and other common infectious pathogens in pig farms were mainly detected to identify whether the detection method established in this study has cross-reactions with other common pig diseases. The RNA of PEDV, PDCoV, EV-G, and TGEV preserved in this laboratory was extracted, and the RT-RAA reaction was performed according to the steps in 1.3, and ddH2O-treated water was set up as a negative control. The determined optimal reaction system was used to react in a PCR instrument for 30 minutes, and target-specific fluorescence detection was performed. After completion, the fluorescence state was observed on a gel imager. ddH2O was added to make up the reaction tube to 50μL, and the pad end of the test strip was inserted into the test sample. The entire reading area was infiltrated, and the test strip test line (T) and quality control line (C) were judged to determine the specificity of the RAA-CRISPR / Cas12a test strip detection technology.

[0062] 1.4.3 Testing of clinical samples

[0063] The RAA-CIRSPR / Cas12a method established in the present invention and the conventional RT-qPCR detection method reported in the literature were respectively used to detect 20 clinical samples, and the test results were evaluated. The results showed (Table 2) that 15 cases were positively detected by RAA-CIRSPR / Cas12a and 15 cases were positively detected by RT-qPCR. The total coincidence rate of the two methods was 90%, indicating that the RT-RAA CIRSPR / Cas12a method established in this study can meet the detection needs.

[0064] Table 2 Comparison results between the RAA-CIRSPR / Cas12a method and the RT-qRCR method for detecting group A porcine rotavirus

[0065]

[0066] 2. Experimental Results

[0067] 2.1. RAA primers and screening

[0068] The amplification results are as follows Figure 2 As shown, among the 9 primer pairs, F2 / R2 can effectively amplify the target band and has good amplification efficiency. Therefore, the F2 / R2 primer pair was selected for the establishment of subsequent research methods.

[0069] 2.2 Positive standard plasmid

[0070] As shown Figure 3 As shown, the extracted PoRV RNA was used as a template and PoRV-F / R primers were used for RT-PCR amplification, and an amplification product was obtained at the 309 bp position.

[0071] 2.3RAA amplification of target gene

[0072] 2.4 Establishment of RAA-CRISPR / Cas12a test strip detection platform

[0073] 2.4.1 RAA-Cas12a reaction system verification results

[0074] like Figure 4 As shown, the reaction system lacking Cas12a protein, crRNA, ssDNA and RAA amplification products in the RAA-Cas12a reaction system did not produce fluorescence, and only the reaction system with Cas12a protein, crRNA, ssDNA and RAA amplification products produced fluorescence. The results show that the purified Cas12a protein has non-specific ssDNA cutting activity, the designed crRNA, ssDNA reporter molecules and PORV-RAA-F2 / R2 amplification primers are correct, and only when Cas12a protein, crRNA, ssDNA reporter molecules and target dsDNA are present in the system at the same time, Cas12a protein can play a cutting role.

[0075] 2.4.2 Optimal concentrations of Cas12a protein and crRNA

[0076] like Figure 5 As shown, in the RAA-Cas12a reaction system, the fluorescence intensity is strongest when the Cas12a protein concentration is 250nM and the crRNA concentration is 250nM, and the optimal Cas12a protein and crRNA usage amounts are determined to be 250nM and 250nM, respectively.

[0077] 2.4.2 RAA-CRISPR / Cas12a test strip detection platform test results

[0078] like Figure 6 As shown, according to 1.3.4, the optimal detection system of CRISPR / Cas12a based on test strip detection was configured and reacted in a water bath at 37°C for 15-30 minutes. After completion, the fluorescence was observed under a gel imager. Sterile enzyme-free water was added to 50 μL in the PCR reaction tube for test strip detection. The results showed that the negative control had no fluorescence, only the quality control line (C) appeared on the test strip, PoRV produced fluorescence, and the test strip detection line (T) appeared.

[0079] 2.2.3 Specificity test

[0080] like Figure 7 As shown, the specific test results of the CRISPR / Cas12a detection platform based on test strip detection showed that when PoRV showed a higher fluorescence intensity, the test strip was inserted and the test strip detection line (T) line appeared, while other virus sample tests had no fluorescence, and only the quality control line (C) line appeared.

[0081] 2.2.4 Sensitivity test

[0082] like Figure 8 As shown in the figure, the sensitivity test results of the CRISPR / Cas12a detection platform based on test strips showed that only when the PoRV concentration was 10 4 ~10 -1 The fluorescence intensity of copies / μL gradually weakened, and the PoRV concentration was greater than 10 2 copies / μL showed a high fluorescence intensity. After the test strip was inserted, the T line of the test strip also gradually weakened. The results showed that the minimum detection limit of PoRV was 4.6×10 0 copies / μL, RAA combined with CRISPR / Cas12a has a high sensitivity for detecting PoRV.

[0083] 2.2.5 Clinical sample testing

[0084] like Fig. 9 The results showed that this experiment used the established RAA-CRISPR / Cas12a method and RT-qPCR method to identify and detect porcine rotavirus group A. In comparison, the consistency rate between the RAA-CRISPR / Cas12a method and the conventional RT-qPCR method was 90%.

[0085] To facilitate on-site testing, corresponding detection kits, test strips, etc. can be assembled and prepared according to the above results.

Claims

1. Sequence combination for porcine rotavirus type A detection based on CRISPR / Cas12a, characterized in that It includes RAA amplification primers, crRNA, ssDNA, and ssDNA reporter molecules; the RAA amplification primers have the base sequence of SEQ.ID.No.3-8 in the sequence list; the crRNA has the base sequence of SEQ.ID.No.9 in the sequence list; the ssDNA is 5'-FAM-TTCCCCCTT-BHQ1-3'; and the ssDNA reporter molecule is 5'-FAM-TTATT-Biotin-3'.

2. The sequence combination according to claim 1, characterized in that: The RAA amplification primers are used for RAA isothermal amplification of the conserved domain of porcine rotavirus type A VP6.

3. A CRISPR / Cas12a-based porcine rotavirus type A detection kit, characterized in that It includes the RAA amplification primer, crRNA, ssDNA, ssDNA reporter molecule or a combination thereof in the sequence combination of claim 1.

4. The porcine rotavirus type A detection kit based on CRISPR / Cas12a according to claim 3, characterized in that It includes Cas12a protein, crRNA, ssDNA, ssDNA reporter molecule, sterile enzyme-free water and RAA reaction product; the RAA reaction product is amplified by the RAA amplification primer.

5. A CRISPR / Cas12a-based lateral flow test strip for porcine rotavirus type A, characterized in that Comprising the ssDNA reporter molecule in the sequence combination of claim 1.

6. The sequence combination of claim 1, the detection kit of claim 3, and the detection test strip of claim 5 are used for detecting porcine rotavirus type A, and the detection is used for non-diagnostic and therapeutic purposes.

7. A CRISPR / Cas12a-based lateral flow detection method for porcine rotavirus type A using the kit of claim 3, wherein the detection is used for non-diagnostic treatment purposes.

8. The detection method according to claim 7, characterized in that The following steps are involved: (1) adding the sample DNA to be tested into the RAA system for RAA isothermal amplification to obtain RAA amplification products; (2) adding the RAA amplification product of step (1) to the CRISPR / Cas12a detection system for reaction; (3) The CRISPR / Cas12a detection system in step (2) is used to interpret the results using a Cas12 / 13-specific nucleic acid detection test strip to determine the quality control line (C) and the detection line (T).

9. The detection method according to claim 8, characterized in that In step (2): Cas12a protein concentration is 250nM, crRNA concentration is 250nM.

10. The detection method according to claim 8, characterized in that In step (1): RAA isothermal amplification temperature is 37°C and the reaction time is 30 min.

Images