Chemotherapy drug resistance marker RAD51AP1 for ovarian cancer drug resistance diagnosis or prognosis evaluation in ovarian cancer treatment with platinum drugs and application of chemotherapy drug resistance marker RAD51AP1

Abstract

The invention discloses a chemotherapy drug resistance marker RAD51AP1 for ovarian cancer drug resistance diagnosis or prognosis evaluation in ovarian cancer treatment with platinum drugs and application of the chemotherapy drug resistance marker RAD51AP1, and relates to the technical field of biological medicines. A series of experiments prove that the high expression of RAD51AP1 is the key for causing the platinum drug chemotherapy resistance of an ovarian cancer patient, the expression level of the RAD51AP1 in an ovarian cancer platinum chemotherapy resistance sample is remarkably increased, and the RAD51AP1 is expected to become a chemotherapy resistance marker for diagnosis or prognosis evaluation of the drug resistance of the ovarian cancer treated by the platinum drug clinically; rAD51AP1 knock-down can lead to cancer cell apoptosis and enhance the curative effect of cis-platinum, and shows the potential of the cis-platinum as a chemotherapy drug resistance marker and a new target for targeted therapy; the combination of RAD51AP1 knockout and cisplatin treatment can significantly inhibit tumor growth, which prompts that RAD51AP1 may be used as an important target in cisplatin treatment, and a new tumor treatment strategy is expected to be developed for the target.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a chemotherapy resistance marker RAD51AP1 used for ovarian cancer resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs and an application thereof. Background Art

[0002] Ovarian cancer is one of the common malignant tumors in my country. As one of the top three gynecological malignant tumors in terms of morbidity and mortality, ovarian cancer brings a huge medical burden to patients.

[0003] Currently, the treatment of ovarian cancer mainly includes surgical treatment and standardized radiotherapy and chemotherapy; platinum drugs are the standard chemotherapy drugs for the treatment of ovarian cancer. About two-thirds of patients may develop drug resistance after receiving standardized chemotherapy using platinum drugs. Ovarian cancer chemotherapy resistance is an important problem in the treatment process.

[0004] In this regard, the inventors believe that it is necessary to screen and identify markers that may become chemotherapeutic resistance in ovarian cancer, so as to better predict the response of ovarian cancer patients to platinum-based drug treatment and evaluate the prognosis of patients treated with platinum-based drugs, thereby achieving the adjustment of personalized treatment plans for patients.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] In response to the above technical problems, the embodiments of the present invention provide a chemotherapy resistance marker RAD51AP1 and its application for ovarian cancer resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs, so as to solve the problems raised in the above background technology.

[0007] A reagent for detecting RAD51AP1 protein or its encoding gene is used in the preparation of a product for diagnosing drug resistance or evaluating the prognosis of ovarian cancer treated with platinum drugs.

[0008] A chemotherapy resistance marker for diagnosing ovarian cancer resistance or evaluating prognosis in the treatment of ovarian cancer with platinum-based drugs, wherein the marker comprises RAD51AP1 protein or a gene encoding it.

[0009] A reagent for detecting RAD51AP1 protein or its encoding gene is used in the preparation of a product for diagnosing drug resistance or evaluating the prognosis of ovarian cancer treated with platinum drugs.

[0010] Preferably, the RAD51AP1 protein or its encoding gene is used as a drug resistance marker in the treatment of ovarian cancer with platinum drugs.

[0011] Preferably, the expression of RAD51AP1 protein is upregulated in ovarian cancer patients.

[0012] Preferably, the expression level of RAD51AP1 protein in ovarian cancer patients is negatively correlated with the prognosis of platinum-based drug treatment.

[0013] Preferably, inhibiting the expression of RAD51AP1 protein in ovarian cancer patients can improve the therapeutic effect of platinum drugs.

[0014] Preferably, the product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum-based drugs includes primers and probes for identifying the RAD51AP1 protein encoding gene, and antibodies for recognizing the RAD51AP1 protein.

[0015] Among them, the forward primer sequence for identifying the RAD51AP1 protein encoding gene is shown in SEQ ID NO.1, and the rear primer sequence is shown in SEQ ID NO.2; the sequence of SEQ ID NO.1 is GCTACATTGTGAAGTTCCCATAAA; the sequence of SEQ ID NO.2 is TGGGTCCTGTCAAAACCAGT.

[0016] The antibody that recognizes the RAD51AP1 protein is an antibody produced by Proteintech, and the product number of this antibody is 11255-1-AP.

[0017] It should be noted that the design of primers and probes is a conventional technique. For example, the design principles of primers generally include: first, search for the full-length mRNA sequence of the RAD51AP1 gene through gene databases (such as NCBI, Ensembl, etc.); then design primers and follow several principles, such as: the length of the primer is generally 18-24 bases; select sequences with strong specificity to avoid large homology with sequences of other genes; avoid primer dimers and self-complementarity when designing primers; when selecting primer sites, it is best to select the exon region of the gene and avoid the intron region to increase the success rate of PCR amplification, etc.

[0018] According to the above primer design principles, we designed primers as shown in SEQ ID NO.1 and SEQ ID NO.2, and performed gene amplification using PCR amplification technology. After gene amplification, it was verified to be the target gene.

[0019] A method for evaluating drug resistance of platinum drugs in the treatment of ovarian cancer, the method comprising evaluating the expression level of RAD51AP1 protein or its encoding gene in ovarian cancer patients treated with platinum drugs.

[0020] Preferably, the expression level of RAD51AP1 protein or its encoding gene is upregulated in ovarian cancer resistant patients; wherein the threshold of drug resistance in immunohistochemistry experiment is 0.026; and the threshold of drug resistance in immunofluorescence experiment is 41.7.

[0021] A use of a drug for inhibiting the expression of RAD51AP1 protein or its encoding gene in the preparation of a drug for treating ovarian cancer.

[0022] The embodiment of the present invention provides a chemotherapy resistance marker RAD51AP1 for ovarian cancer resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs and its application, which has the following beneficial effects:

[0023] 1. The present invention has confirmed through a series of experiments that the high expression of RAD51AP1 is closely related to the resistance of ovarian cancer patients to platinum-based chemotherapy. The expression level of RAD51AP1 is significantly upregulated in samples of ovarian cancer patients with resistance to platinum-based chemotherapy. RAD51AP1 is expected to become a chemotherapeutic resistance marker for the diagnosis of resistance or prognosis evaluation of ovarian cancer patients treated with platinum-based drugs in clinical practice.

[0024] 2. RAD51AP1 knockdown can enhance the efficacy of cisplatin and increase the apoptosis rate of cancer cells, showing its potential as a marker of chemotherapy resistance and targeted therapy.

[0025] 3. RAD51AP1 knockout combined with cisplatin treatment can significantly inhibit tumor growth, suggesting that RAD51AP1 may serve as an important target in cisplatin treatment and optimize cancer treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The experimental results of detecting RAD51AP1 expression by immunohistochemistry and immunofluorescence techniques;

[0027] Figure 2 The results show the effect of RAD51AP1 gene knockdown on cisplatin-induced apoptosis in ovarian cancer SKOV3 cells;

[0028] Figure 3 This is the result of the effect of cisplatin combined with RAD51AP1 knockout on the subcutaneous tumor-forming ability of nude mice. DETAILED DESCRIPTION

[0029] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0030] In response to the above technical problems, the embodiments of the present invention provide a chemotherapy resistance marker RAD51AP1 and its application for ovarian cancer resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs, so as to solve the problems raised in the above background technology.

[0031] Example 1: Immunohistochemistry and immunofluorescence techniques to detect the expression of RAD51AP1

[0032] The main purpose of this experiment is to study the expression difference of RAD51AP1 in ovarian cancer, especially the expression difference in samples of sensitive ovarian cancer patients and platinum-resistant ovarian cancer patients, and to explore whether it is related to platinum chemotherapy resistance. By detecting the expression of RAD51AP1, the experiment attempts to clarify whether it may be used as a marker or potential therapeutic target to predict or explain chemotherapy resistance in ovarian cancer.

[0033] Tissue sections were collected from 8 patients with platinum-sensitive ovarian cancer and 8 patients with platinum-resistant ovarian cancer (the acquisition of samples complied with ethical review), and the protein expression level of RAD51AP1 was verified by immunohistochemistry and immunofluorescence experiments (the RAD51AP1 protein antibody model used in the experiment was Proteintech, 11255-1-AP).

[0034] The results are as follows Figure 1 As shown in the figure, the expression level of RAD51AP1 in samples of ovarian cancer resistant to platinum chemotherapy was significantly higher than that in samples sensitive to platinum. In Example 1, samples from 8 patients with platinum-sensitive ovarian cancer and 8 patients with platinum-resistant ovarian cancer were used for clinical verification, and the expression level of RAD51AP1 was detected by immunohistochemistry and immunofluorescence techniques, respectively. The results showed that the expression level of RAD51AP1 in platinum-resistant samples was significantly upregulated.

[0035] It should be noted that Figure 1 The results showed that the average immunohistochemical score of RAD51AP1 in platinum-sensitive ovarian cancer samples was 0.026, and the immunohistochemical score of RAD51AP1 in platinum-resistant samples increased significantly to about 0.065. The immunofluorescence results also found that the immunofluorescence intensity of RAD51AP1 in platinum-sensitive samples was about 41.7., and the immunofluorescence intensity of RAD51AP1 in platinum-resistant samples increased significantly to about 77.1. In summary, the immunohistochemical experiment showed that the threshold of platinum resistance and platinum sensitivity was 0.026, and greater than or equal to 0.026 was resistance. The immunofluorescence experiment showed that the threshold of both was 41.7, and greater than or equal to 41.7 was resistance.

[0036] This experiment shows that RAD51AP1 may be an important regulator of platinum chemotherapy resistance in ovarian cancer. Its expression level is significantly increased in patients with platinum-resistant ovarian cancer, suggesting that RAD51AP1 may be involved in the development of chemotherapy resistance. Therefore, RAD51AP1 may be used as a marker of chemotherapy resistance and may also become a target worthy of attention in future treatment strategies. This provides clinicians with a new diagnostic tool to help determine the effectiveness of chemotherapy, predict treatment response, and make adjustments in treatment plans.

[0037] Example 2: Effect of RAD51AP1 gene knockdown on cisplatin-induced apoptosis of ovarian cancer SKOV3 cells

[0038] The main purpose of this experiment is to study the effect of RAD51AP1 on cisplatin resistance in ovarian cancer SKOV3 cells by detecting the apoptosis level of SKOV3 cells under specific treatment. The expression of RAD51AP1 was knocked down by siRNA interference in human ovarian cancer SKOV3 cells, and then treated with cisplatin to observe the effect of cisplatin on the apoptosis of the treated SKOV3 cells, so as to evaluate whether the loss of RAD51AP1 affects the killing ability of cisplatin. The specific data were detected by the apoptosis detection kit.

[0039] The results are as follows Figure 2 As shown in the figure; knockdown of RAD51AP1 enhances the killing effect of cisplatin on human ovarian cancer SKOV3 cells. We used siRNA to knockdown the expression of RAD51AP1 in human ovarian cancer SKOV3 cells. The results of cell flow cytometry showed that knockdown of RAD51AP1 can enhance the apoptosis level of SKOV3 cells induced by cisplatin and improve the killing effect of cisplatin on SKOV3 cells.

[0040] In summary, Example 2 explores the role of the RAD51AP1 gene in the resistance of ovarian cancer cells to cisplatin, and verifies by flow cytometry that RAD51AP1 knockdown can improve the efficacy of cisplatin and increase the apoptosis rate of cancer cells. The experimental results provide experimental basis for the role of RAD51AP1 in cisplatin treatment of ovarian cancer, and provide new ideas for exploring therapeutic strategies targeting RAD51AP1 in the future.

[0041] Example 3: Effect of cisplatin combined with RAD51AP1 knockout on subcutaneous tumorigenesis in nude mice

[0042] The main purpose of this experiment is to use nude mice as experimental animals, transplant tumor cells and combine them with drugs to study the effects of cisplatin and RAD51AP1 gene knockout on tumor growth.

[0043] 40 BALB / c nu / nu nude mice, male, 4-6 weeks old, weighing 18-20 g, raised at a specific pathogen-free (SPF) level; each transplant site was inoculated with 1×10 6 After the mice grew for 3 weeks, they were randomly divided into two groups and given intraperitoneal injections of normal saline and cisplatin, respectively, twice a week for 3 consecutive weeks, and the tumor volume of the mice was continuously tracked and measured.

[0044] The experimental results are as follows Figure 3 As shown in the figure, cisplatin combined with RAD51AP1 knockout significantly weakened the subcutaneous tumor formation ability of nude mice. The nude mouse tumor formation results showed that the tumor formation ability of RAD51AP1 knockout strains and cisplatin treatment were significantly reduced, and the tumor formation ability of nude mice treated with combined RAD51AP1 knockout and cisplatin was the lowest.

[0045] The results of this experiment support the importance of the RAD51AP1 gene in tumorigenesis and suggest that its combination with cisplatin may have potential therapeutic advantages. By regulating the RAD51AP1 gene, it may help enhance the efficacy of chemotherapy drugs such as cisplatin, providing new ideas for tumor treatment.

[0046] The embodiments described above are only descriptions of the preferred implementation modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the claims of the present invention.

Claims

1. A chemotherapy resistance marker for ovarian cancer drug resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs, characterized in that: The marker includes RAD51AP1 protein or its encoding gene.

2. Use of a reagent for detecting RAD51AP1 protein or its encoding gene in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs.

3. Use of the reagent for detecting RAD51AP1 protein or its encoding gene according to claim 2 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: The RAD51AP1 protein or its encoding gene is used as a drug resistance marker in the process of treating ovarian cancer with platinum drugs.

4. Use of the reagent for detecting RAD51AP1 protein or its encoding gene according to claim 2 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: The expression of RAD51AP1 protein is upregulated in ovarian cancer patients with drug resistance.

5. Use of the reagent for detecting RAD51AP1 protein or its encoding gene according to claim 2 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: The expression level of RAD51AP1 protein in ovarian cancer patients is negatively correlated with the prognosis of platinum-based drug treatment.

6. Use of the reagent for detecting RAD51AP1 protein or its encoding gene according to claim 2 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: Inhibiting the expression of RAD51AP1 protein in ovarian cancer patients can improve the therapeutic effect of platinum drugs.

7. Use of the reagent for detecting RAD51AP1 protein or its coding gene according to claim 2 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: Products for diagnosing resistance or prognostic assessment of ovarian cancer treated with platinum-based drugs include primers and probes for identifying the RAD51AP1 protein encoding gene, and antibodies for recognizing the RAD51AP1 protein.

8. A method for evaluating platinum drug resistance in the treatment of ovarian cancer, characterized in that: The method comprises evaluating the expression level of RAD51AP1 protein or its encoding gene in ovarian cancer patients treated with platinum drugs.

9. The method for evaluating drug resistance of platinum drugs in the treatment of ovarian cancer according to claim 8, characterized in that: The expression of RAD51AP1 protein or its encoding gene is upregulated in patients with ovarian cancer resistance; among them, the threshold of resistance in immunohistochemistry experiment is 0.026; the threshold of resistance in immunofluorescence experiment is 41.

7.

10. Use of a drug for inhibiting the expression of RAD51AP1 protein or its encoding gene in the preparation of a drug for treating ovarian cancer.

Images