Primer design method of house-keeping gene

Abstract

The invention discloses a primer design method for housekeeping genes, which belongs to the field of primer design methods, and comprises the following steps: acquiring transcriptome expression quantity data of a target species, and downloading an expression gene sequence file of the target species at the same time; processing transcriptome expression quantity data according to a preset screening rule to obtain a proper gene ID number which can be used as a housekeeping gene; according to the gene ID number of the house-keeping gene, searching a corresponding gene sequence in an expression gene sequence file of the target species to obtain a gene sequence of the house-keeping gene; and designing a primer based on the gene sequence of the housekeeping gene, and storing the designed primer sequence to an output file. According to the method, the housekeeping genes with stable expression and high expression are screened through transcriptome data, so that the steps of manual screening and verification are reduced; gene sequence information is processed on a large scale by means of automatic primer design software, a primer design scheme meeting experimental requirements can be rapidly generated, the accuracy of a design result is ensured, and the process is efficient.

Description

Technical Field

[0001] The present invention relates to a primer design method, and in particular to a method for screening and designing housekeeping gene primers based on transcriptome data. Background Art

[0002] Primer is a short, artificially synthesized oligonucleotide sequence used in molecular biology to initiate DNA replication or PCR (polymerase chain reaction) amplification process. They are usually complementary to specific sequences on the DNA template chain and serve as the starting point of the DNA synthesis reaction under the action of DNA polymerase. Primers play a vital role in the PCR reaction. They determine the starting point of the DNA sequence to be amplified and ensure the specificity of the amplified product. The selection and design of primers directly affect the selectivity and efficiency of the PCR reaction. Suitable primers can improve the specificity of the PCR reaction, avoid nonspecific amplification, and ensure the accuracy of the experimental results. The correct pairing and directional extension of primers ensure the complete amplification of the target DNA sequence, which is crucial for subsequent gene cloning, sequencing and other experiments. Primers play a pivotal role in molecular biology experiments such as PCR, and primer design is a complex process that requires comprehensive consideration of multiple factors. In actual operation, appropriate parameters such as primer length, GC content, Tm value, etc. should be selected according to the specific needs and conditions of the experiment, and strict quality control should be carried out to ensure the success of the experiment.

[0003] At present, in the process of PCR detection, housekeeping genes that are applicable to most species are usually selected as internal references, such as GAPDH or β-actin genes. However, for a specific species, what is applicable to most species may not be applicable to a specific species, and even if it is applicable, it may not necessarily be the best control. For example, Zeng Wentao (Zeng Wentao, Chai Chunyue, Dou Daolong. 2015. Screening and verification of internal reference genes suitable for soybean real-time fluorescence quantitative PCR analysis. Journal of Nanjing Agricultural University, 38(5): 787-795.) found that Cons4, ACT11, and TUA are the preferred housekeeping genes for qRT-PCR analysis of soybean gene expression during soybean Phytophthora infection, while Cons15, CYP2, and Cons4 are suitable for housekeeping genes for qRT-PCR analysis of gene expression in different soybean tissues at the seedling stage. Sun Jing (Sun Jing. Screening of qPCR reference genes and expression analysis of flowering-related genes in Dendrobium officinale [D]. Nanjing Normal University, 2017.) proposed that in order to study the functional gene expression in different tissues of Dendrobium officinale, at different growth stages and under abiotic stress conditions, it is necessary to screen the best housekeeping genes or gene combinations under specific experimental conditions. YL Lin (Lin YL, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree. [J]. Plant Science: An International Journal of Experimental Plant Biology, 2010 (4). DOI: 10.1016 / j.plantsci.2010.02.005.) believes that the selection of different housekeeping genes leads to great differences in results. Therefore, the screening of housekeeping genes and the design of their primers in actual use still require experimenters and operators to spend a lot of time to design primers. Generally speaking, designing primers for non-universal housekeeping genes takes at least 5 to 6 hours, from finding the target gene to downloading the sequence, and then to primer design and verification. This is time-consuming and labor-intensive, and delays the progress of the experiment. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a method for screening housekeeping genes and designing primers based on transcriptome data, so as to solve the problem that the existing primer design method for housekeeping genes relies on manual operation and is time-consuming and labor-intensive.

[0005] Technical solution: The method for designing primers based on transcriptome data described in the present invention comprises the following steps:

[0006] Obtain the transcriptome expression data of the target species and download the expressed gene sequence files of the target species;

[0007] Processing the transcriptome expression data according to predetermined screening rules to obtain the gene ID number of the housekeeping gene;

[0008] According to the gene ID number of the housekeeping gene, the corresponding gene sequence is searched in the expression gene sequence file of the target species to obtain the gene sequence of the housekeeping gene;

[0009] Design primers based on the gene sequence of the housekeeping gene, and store the designed primer sequences in output files;

[0010] The present invention screens housekeeping genes with stable and high expression through transcriptome data, reducing the steps of manual screening and verification; by means of large-scale processing of gene sequence information by automated primer design software, primer design schemes that meet experimental requirements can be quickly generated. This automated process significantly improves the design efficiency, and at the same time, through the combination of high-quality data and mature algorithms, the accuracy of the design results is ensured. The method flow is efficient and has a high accuracy rate. Preferably, the transcriptome expression data includes transcriptome expression data of at least two different tissue samples of the target species or transcriptome expression data of at least two different time points of the same tissue of the target species.

[0011] Preferably, the predetermined screening rules include: calculation rule C1, calculation rule C2, calculation rule C3 and screening rule C4;

[0012] Preferably, the calculation rule C1 is expressed as:

[0013]

[0014] Among them, U j is the average expression of the j-th gene in the target species, n is the number of selected tissue samples of the target species or the number of different time points of the same tissue, i is the expression level of the j-th gene in the ith tissue or the ith time point, It represents the sum of the expression levels of a gene in selected tissue samples of the acquired target species or in the same tissue at different time points;

[0015] Preferably, the calculation rule C2 is expressed as:

[0016]

[0017] Among them, σ j is the standard deviation of the jth gene; n is the number of tissue samples of the selected target species or the total number of the same tissue at different time points; x ij is the expression level of the jth gene in the tissue sample of the i-th selected target species or in the same tissue at different time points; U jis the average expression of the jth gene in the target species;

[0018] Preferably, the calculation rule C3 is expressed as:

[0019]

[0020] Wherein, CV is the coefficient of variation;

[0021] Preferably, the screening rule C4 includes:

[0022] Calculate U j The median value is set as the threshold.

[0023] The 10% with the lowest coefficient of variation (CV) and the average expression level (U) were selected. j genes above the median;

[0024] The result of the screening is the gene ID number of the housekeeping gene;

[0025] Preferably, the design rules of the primers include:

[0026] For each gene sequence of the housekeeping gene, return 1 pair of primers;

[0027] The length of primers ranged from 18 ± 3 bp;

[0028] The melting temperature range of the primers was 57.5 ± 2.5°C;

[0029] The content of guanine and cytosine in the primers ranged from 45% to 55%;

[0030] The maximum number of consecutive identical bases allowed is 100;

[0031] Unknown bases in primers are not accepted;

[0032] The maximum length of complementarity within the primers at any position is 8 bp;

[0033] The maximum length of complementarity between primer pairs at any position is 8 bp;

[0034] The length of the target DNA fragment amplified by the primers ranges from 150 to 300 bp.

[0035] Further defined, the optimized length of the primer is 20 bp; the optimized melting temperature of the primer is 57.5° C.; the maximum complementary length of the 3′ end of the primer is 3 bp; and the maximum complementary length of the 3′ end of the primer pair is 3 bp.

[0036] Based on the above method, the present invention further discloses a computer device, including a processor and a memory, wherein the memory stores a plurality of instructions, and the processor is used to read the instructions and execute the steps of the above-mentioned housekeeping gene primer design method based on transcriptome data.

[0037] Based on the above method, the present invention further discloses a computer-readable storage medium, wherein a plurality of instructions are stored in the computer-readable storage medium, and when the instructions are read, the steps of the above-mentioned method for designing housekeeping gene primers based on transcriptome data are executed.

[0038] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0039] 1. The method for screening and designing housekeeping gene primers based on transcriptome data of the present invention screens housekeeping genes with stable and high expression through transcriptome data, thereby reducing the steps of manual screening and verification;

[0040] 2. The present invention uses automated primer design software to process gene sequence information on a large scale, and can quickly generate primer design solutions that meet experimental requirements. This automated process significantly improves design efficiency, and at the same time, through the combination of high-quality data and mature algorithms, ensures the accuracy of the design results. The method and process are efficient, and its advantage is that it can quickly and specifically screen out the adapted housekeeping genes and primers for specific species. The entire housekeeping gene primer design only takes 2 to 3 minutes, which greatly saves working time and has a high accuracy rate, laying a solid foundation for subsequent work. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is a flow chart of the method of the present invention;

[0042] Figure 2 Amplification results of different primers. DETAILED DESCRIPTION

[0043] The technical solution of the present invention is further described below.

[0044] Example 1: A method for screening and designing housekeeping gene primers based on transcriptome data is as follows:

[0045] like Figure 1 As shown, the transcriptome expression data of different tissue samples of the target species or the transcriptome expression data F1 of the same tissue of the target species at different times are obtained, as shown in Table 1 (partial example), the transcriptome data F1 includes the expression data of the transcriptome of two tissues of the target species (1) LEAF (green plum leaf tissue) and ROOT (green plum root tissue) at three different time points, which were repeated three times. The target species is selected according to actual requirements.

[0046] Table 1 Transcriptome expression data of LEAF (green plum leaf tissue) and ROOT (green plum root tissue)

[0047]

[0048] According to the predetermined screening rules, the transcriptome expression data is processed to obtain the appropriate gene ID number that can be used as the housekeeping gene. The screening environment includes:

[0049] Calculation rule C1, calculation rule C2, calculation rule C3 and screening rule C4;

[0050] The expression of the calculation rule C1 is:

[0051]

[0052] Among them, U j is the average expression of the j-th gene in the target species, n is the number of selected tissue samples of the target species or the number of different time points of the same tissue, i is the expression level of the j-th gene in the ith tissue or the ith time point, It represents the sum of the expression levels of a gene in selected tissue samples of the acquired target species or in the same tissue at different time points;

[0053] The expression of the calculation rule C2 is:

[0054]

[0055] Among them, σ j is the standard deviation of the jth gene; n is the number of tissue samples of the selected target species or the total number of the same tissue at different time points; x ij is the expression level of the jth gene in the tissue sample of the i-th selected target species or in the same tissue at different time points; U j is the average expression of the jth gene in the target species;

[0056] The expression of the calculation rule C3 is:

[0057]

[0058] The screening rule C4 includes:

[0059] Calculate U j The median value is set as the threshold.

[0060] The 10% with the lowest coefficient of variation (CV) and the average expression level (U) were selected. j genes above the median;

[0061] The screening result is the gene ID number of the housekeeping gene.

[0062] According to the gene ID number of the housekeeping gene, the corresponding gene sequence is searched in the expression gene sequence file of the target species to obtain the gene sequence of the housekeeping gene;

[0063] The corresponding gene sequence is searched in the expression gene sequence file of each sample to obtain the gene sequence of the housekeeping gene. An example (part) of the expression sequence file F2 of the obtained housekeeping gene is as follows:

[0064] >NM_001293250.1 103330316|Prunus mume carbonyl reductase[NADPH]2(LOC103330316),

[0065] mRNA

[0066]

[0067] >NM_001293251.1 103342359|Prunus mume caffeic acid 3-O-methyltransferase-like(OMT1),

[0068] mRNA

[0069]

[0070] >NM_001293252.1 103332890|Prunus mume expansin-A8(LOC103332890),mRNA

[0071]

[0072] >NM_001293253.1 103318827|Prunus mume protein HEADING DATE 3A(LOC103318827),mRNA

[0073] ATGCCTAGGGACAGGGATCCTCTTGTTGTTGGAAGAGTGGTAGGTGATGTTTTAGACCCGTTTACAAGGTCTGTTTCTCTCAGGGTCACTTACGGTTTGAAGGAGGTTAACAATGGTTGCGAGCTCAAACCTTCCCAAGTTGTCCAACAACCTAGAGTTGATATTGGTGGGGATGATCTTAGGACTTTCTACACTCTGGTCATGGTGGATCCTGATGCACCCAGCCCAAGTGACCCCAACCTAAAGGAATATTTGCATTGGTTGGTTACGGATATACCAGCAACAACGGCGGCAAGCTTTGGGCAAGAGATTGTGTGTTATGAAAGCCCACGGCCAACGGTGGGGATTCATCGCTTTGTTTTGGTGTTATTTCGGCAATTGGGTAGGCAAACAGTGTATGCTCCGGGGTGGCGCCAGAACTTTAATACTAGAGACTTTGCGGAGCTTTACAATCTTGGATTACCGGTATCTGCCGTCTATTTTAACTGCCAAAGGGAGAGCGGCTCTGGAGGGAGGAGAAGATAA

[0074] >NM_001293254.1 103329345|Prunus mume 1-aminocyclopropane-1-carboxylate oxidase(LOC103329345),mRNA

[0075]

[0076] >NM_001293255.1 103323462|Prunus mume(R)-mandelonitrile lyase 2(LOC103323462),mRNA

[0077]

[0078] >NM_001293256.1 103325270|Prunus mume aquaporin PIP2-2(LOC103325270),mRNA

[0079]

[0080] >NM_001293257.1 103339352|Prunus mume 1-acyl-sn-glycerol-3-phosphateacyltransferase 2(LOC103339352),mRNA

[0081]

[0082] The proofreading file F3 obtained by comparing the file F1 with the proofreading rules is as follows:

[0083] >NM_001293257.1 103339352|Prunus mume 1-acyl-sn-glycerol-3-phosphateacyltransferase 2(LOC103339352),mRNA

[0084]

[0085] >XM_008219920.2 103318531|PREDICTED:Prunus mume superoxide dismutase[Cu-Zn](LOC103318531),transcript variant X1,mRNA

[0086]

[0087] >XM_008219937.2 103318540|PREDICTED:Prunus mume translationinitiation factor eIF-2Bsubunit epsilon-like(LOC103318540),mRNA

[0088]

[0089] >XM_008219940.2 103318545|PREDICTED:Prunus mume probable serine / threonine-protein kinaseAt1g54610(LOC103318545),transcript variant X1,mRNA

[0090]

[0091] >XM_008219941.1 103318545|PREDICTED:Prunus mume probable serine / threonine-protein kinaseAt1g54610(LOC103318545),transcript variant X2,mRNA

[0092]

[0093] >XM_008219943.2 103318546|PREDICTED:Prunus mume probable nucleolarprotein 5-2(LOC103318546),mRNA

[0094]

[0095] Primers are designed based on the gene sequence of the housekeeping gene obtained above, wherein the primer design rules include:

[0096] C31: For each housekeeping gene sequence, return a pair of primers;

[0097] C32: The optimized length of the primer is 20 base pairs;

[0098] C33: Primer length range is 18 ± 3 bp;

[0099] C34: The optimized melting temperature (Tm) of the primer is 57.5°C;

[0100] C35: The melting temperature (Tm) range of the primers is 57.5°C ± 2.5°C;

[0101] C36: The guanine (G) and cytosine (C) content (GC content) in the primer ranges from 45% to 55%;

[0102] C37: The maximum number of consecutive identical bases allowed (such as AAAAA...) is 100;

[0103] C38: does not accept unknown bases (N) in the primer;

[0104] C39: The maximum length of complementarity within the primer at any position is 8 bp;

[0105] C310: The maximum complementary length of the primer 3' end is 3 bp;

[0106] C311: The maximum length of complementarity between primer pairs (i.e., cross-pairing between forward and reverse primers) at any position is 8 bp;

[0107] C312: The maximum complementary length of the primer pair at the 3' end is 3 bp;

[0108] C313: The length of the target DNA fragment amplified by the primers should range from 150 to 300 bp;

[0109] The primer sequences designed according to the above primer design rules are saved in the output file F3. The primer sequences in the output file F3 are as follows:

[0110] LOC103339352_s:TAGGGCTCGCTCGTTAAATC;

[0111] LOC103339352_a:TGCCACCACTCTGTTTATCC;

[0112] Where LOC103339352 represents the gene ID, S represents the forward sequence, a represents the reverse sequence, TAGGGCTCGCTCGTTAAATC and TGCCACCACTCTGTTTATCC represent the specific primer base compositions;

[0113] The specific primer file F4 is as follows (part):

[0114] LOC103339352_s:TAGGGCTCGCTCGTTAAATC

[0115] LOC103339352_a:TGCCACCACTCTGTTTATCC

[0116] LOC103318531_s:ATTGGTAGGGCGATTGTTGT

[0117] LOC103318531_a:TGTTCGGGTTCCCTCTCAAAG

[0118] LOC103318540_s:GGACTTATCCTTTGGGTGCCA

[0119] LOC103318540_a:TAGCTTTGCAGCCATTCTTCAA

[0120] LOC103318545_s:TTGACAGAAGGCGCCTAATT

[0121] LOC103318545_a:TTGATGTTTCTCGGGCATCA

[0122] LOC103318546_s:ACCATGCATCCTTGATTGGT

[0123] LOC103318546_a:CTTGCGATCCTTGTCGTAGA

[0124] LOC103318558_s:ACAGGGGAATCACGATGATG

[0125] LOC103318558_a:CCTTGGTCCAACTACTTCCC

[0126] 5'-adenosyl_s:GTGAAGTGAAGCGCTTTGTT

[0127] 5'-adenosyl_a:CTGTCCTTCCTGTCCTTGTC

[0128] LOC103318617_s:CAGATGTACAAGCAAGCTGC

[0129] LOC103318617_a:TTTTGCAAGCTGTCCAATGG

[0130] LOC103318618_s:GCAACTAGATTAGCCGCTCT

[0131] LOC103318618_a:AGATTTCCACTCTCCTCGGA

[0132] LOC103318625_s:GTCTGGAGTTGAATGCCTCA

[0133] LOC103318625_a:ACCTTCCTCTTCAGGTCCTT

[0134] 4_s:TGTTGCTTTGGATGCTTTGG

[0135] 4_a:TGATGTGCGTAACCCATCAA

[0136] LOC103318639_s:CTGTCCACTCAAAGATCCCC

[0137] LOC103318639_a:TTCCCAATACTCTTGCCCAC

[0138] LOC103318645_s:GAGCTTGGAAAGATGGTCCA

[0139] LOC103318645_a:TTCTTGCCTGAGGAATCACC

[0140] LOC103318650_s:GGAAGACCAGCAGAACATCA

[0141] LOC103318650_a:CGCCTCTTTCATCTCTTCGA

[0142] LOC103318657_s:AAGCCAGAAATGATCAGCCA

[0143] LOC103318657_a:TGAAATCCTACAAGGCGGTC

[0144] LOC103318662_s:TGTTGAAGTAGTGGGTGACG

[0145] LOC103318662_a:TGGACCCCATTGTTGATGAG

[0146] LOC103318670_s:GGCATTCAGGTCATCATTGC

[0147] LOC103318670_a:GACAGTAGATCAGCATCGCA

[0148] LOC103318677_s:CGTACGTACTGACCTTGGAG

[0149] LOC103318677_a:ATCACCCTTTACACCAGCAG

[0150] LOC103318681_s:CGGCCTAAACCCTCTGTATC

[0151] LOC103318681_a:TGCCATTGCAGCTTCTAGAA

[0152] LOC103318684_s:GGGGTTCCGAGTTGTTGTAT

[0153] LOC103318684_a:TCTAAAGCAGCAGTTCTGGG

[0154] LOC103318696_s:ACAGCATTCACAGCCATGTA

[0155] LOC103318696_a:CTGGCTGTTACACCATGACT

[0156] LOC103318697_s:GTCGTCATCGTCCTACTTCC

[0157] LOC103318697_a:AATCGTCTGTGCATCCCTTT

[0158] LOC103318702_s:CTGTCCATGGCAACTCTTCT

[0159] LOC103318702_a:TAGTTCATTTGGAGGTGGGC

[0160] LOC103318703_s:CTGGATTGCCCTCTCTTTGT

[0161] LOC103318703_a:CATGCAGCATCACATCCTTG

[0162] LOC103318704_s:CCCGTATCTGAAAACCCACA

[0163] LOC103318704_a:GACAGCCTCAAATCTGGGAA

[0164] LOC103318707_s:AAAACAAGAAGCCGTGAACG

[0165] LOC103318707_a:TTCAGCAGATTGGTACCACC

[0166] LOC103318710_s:GCCTGATCTCCGTAAGAAGG

[0167] LOC103318710_a:AATCCTTGGCCACAGATCAG

[0168] LOC103318742_s:AAGGCTCTCAGCACTTAACC

[0169] LOC103318742_a:CAGCCTTGAAGAACCTGGAT

[0170] LOC103318747_s:CTGGTACTGCTCGTGGATAC

[0171] LOC103318747_a:CCATGCAGGGTTCTTACTGT

[0172] LOC103318752_s:TGGACCATCTCATCCTCCAT

[0173] LOC103318752_a:CACCAAGGTTGAGCAACAAG

[0174] LOC103318763_s:GGACCAGGATGTGTCAATGT

[0175] LOC103318763_a:AGCCTCGTACTCCTCTTCTT

[0176] LOC103318765_s:TGCCATTGCAGGTTATGAGT

[0177] LOC103318765_a:TGCCTCCAACAATAGGTGAC

[0178] LOC103318764_s:ATTGGCTGTTGAGAACGAGT

[0179] LOC103318764_a:GCAACTCTTCGATGATTGGC

[0180] LOC103318769_s:ATGAACTCGTGCAGTGAAGT

[0181] LOC103318769_a:GTCAACATGCTTTCTCTCGC

[0182] LOC103318777_s:ATTCCCTCGACATTGTTGCT

[0183] LOC103318777_a:GATTGGCAGCAAGGCTATTG

[0184] LOC103318779_s:CGAGGTCGAAAGAGAGATGG

[0185] LOC103318779_a:TTAACCCTACAGCAGCCAAG

[0186] LOC103318798_s:ACAAAGTCCAAATGCAGTGC

[0187] LOC103318798_a:CAAAAGTTTGCCTCCCCTTG

[0188] LOC103318800_s:CTGAGAATGGGTTCCTGCTT

[0189] LOC103318800_a:CAAGAACATTCTCCCGGGAA

[0190] LOC103318808_s:CATCTGGGTCGTCGTCTAAG

[0191] LOC103318808_a:ATCCACTTCAGGCAAAGGAG

[0192] LOC103318809_s:TCGTTTCTCGTTCACACCAT

[0193] LOC103318809_a:GGAGGGAGTTGAAGAAAGGG

[0194] LOC103318823_s:GTCAACAACGCCGATAACTG

[0195] LOC103318823_a:CGGGCAGAGTATTCTCCTTC

[0196] LOC103318824_s:AGCTTTACACGAAGGATGCA

[0197] LOC103318824_a:CCCAGCATGAGAAACTGAGT

[0198] LOC103318831_s:AAAGGCAGATGTTGAGGAGG

[0199] LOC103318831_a:CCGTGCAGTATCATCATCCA

[0200] LOC103318838_s:ACTTCCCTCCCAAATTCGTC

[0201] LOC103318838_a:ATCAGGGAATATTCGCGACC

[0202] LOC103318854_s:TAGTGGCGATTTGAAGGCTT

[0203] LOC103318854_a:CATGGCCATTGCTTGATCAG

[0204] LOC103318884_s:GGACTGCCGAAGAGAATAGG

[0205] LOC103318884_a:TCTGAGCCAATTTCAGGTCC

[0206] LOC103318894_s:ATTCAGGCAATCGAAGGGTT

[0207] LOC103318894_a:AAGGTCTGCTTGGATTCCAG

[0208] LOC103318895_s:GCCATCCAAACATCATTCGG

[0209] LOC103318895_a:ACTCCCGA

[0210] LOC103318896_s:CTACCACTGGCAATGGACTT

[0211] LOC103318896_a:ATTCCTAAGCCGAGGCAAAA

[0212] LOC103318899_s:GGGAGTTCTTCTTCCAAGGG

[0213] LOC103318899_a:GGTCATCTCACGCAATGTTG

[0214] LOC103318898_s:GAAAAGACCGAACAGGACCT

[0215] LOC103318898_a:ATCTTCCAAGCACTGCATCA

[0216] LOC103318931_s:AGCCTAAGGGGGGG

[0217] LOC103318931_a:CTGTGTTCCTGAAGCATCCT

[0218] LOC103318933_s:GTTGGAGCAAAACCCAGTTC

[0219] LOC103318933_a:GGTGCTCAAGAACCAAAACC

[0220] LOC103318937_s:TGAGGCATGGGAAGTTAACC

[0221] LOC103318937_a:CAACTGCACCACCATGA

[0222] LOC103318941_s:HOLDERAAAAGGCGCT

[0223] LOC103318941_a:GTAGGGCGGAATGAGAGTG

[0224] LOC103318946_s:AATGTGCAACTGAGGGGTAG

[0225] LOC103318946_a:TGCCACGATTGAACCCAATA

[0226] LOC103318948_s:CTCCTCTCGACGGGTTAATG

[0227] LOC103318948_a:GCATTTTTCCAACACGACCA

[0228] LOC103318950_s:TGGGGAGTGGTATGATGCTA

[0229] LOC103318950_a:ATTGCTTGTTTTGTGGCCTC

[0230] LOC103318955_s:TGATGAAGCGGGACATGAAA

[0231] LOC103318955_a:TGCAGCAGAGAAATCACCAT

[0232] LOC103318967_s:ATTTTTGCCCTGAAACCAGC

[0233] LOC103318967_a:ACGAGCTTCACTTGCCAATA

[0234] LOC103318969_s:ACCTTTTGGAAGAACTGGCA

[0235] LOC103318969_a:AAGAATAAGCACGTCAGCCA

[0236] LOC103318972_s:AAAGGGTGCTAGAGACGTTG

[0237] LOC103318972_a:CAGCTTTTTCCTGCCGAAAA

[0238] LOC103318985_s:GATCAATTGGCCGGACAATG

[0239] LOC103318985_a:ACCTGCAGTATGAAATGCCA

[0240] LOC103318990_s:TTCAGCCCCAAGAATACACC

[0241] LOC103318990_a:AGGCAAGATTAAGTGCTGCT

[0242] LOC103318992_s:TCCGACTGCAACTCAATCAA

[0243] LOC103318992_a:CAGCTTGACTGTCTTCCCAT

[0244] LOC103318994_s:CCCTCATAGTTGCGGAGTAC

[0245] LOC103318994_a:TTGCTCTCAAAGATGGGACC

[0246] LOC103318995_s:TGTATGCAGTGAAGGGACAC

[0247] LOC103318995_a:CGAGCAACATAACGTGCAAT

[0248] LOC103318997_s:TAGCTGCTGAGGTTCAAAGG

[0249] LOC103318997_a:GCCCCACTGGTTTGATCTTA

[0250] LOC103318999_s:GGTTGCAGGTGAAGGAAAAC

[0251] LOC103318999_a:CAACATGCATGCTACGAAGG

[0252] LOC103319004_s:GAGACAGAAAGAAGCCCGAA

[0253] LOC103319004_a:CATCTTCTCTTTTGGCAGCG

[0254] LOC103319019_s:TTATGGGAATTGACGGCCAA

[0255] LOC103319019_a:TCTGCTTGGAAGATTGCCAT

[0256] LOC103319024_s:GGCACCCATCCCTTCTTAAA

[0257] LOC103319024_a:GGGCCACATTCTCTTCAGAA

[0258] LOC103319029_s:ATCAACATCCAGGGACACAC

[0259] LOC103319029_a:CCTTGTAAGCCTCTTGAGCA

[0260] LOC103319031_s:AGGAAATGTAGTGCGCTTGA

[0261] LOC103319031_a:TCAAGCCCTGTTTCTCCATC

[0262] LOC103319037_s:GCCTTCTCCCTGGATTTCAA

[0263] LOC103319037_a:AGCATAAGGGCGATCAGATG

[0264] LOC103319039_s:GGCATGGGAGTCTTCTTTGA

[0265] LOC103319039_a:TCAACCTGATCCTGCCTTTC

[0266] LOC103319049_s:ACAAGGAGGAAATGGAGCTG

[0267] LOC103319049_a:CAGAGGCTCATTGTCAAGGT

[0268] LOC103319063_s:TGTTGGTGCTATTCCTCCAC

[0269] LOC103319063_a:TCCAGCGGCATAGTCATTAC

[0270] LOC103319070_s:ATGAGCGGAAGGGAACAATT

[0271] LOC103319070_a:CAGCAGCTTCTTCCACCTTA

[0272] LOC103319067_s:ACTGTTTGGTGAAGCAAGGA

[0273] LOC103319067_a:GGAGGTTCCCAGGTAGATCT

[0274] LOC103319075_s:TTCTCCTACAGCCAGATCCA

[0275] LOC103319075_a:TCCCGCTTCTTTAAAGCTGT

[0276] LOC103319076_s:AACCCTTAATAAACCCGCGT

[0277] LOC103319076_a:GGGTTGGGTTGTTCTTGTTG

[0278] LOC103319080_s:AAGGTGGGAAAATGTGTGGT

[0279] LOC103319080_a:GTTCCCACGGGATAAAAGGT

[0280] LOC103319084_s:AGTTCGGTTGCCATCATCTT

[0281] LOC103319084_a:ACATGCCAGGTAGTTTCCAG

[0282] LOC103319096_s:CTCTTCGCTTCTCTCGTCTC

[0283] LOC103319096_a:CTTGCATCCTCCTCAACAGT

[0284] LOC103319100_s:GGAGTCTTGAAAGGCTTCGA

[0285] LOC103319100_a:CGCTCTATGGCTTTGCTTTC

[0286] LOC103319108_s:CATGGAGCCCTTCTTTGTCT

[0287] LOC103319108_a:TAGAAACAACATCCCCAGGC

[0288] Primers are synthesized and prepared according to the sequence data in the output file F3. This method is used for housekeeping gene screening and primer design. Its advantages are rapidity and specificity. It only takes 2 to 3 minutes to design the most suitable housekeeping gene primers for a specific species using this method.

[0289] From the green plum data, 87 pairs of housekeeping gene primers were designed in batches according to the above method. Five pairs of genes (LOC103318684, LOC103318710, LOC103318764, LOC103318777, LOC103318838) and the traditionally used GAPDH or β-actin genes were randomly selected and amplified in samples (LEAF1, LEAF2, LEAF3, ROOT1, ROOT2, ROOT3). The experiment was repeated 3 times. The results are shown in Figure 2 shown.

[0290] The CT value statistics of the test results are as follows:

[0291] Table 2 Amplification results of different housekeeping gene primers

[0292] LEAF1 LEAF2 LEAF3 ROOT1 ROOT2 ROOT3 LOC103318684 17.59 17.75 17.39 17.51 17.03 17.1 LOC103318710 17.58 17.21 17.63 17.47 17.31 17.43 LOC103318764 20.62 20.42 20.55 20.99 20.63 20.31 LOC103318777 24.53 24.97 24.93 24.76 24.84 25.49 LOC103318838 26.12 27.25 26.21 26.69 26.43 27.4 GAPDH 28.57 28.57 28.12 27.35 27.2 28.65 β-actin 21.53 21.57 21.65 21.73 22.71 22.29

[0293] From the statistical results of CT values, LOC103318684, LOC103318710, LOC103318764, LOC103318777, and LOC103318838, as internal reference genes, have relatively smaller CT values ​​than GAPDH and β-actin, indicating that their expression levels are higher in the samples and easier to amplify. At the same time, their CT value coefficients of variation in each sample are smaller than those of GAPD and β-actin, indicating that they are more stable. These two points ensure that the selected genes have better accuracy and stability than traditional general housekeeping genes.

[0294] The method provided by the present invention can be implemented in the following terminal environment, and the terminal may include one or more of the following components: a processor, a memory, and a display screen. The memory stores at least one instruction, and the instruction is loaded and executed by the processor to implement the method described in the following embodiment.

[0295] The processor may include one or more processing cores. The processor uses various interfaces and lines to connect various parts of the entire terminal, and executes various functions of the terminal and processes data by running or executing instructions, programs, code sets or instruction sets stored in the memory, and calling data stored in the memory.

[0296] The memory may include random access memory (RAM) or read-only memory (ROM). The memory may be used to store instructions, programs, codes, code sets or instructions.

[0297] In addition, those skilled in the art can understand that the structure of the above terminal does not constitute a limitation on the terminal, and the terminal may include more or fewer components, or combine certain components, or arrange the components differently. For example, the terminal also includes components such as a radio frequency circuit, an input unit, a sensor, an audio circuit, and a power supply, which will not be described in detail here.

Claims

1. A method for designing primers for housekeeping genes, characterized in that: The steps include: Obtain the transcriptome expression data of the target species and download the gene expression sequence files of the target species; Processing the transcriptome expression data according to predetermined screening rules to obtain the gene ID number of the housekeeping gene; According to the gene ID number of the housekeeping gene, the corresponding gene sequence is searched in the gene expression sequence file of the target species to obtain the gene sequence of the housekeeping gene; Primers are designed based on the gene sequence of the housekeeping gene, and the designed primer sequences are stored in output files.

2. The primer design method for the housekeeping gene according to claim 1, characterized in that: The transcriptome expression data include transcriptome expression data of at least two different tissue samples of the target species or transcriptome expression data of at least two different time points of the same tissue of the target species.

3. The primer design method for the housekeeping gene according to claim 1, characterized in that: The predetermined screening rules include: calculation rule C1, calculation rule C2, calculation rule C3 and screening rule C4; The expression of the calculation rule C1 is: Among them, U j is the average expression of the j-th gene in the target species, n is the number of selected tissue samples of the target species or the number of different time points of the same tissue, i is the expression level of the j-th gene in the ith tissue or the ith time point, It represents the sum of the expression levels of a gene in selected tissue samples of the acquired target species or in the same tissue at different time points; The expression of the calculation rule C2 is: Among them, σ j is the standard deviation of the jth gene; n is the number of tissue samples of the selected target species or the total number of the same tissue at different time points; x ij is the expression level of the jth gene in the tissue sample of the i-th selected target species or in the same tissue at different time points; U j is the average expression of the jth gene in the target species; The expression of the calculation rule C3 is: Wherein, CV is the coefficient of variation; The screening rule C4 includes: Calculate U j The median value is set as the threshold. The 10% with the lowest coefficient of variation (CV) and the average expression level (U) were selected. j genes above the median; The screening result is the gene ID number of the housekeeping gene.

4. The primer design method for the housekeeping gene according to claim 1, characterized in that: The design rules of the primers include: For each gene sequence of each housekeeping gene, return 1 pair of primers; The length of primers ranged from 18 ± 3 bp; The melting temperature range of the primers was 57.5 ± 2.5°C; The content of guanine and cytosine in the primers ranged from 45% to 55%; The maximum number of consecutive identical bases allowed is 100; Unknown bases in primers are not accepted; The maximum length of complementarity within the primers at any position is 8 bp; The maximum length of complementarity between primer pairs at any position is 8 bp; The length of the target DNA fragment amplified by the primers ranges from 150 to 300 bp.

5. The method for designing primers for housekeeping genes according to claim 4, characterized in that: The optimized length of primers is 20 bp; The optimized melting temperature of the primers was 57.5°C; The maximum complementary length of the primer 3′ end is 3 bp; The maximum complementary length at the 3' end of the primer pair is 3 bp.

6. A computer device, characterized in that: It comprises a processor and a memory, wherein the memory stores a plurality of instructions, and the processor is used to read the instructions and execute the steps of the primer design method for the housekeeping gene as described in any one of claims 1 to 5.

7. A computer-readable storage medium, characterized in that: The computer-readable storage medium stores a plurality of instructions, and when the instructions are read, the steps of the primer design method for the housekeeping gene according to any one of claims 1 to 5 are executed.

Images