Preparation method of nutritional rice and nutritional rice

Abstract

The invention provides nutritional rice and a preparation method thereof, and relates to the technical field of food processing. The preparation method provided by the invention comprises the following steps: performing extrusion puffing on rice powder to obtain puffed rice; the method comprises the following steps: culturing aspergillus oryzae in a culture medium containing organic iron for 48-72 hours, and collecting to obtain composite aspergillus oryzae; the compound aspergillus oryzae is inoculated into puffed rice with the water content of 35-50%, fermentation treatment is carried out in a fermentation environment under a magnetic field of 0.3 mT to 0.4 mT, and drying and mildew killing are carried out to obtain the nutritional rice. According to the method, the enzyme activity and the nutrient content of the colored rice after the colored rice is fermented by the aspergillus oryzae can be improved, and the release of nutrient substances of the colored rice can be effectively promoted.

Description

Technical Field

[0001] The invention relates to the technical field of food processing, and in particular to a preparation method of nutritious rice and the nutritious rice. Background Art

[0002] Nutritious rice is a rice food obtained by artificially processing and transforming ordinary colored rice through physical, chemical or biological means. It not only retains the basic nutrients of colored rice, such as carbohydrates, proteins and fats, but also adds a variety of active ingredients that are beneficial to the human body. In addition, artificial processing can make colored rice that was originally difficult to digest by the human body easier to be absorbed and utilized by the human body.

[0003] Traditional nutritious rice processing mainly involves grinding colored rice particles into powder, and then reshaping them into rice-shaped products by adding various nutrients to meet people's dietary nutritional needs. However, this method only adds nutrients and does not fully release the nutrients of the colored rice itself, so there is an urgent need to provide a solution to improve the above problem. Summary of the invention

[0004] The purpose of the present invention is to provide a preparation method and application of nutritious rice.

[0005] In a first aspect, the present invention provides a method for preparing nutritious rice, comprising the following steps:

[0006] Extruding and puffing rice powder to obtain puffed rice;

[0007] The Aspergillus oryzae is cultured in a medium containing organic iron for 48 hours to 72 hours, and then the composite Aspergillus oryzae is collected;

[0008] The composite Aspergillus oryzae is inoculated into puffed rice with a water content of 35-50%, and fermented in a fermentation environment and a magnetic field of 0.3mT-0.4mT, and dried and sterilized to obtain nutritious rice.

[0009] Optionally, the water content of the rice powder is 30%-35%.

[0010] Optionally, the rice powder is sieved through a 40-mesh sieve in advance.

[0011] Optionally, the rice powder is subjected to multi-temperature zone extrusion puffing.

[0012] Optionally, the rice in the rice powder includes at least one of brown rice, purple rice, black rice, rice and red rice.

[0013] Optionally, the extrusion puffing is followed by drying at 40°C-50°C.

[0014] Optionally, the organic iron includes at least one of iron amino acid chelate, iron gluconate, iron lactate, iron fumarate, iron citrate, and iron polysaccharide chelate.

[0015] Optionally, the concentration of the organic iron in the culture medium is 10 mg / L-200 mg / L.

[0016] Optionally, the culture medium comprises potato dextrose medium.

[0017] Optionally, the initial inoculation density of Aspergillus oryzae in the culture medium is 10 4 cfu / mL-10 6 cfu / mL.

[0018] Optionally, culturing Aspergillus oryzae in a culture medium containing organic iron includes an induction stage, a consolidation stage and a reinforcement stage, and the organic iron concentration in the culture medium increases in a gradient during the induction stage, the consolidation stage and the reinforcement stage.

[0019] Optionally, Aspergillus oryzae and lactic acid bacteria are co-cultured in a culture medium containing organic iron and then centrifuged to obtain composite Aspergillus oryzae.

[0020] Optionally, the inoculation amount of the composite Aspergillus oryzae in the puffed rice is 3×10 7 cfu / g-4×10 7 cfu / g.

[0021] Optionally, the temperature of the fermentation environment is 34°C-38°C.

[0022] Optionally, the humidity of the fermentation environment is 90%-95%.

[0023] Optionally, the fermentation environment is a light-proof environment.

[0024] Optionally, the frequency of the magnetic field is 50 Hz-100 Hz.

[0025] Optionally, the composite Aspergillus oryzae is inoculated into the puffed rice for fermentation treatment for 48-72 hours.

[0026] Optionally, during the fermentation process, the magnetic field is intermittently applied to the composite Aspergillus oryzae, and the interval between two adjacent magnetic fields is 4-6 hours.

[0027] Optionally, the Aspergillus oryzae is Aspergillus oryzae M6, which has been deposited in the China Center for Type Culture Collection on April 12, 2023, with a deposit number of CCTCC NO: M2023533, and the deposit address is Wuhan University, Wuhan, China.

[0028] In a second aspect, the present invention also provides nutritious rice prepared by any of the above optional preparation methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The present invention provides a flow chart of a method for preparing nutritious rice. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Unless otherwise defined, the technical terms or scientific terms used herein should be the common meanings understood by people with general skills in the field to which the present invention belongs.

[0031] See also Figure 1 The present invention provides a method for preparing nutritious rice, comprising the following steps:

[0032] S1, extruding and puffing rice powder to obtain puffed rice;

[0033] S2, culturing Aspergillus oryzae in a medium containing organic iron for 48h-72h and then collecting the composite Aspergillus oryzae;

[0034] S3, inoculating the composite Aspergillus oryzae into puffed rice with a moisture content of 35-50%, and fermenting the rice in a fermentation environment and a magnetic field of 0.3mT-0.4mT, and drying and sterilizing the rice to obtain nutritious rice.

[0035] In fact, by extruding and puffing the rice powder in step S1, the starch in the rice powder can be gelatinized and the protein can be denatured, and the molecular structure becomes looser, which is conducive to the decomposition and utilization by the composite Aspergillus oryzae in step S3, thereby effectively improving the production of nutrients in the composite Aspergillus oryzae during the fermentation process, and is conducive to the composite Aspergillus oryzae releasing more beneficial metabolic substances. In addition, the specific surface area of ​​the puffed rice after puffing is increased, which provides more attachment sites for the composite Aspergillus oryzae, which further promotes the growth and reproduction of the composite Aspergillus oryzae.

[0036] In fact, culturing Aspergillus oryzae in a culture medium containing organic iron in step S2 can promote Aspergillus oryzae to absorb organic iron, and then integrate the iron element into the fermentation product during the fermentation process, thereby effectively increasing the iron content in the fermentation product, which is of positive significance for preventing and improving iron deficiency-related diseases. In addition, organic iron can also greatly promote the growth and reproduction of Aspergillus oryzae and enhance the activity of protease, amylase and cellulase secreted by Aspergillus oryzae.

[0037] In some embodiments, the execution order of step S1 and step S2 can be changed arbitrarily, for example, step S2 can be executed first, and then step S1 can be executed, or Figure 1 In fact, when the composite Aspergillus oryzae is obtained after executing step S2, the composite Aspergillus oryzae can be stored at low temperature.

[0038] In some embodiments, the water content of the rice powder used in step S1 is 30%-35%. In fact, by extruding and puffing the rice powder, the water in the rice is vaporized under the action of high temperature, high pressure and high shear force, thereby generating a strong steam pressure. When the steam pressure exceeds the strength limit of the rice powder, a porous puffed structure is formed, which is beneficial for regulating the volume and porous structure after puffing during blasting.

[0039] In some embodiments, the source of the rice powder used in step S1 includes at least one of brown rice, purple rice, black rice, rice and red rice. In fact, by puffing the rice, it is helpful to loosen the rice that is originally difficult to digest and hard in texture, which is conducive to eating and digesting. In fact, when the rice powder is extruded and puffed, the extrusion and puffing parameter setting is related to the particle size of the rice powder and the type of rice.

[0040] At the same time, before executing step S1 to extrude and puff the rice powder, the rice powder is pre-sieved through a 40-mesh sieve. This is beneficial for controlling the consistency of the particle size of the rice powder after puffing. It is also beneficial for controlling the consistency of parameters during the extrusion and puffing process to avoid the situation where the rice powder with larger particles has not been fully puffed and the rice powder with smaller particles has been over-puffed.

[0041] In some embodiments, when the rice powder is extruded and puffed in step S1, the rice powder is extruded and puffed in multiple temperature zones. In fact, by heating in multiple temperature zones, the temperature of the rice powder at different stages can be accurately controlled, so that the rice powder passes through different temperature zones in sequence during the extrusion process, so that the powder is heated more evenly, which helps to achieve a more uniform puffing effect, and at the same time can reduce the loss of nutrients in the rice powder and reduce the damage of heat-sensitive nutrients.

[0042] In some embodiments, when performing multi-temperature zone extrusion puffing on the rice powder in step S1, extrusion puffing in five temperature zones may be performed, and the temperatures of the five temperature zones may be 60-80° C., 90-110° C., 160-180° C., 160-180° C., and 160-180° C., respectively. After performing multi-temperature zone extrusion puffing, substances with unique flavors may be produced at different temperature and time combinations, giving the puffed rice a rich aroma and taste, and at the same time, substances with bad flavors in the rice powder may be removed.

[0043] In some embodiments, when performing step S2 and culturing Aspergillus oryzae in a culture medium containing organic iron, the organic iron added in the culture medium includes at least one of iron amino acid chelate, iron gluconate, iron lactate, iron fumarate, iron citrate, and iron polysaccharide chelate. In fact, these organic iron compounds are conducive to the absorption and utilization of Aspergillus oryzae. In fact, different organic irons can also be selected to cooperate in different growth stages of Aspergillus oryzae, for example, by adding iron gluconate in the growth stage, it can be better absorbed and utilized.

[0044] In some embodiments, when performing step S2 to culture Aspergillus oryzae in a culture medium containing organic iron, the concentration of organic iron in the culture medium is 10 mg / L-200 mg / L. In fact, organic iron within this concentration range can provide an appropriate amount of iron element for Aspergillus oryzae, thereby meeting the growth and metabolic needs of Aspergillus oryzae, while when the organic iron concentration is too low, it cannot provide sufficient iron element for Aspergillus oryzae to absorb, and when the organic iron concentration is too high, it will cause oxidative stress in Aspergillus oryzae, and produce too many active oxygen free radicals to damage Aspergillus oryzae.

[0045] In some embodiments, the culture medium for adding organic iron can be a potato dextrose culture medium, specifically, the potato dextrose culture medium includes potatoes, glucose and agar. In fact, the culture medium can be a common culture medium commonly used in the art for growing and culturing Aspergillus oryzae, and can be a commercially available product, or can be synthesized in the laboratory using conventional steps and conventional raw materials.

[0046] In some embodiments, when performing step S2, the initial inoculation density of Aspergillus oryzae in the culture medium containing organic iron is 10 4 cfu / mL-10 6 In fact, by controlling the initial inoculation density of Aspergillus oryzae in the culture medium, it is beneficial to promote the growth of Aspergillus oryzae in the culture medium and to take in enough iron to avoid growth competition caused by excessive Aspergillus oryzae.

[0047] In some embodiments, when Aspergillus oryzae is cultured in a culture medium containing organic iron, the process includes an induction stage, a consolidation stage and an enhancement stage, and the organic iron concentration in the culture medium increases gradually during the induction stage, the consolidation stage and the enhancement stage.

[0048] In fact, during the induction stage of cultivation, lower concentrations of organic iron can gently stimulate Aspergillus oryzae, allowing Aspergillus oryzae to adapt to the presence of organic iron, avoid excessive stress on Aspergillus oryzae, and help Aspergillus oryzae initiate the absorption and utilization mechanism of iron and begin to synthesize specific iron transport proteins and related metabolic pathways. In addition, low concentrations of organic iron can also promote the growth and metabolism of Aspergillus oryzae.

[0049] In fact, during the consolidation stage of cultivation, Aspergillus oryzae has been able to adapt to a certain concentration of organic iron after the induction stage of cultivation, which helps to improve Aspergillus oryzae's intake and utilization of iron. At the same time, more iron-containing enzymes in Aspergillus oryzae are activated, which can enhance the metabolic function of Aspergillus oryzae, allowing Aspergillus oryzae to more effectively utilize the nutrients in the culture medium, while also increasing the reserves of organic iron inside Aspergillus oryzae.

[0050] In fact, during the intensification stage of cultivation, high concentrations of organic iron can greatly stimulate Aspergillus oryzae to absorb organic iron, and at the same time can improve the stress resistance and adaptability of Aspergillus oryzae, and effectively cope with the oxidative stress in the environment. Specifically, when Aspergillus oryzae absorbs a large amount of organic iron and stores it, the rich iron reserves can not only promote the growth and metabolism of Aspergillus oryzae itself, but also increase the activity of enzymes such as proteases secreted when the puffed rice is fermented in step S3.

[0051] In some embodiments, the organic iron concentration in the culture medium is 10 mg / L-40 mg / L during the induction stage, 40 mg / L-150 mg / L during the consolidation stage, and 150 mg / L-200 mg / L during the reinforcement stage. In fact, during the induction stage, consolidation stage, and reinforcement stage, the difference in organic iron concentration between two adjacent stages is greater than or equal to 30 mg / L, which is conducive to forming an organic iron concentration gradient in different stages and facilitating different degrees of organic iron stimulation to Aspergillus oryzae.

[0052] Specifically, Aspergillus oryzae and Lactobacillus are co-cultured on a culture medium containing organic iron. In fact, during the induction culture stage, the ratio of the number of viable bacteria of Aspergillus oryzae to that of Lactobacillus in the culture medium is (10-20):1, which can establish that Aspergillus oryzae is in a dominant position during co-culture. At the same time, when Lactobacillus can absorb organic iron during metabolism and produce composite organic iron that is more easily absorbed by Aspergillus oryzae through metabolic pathways, it is beneficial for Aspergillus oryzae to utilize organic iron.

[0053] Specifically, Aspergillus oryzae and Lactobacillus are co-cultured in an induction phase, a consolidation phase, and a reinforcement phase on a culture medium containing organic iron, so that multiple factors can stimulate Aspergillus oryzae to express iron absorption proteins, thereby taking in and storing more organic iron and increasing its own iron content. In fact, when Aspergillus oryzae and Lactobacillus are co-cultured, the Lactobacillus used can be Lactobacillus CCRC12944.

[0054] In fact, after Aspergillus oryzae and Lactobacillus are co-cultured for 48-72 hours, the culture medium environment of Aspergillus oryzae and Lactobacillus co-culture is adjusted to an alkaline environment, and cultured for 8-12 hours to obtain composite Aspergillus oryzae. Specifically, by adjusting the environment of the culture medium to an alkaline environment, the growth of Lactobacillus can be greatly inhibited, thereby separating Aspergillus oryzae from the co-cultured flora.

[0055] In fact, after the composite Aspergillus oryzae is collected, it can be stored at low temperature, so as to be used multiple times after one culture. Specifically, when the composite Aspergillus oryzae is used, it can also be grown or activated in a culture medium containing organic iron.

[0056] In some embodiments, the inoculation amount of the composite Aspergillus oryzae in the puffed rice is 3×10 7 cfu / g-4×10 7 cfu / g, which can help the composite Aspergillus oryzae to fully utilize its nutrients in the puffed rice for rapid growth and quickly produce active enzyme substances such as protease, amylase, cellulase, etc., thereby changing the flavor substances and nutritional component structure of the puffed rice.

[0057] In fact, after the composite Aspergillus oryzae is inoculated in the puffed rice, the fermentation temperature of the composite Aspergillus oryzae is controlled to be 30-32°C in a light-proof environment. This temperature range is conducive to promoting the fermentation activity of the composite Aspergillus oryzae. In addition, it can also increase the activity of various enzymes, which is beneficial to the enzymatic hydrolysis of the puffed rice.

[0058] In some embodiments, after the composite Aspergillus oryzae is inoculated into the puffed rice, the humidity in the fermentation environment is controlled to be 90%-95%, which is conducive to the composite Aspergillus oryzae to maintain its own moisture content, thereby maintaining normal metabolism and fermentation activities, and at the same time, it is conducive to the spore germination and hyphae growth of the composite Aspergillus oryzae, thereby promoting the growth of the composite Aspergillus oryzae. In addition, the enzyme activity of protease and amylase produced by the metabolism of the composite Aspergillus oryzae can be improved, and the nutrients produced during the fermentation process can be promoted to diffuse in the puffed rice.

[0059] In some embodiments, after the composite Aspergillus oryzae is inoculated into the puffed rice, an alternating magnetic field of 50 Hz-100 Hz is applied in the fermentation environment. By performing the fermentation process in the magnetic field environment, the ion movement and surface potential change in the Aspergillus oryzae can be affected, thereby stimulating the Aspergillus oryzae to carry out metabolic activities, and at the same time, the Aspergillus oryzae can improve the use of the iron stored inside in the alternating magnetic field environment, thereby increasing the activity of the enzymes secreted by the Aspergillus oryzae. In addition, the alternating magnetic field can change the composition and nutritional components of the composite Aspergillus oryzae fermentation product by affecting the metabolic pathway of the composite Aspergillus oryzae, thereby changing the flavor and taste of the puffed rice after fermentation.

[0060] In some embodiments, the composite Aspergillus oryzae is inoculated into the puffed rice for 48-72 hours of fermentation treatment, which is conducive to the composite Aspergillus oryzae to adapt to the growth of the puffed rice and start its own metabolic activities, thereby secreting various enzyme substances to decompose the macromolecular substances in the puffed rice. At the same time, as the fermentation activity continues, the composite Aspergillus oryzae uses the nutrients in the puffed rice for growth and metabolism, and at the same time, beneficial metabolites are produced in the puffed rice, thereby effectively improving the flavor of the puffed rice. In addition, after the composite Aspergillus oryzae is fermented for 48-72 hours, the puffed rice can be fully fermented, which promotes the significant improvement of the nutritional components in the puffed rice. At the same time, by controlling the fermentation time, the flavor change of the puffed rice can be controlled.

[0061] In some embodiments, during the fermentation treatment of puffed rice by composite Aspergillus oryzae, the magnetic field is intermittently applied to the composite Aspergillus oryzae, and the interval between two adjacent magnetic fields is 4-6h. In fact, by setting the intermittent magnetic field, it is possible to provide a staged stimulation for the growth of the composite Aspergillus oryzae, avoid excessive stimulation to the composite Aspergillus oryzae and cause death, and facilitate the composite Aspergillus oryzae to adjust and adapt during the intermittent period of the magnetic field, so that the composite Aspergillus oryzae can grow and ferment in a relatively stable state, and promote the composite Aspergillus oryzae to optimize its own metabolic pathways.

[0062] In fact, the Aspergillus oryzae used in the present invention can be Aspergillus oryzae M6, which has been deposited in the China Center for Type Culture Collection on April 12, 2023, with a deposit number of CCTCC NO: M2023533, and the deposit address is Wuhan University, Wuhan, China.

[0063] Isolation of Aspergillus oryzae M6 (CCTCC NO: 2023533): Use a sterile medicine spoon to take 1g of naturally fermented soybean paste and 9mL of 0.9% saline solution, stir and dilute, shake and take 1mL of soybean milk dilution and 9mL of saline solution to dilute to a dilution of 10 -2 At the same time, prepare a dilution of 10 -3 , 10 -4 , 10 -5 , 10-6 dilution, and take 200 μL of 10 -3 , 10 -4 , 10 -5 , 10 -6 The dilution is evenly spread on a red Bengal medium with chloramphenicol added using a sterile applicator, and after constant temperature static culture at 28°C for 96 hours, a typical mold single colony is selected and streaked on a potato dextrose agar solid medium, and purified 2-3 times until a single colony is obtained, and the purified mold strain is streaked and transferred on a potato dextrose agar solid slant medium to obtain an Aspergillus oryzae strain for cryopreservation;

[0064] Mutagenesis: After the isolated Aspergillus oryzae strain was cultured to maturity, the Aspergillus oryzae plate was washed with sterile water to prepare a uniform spore suspension, and the concentration of the Aspergillus oryzae spore suspension was adjusted to 10 8 CFU / mL, and then 10mL of spore suspension was evenly coated on the slide, and the mutagenesis conditions were set as follows: ventilation volume 10SLM, power 100W, time was set to 0s, 15s, 30s, 45s, 60s, 75s, 90s, 120s respectively. After completing the atmospheric pressure and room temperature plasma mutagenesis treatment, the slide was washed in PBS and then suspended in sterile plasma water for use;

[0065] Screening: The induced Aspergillus oryzae suspension was spread on casein medium, cultured at 30°C for 72 hours in a constant temperature and dark environment, and single colonies with vigorous mycelial growth and large transparent circle compared with the uninduced Aspergillus oryzae strain were streaked on soy protein medium. After cultured at 30°C for 48 hours, single colonies with large colony diameter and vigorous growth were selected again, transferred to soy protein medium for culture and storage after maturity; the strains were activated and cultured to make 1×10 6 CFU / mL of spore suspension, drawing the spore suspension and placing it on a solid fermentation basal medium, carrying out a solid fermentation process at 30 ℃ for 72h, and measuring the enzymatic activities of amylase, protease, cellulase, carboxymethyl cellulose and pectinase, preferably preserving the strains with normal growth and high enzyme activity; wherein the casein medium comprises casein 10g / L, beef soaked powder 10g / L, disodium hydrogen phosphate 2g / L, sodium chloride 5g / L, agar powder 15g / L and deionized water 1L, and the raw material is sterilized at 121 ℃ for 20min by high pressure sterilization; the soy protein medium comprises soy protein isolate 10g, MgSO4·7H2O 0.5g, xylose 30g, KH2PO41g, agar powder 15g, dissolved in 1000m L distilled water, adjusting pH to 6.4, and sterilizing at 121 ℃ for 15min; the solid fermentation basal medium comprises cooked black rice 97% and (NH4)2SO4 3%, adjust the solid-water ratio to 1:0.8, and sterilize at 121 degrees for 15 minutes;

[0066] Identification: The strain was sent to Beijing Qingke Biotechnology Co., Ltd. for gene identification, and the gene sequence of Aspergillus oryzae M6 was obtained as follows:

[0067] AACGGTACTCTCTGCTTATTGATATGCCTGTCCGAAGACTGATTTGCGTT

[0068] CGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCT

[0069] CGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGG

[0070] AGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATG

[0071] ACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTT

[0072] CAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTT

[0073] CGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTT

[0074] TAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTC

[0075] GTGGTGTCTCCGGCGGGCCGGGCCCGGGGCTGAGAGCCCCCGGCGGCC

[0076] ATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGG

[0077] AGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCCTGCCCCCCCCCACGGGAAAAGGC.

[0078] Example 1

[0079] Embodiment 1 of the present invention provides a method for preparing nutritious rice, comprising the following steps:

[0080] S1, grinding and pulverizing black rice and adjusting the moisture content to 35% after passing through a 40 mesh sieve to obtain black rice powder, adding the black rice powder in an extruder at a feeding rate of 8.0kg / h, and extruder extruding the colored rice powder at a screw speed of 130rpm, and successively extruding in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, collecting the material output at the discharge port of the extruder, and obtaining puffed rice after drying in 46 ℃ of hot air drying ovens;

[0081] S2, Aspergillus oryzae M6 at 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 cfu / mL density is inoculated into a potato glucose medium with a pH of 5.5, and after culturing for 60 hours in an incubator at 30°C and 20% oxygen concentration, sodium hydroxide is added to the medium to adjust the pH of the medium to 8.0, and then cultured for 10 hours, and the composite Aspergillus oryzae is collected by centrifugation; wherein the 60-hour culture process includes a 10-hour induction stage, a 40-hour consolidation stage, and a 10-hour reinforcement stage, in which ferrous gluconate is added to the medium in the induction stage to adjust its initial concentration to 20 mg / L, in the consolidation stage, ferrous gluconate is added to the medium to adjust its initial concentration to 100 mg / L, and in the reinforcement stage, ferrous gluconate is added to the medium to adjust its initial concentration to 150 mg / L;

[0082] S3, the composite Aspergillus oryzae was added at 3.8×10 7 cuf / g is inoculated into puffed rice with a moisture content of 40%, and fermented for 60 hours in a light-shielded environment at 30°C and an alternating magnetic field of 0.3mT and 50Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0083] Example 2

[0084] This embodiment 2 provides a method for preparing nutritious rice, comprising the following steps:

[0085] S1, grinding and pulverizing black rice and adjusting the moisture content to 37% after passing through a 40 mesh sieve to obtain black rice powder, adding the black rice powder in an extruder at a feeding rate of 8.0kg / h, and extruder extruding the colored rice powder at a screw speed of 120rpm, and successively extruding in five gradient temperature zones of 70 ℃, 100 ℃, 175 ℃, 175 ℃, and 175 ℃, collecting the material output at the discharge port of the extruder, and obtaining puffed rice after drying in 50 ℃ of hot air drying ovens;

[0086] S2, Aspergillus oryzae M6 was added at 1.5×105 The density of cfu / mL, lactic acid bacteria CCRC12944 was 1.5×10 4 cfu / mL density is inoculated into a potato glucose medium with a pH of 5.5, and after culturing for 65 hours in an incubator at 37°C and 20% oxygen concentration, sodium hydroxide is added to the medium to adjust the pH of the medium to 8.0, and then cultured for 10 hours, and the composite Aspergillus oryzae is collected by centrifugation; wherein the 65-hour culture process includes a 10-hour induction stage, a 43-hour consolidation stage, and a 12-hour reinforcement stage, in which ferrous gluconate is added to the medium in the induction stage to adjust its initial concentration to 20 mg / L, in the consolidation stage, ferrous gluconate is added to the medium to adjust its initial concentration to 110 mg / L, and in the reinforcement stage, ferrous gluconate is added to the medium to adjust its initial concentration to 160 mg / L;

[0087] S3, the composite Aspergillus oryzae was added at 4×10 7 cuf / g was inoculated into puffed rice with a water content of 40%, and fermented for 65 hours in a 37°C light-shielded environment with a constant 0.3 mT, 50 Hz alternating magnetic field, and then dried and sterilized to obtain nutritious rice.

[0088] Example 3

[0089] This embodiment 3 provides a method for preparing nutritious rice, comprising the following steps:

[0090] S1, grinding and pulverizing black rice and adjusting the moisture content to 37% after passing through a 40-mesh sieve to obtain black rice powder, adding the black rice powder into an extruder at a feeding rate of 7.0kg / h, and extruder extruding the colored rice powder at a screw speed of 120rpm, and successively extruding in five gradient temperature zones of 70 ℃, 110 ℃, 170 ℃, 175 ℃ and 175 ℃, collecting the material outputted at the discharge port of the extruder, and obtaining puffed rice after drying in 45 ℃ of hot air drying ovens;

[0091] S2, Aspergillus oryzae M6 was added at 2.3×10 5 cfu / mL was inoculated in a potato glucose medium with a pH of 5.5, and after culturing for 55 hours in an incubator at 37°C and 20% oxygen concentration, the composite Aspergillus oryzae was obtained by centrifugation; wherein the 55-hour culturing process includes an 8-hour induction phase, a 40-hour consolidation phase, and a 7-hour reinforcement phase, in which ferrous gluconate was added to the culture medium in the induction phase to adjust its initial concentration to 20 mg / L, in the consolidation phase to adjust its initial concentration to 100 mg / L, and in the reinforcement phase to adjust its initial concentration to 160 mg / L;

[0092] S3, the composite Aspergillus oryzae was added at 3.6×107 The inoculum amount of cuf / g is inoculated into puffed rice with a water content of 40%, and the rice is fermented for 65 hours in a light-shielded environment at 37°C and an alternating magnetic field of 0.3mT and 50Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0093] Example 4

[0094] This embodiment 4 provides a method for preparing nutritious rice, comprising the following steps:

[0095] S1, grinding and pulverizing black rice and adjusting the moisture content to 37% after passing through a 40 mesh sieve to obtain black rice powder, adding the black rice powder in an extruder at a feeding rate of 7.0kg / h, and extruder extruding the colored rice powder at a screw speed of 130rpm, and successively extruding in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, collecting the material output at the discharge port of the extruder, and obtaining puffed rice after drying in 46 ℃ of hot air drying ovens;

[0096] S2, Aspergillus oryzae M6 at 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 cfu / mL were co-inoculated into a potato glucose medium with a pH of 5.5, and cultured in an incubator at 37°C and 20% oxygen concentration for 60 hours, and then sodium hydroxide was added to the medium to adjust the pH of the medium to 8.0, and then cultured for 10 hours, and the composite Aspergillus oryzae was collected by centrifugation; wherein during the 60-hour culture process, ferrous gluconate was added to the medium and its initial concentration was adjusted to 150 mg / L, and the ferrous gluconate concentration of the medium was adjusted every 10 hours to control its concentration to 140-160 mg / L;

[0097] S3, the composite Aspergillus oryzae was added at 3.8×10 7 The inoculum amount of cuf / g is inoculated into puffed rice with a water content of 40%, and the rice is fermented for 60 hours in a light-shielded environment at 37°C and an alternating magnetic field of 0.3mT and 50Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0098] Example 5

[0099] This embodiment 5 provides a method for preparing nutritious rice, comprising the following steps:

[0100] S1, grinding and pulverizing black rice and adjusting the moisture content to 35% after passing through a 40 mesh sieve to obtain black rice powder, adding the black rice powder in an extruder at a feeding rate of 8.0kg / h, and extruder extruding the colored rice powder at a screw speed of 130rpm, and successively extruding in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, collecting the material output at the discharge port of the extruder, and obtaining puffed rice after drying in 46 ℃ of hot air drying ovens;

[0101] S2, Aspergillus oryzae M6 was added at 2.3×10 5 cfu / mL was inoculated in a potato glucose medium with a pH of 5.5, and cultured in an incubator at 37°C and 20% oxygen concentration for 60 hours, followed by centrifugation to obtain a composite Aspergillus oryzae; during the 60-hour culture, ferrous gluconate was added to the culture medium and its initial concentration was adjusted to 150 mg / L, and the ferrous gluconate concentration of the culture medium was adjusted every 10 hours to control its concentration to 140-160 mg / L;

[0102] S3, the composite Aspergillus oryzae was added at 3.8×10 7 The inoculum amount of cuf / g is inoculated into puffed rice with a water content of 40%, and the rice is fermented for 60 hours in a light-shielded environment at 37°C and an alternating magnetic field of 0.3mT and 50Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0103] Comparative Example 1

[0104] This comparative example 1 provides a method for preparing nutritious rice, comprising the following steps:

[0105] D1, black rice was ground and pulverized and adjusted to obtain black rice powder after 35% moisture content through 40 mesh screens, black rice powder was added in an extruder with a feeding rate of 8.0kg / h, and the extruder extruded colored rice powder at a screw speed of 130rpm, and after expansion treatment was carried out in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, the material output at the discharge port of the extruder was collected, and puffed rice was obtained after drying in 46 ℃ of hot air drying ovens;

[0106] D2, Aspergillus oryzae M6 was cultured at 3.8×10 7 cuf / g was inoculated into puffed rice with a water content of 40%, and fermented at 37°C in a light-shielded environment for 60 hours, and then dried and sterilized to obtain nutritious rice.

[0107] Comparative Example 2

[0108] This comparative example 2 provides a method for preparing nutritious rice, comprising the following steps:

[0109] D1, black rice was ground and pulverized and adjusted to obtain black rice powder after 35% moisture content through 40 mesh screens, black rice powder was added in an extruder with a feeding rate of 8.0kg / h, and the extruder extruded colored rice powder at a screw speed of 130rpm, and after expansion treatment was carried out in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, the material output at the discharge port of the extruder was collected, and puffed rice was obtained after drying in 46 ℃ of hot air drying ovens;

[0110] D2, Aspergillus oryzae M6 was cultured at 3.8×10 7 The inoculum amount of cuf / g is inoculated into puffed rice with a water content of 40%, and the rice is fermented for 60 hours in a light-shielded environment at 37°C and an alternating magnetic field of 0.3mT and 50Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0111] Comparative Example 3

[0112] This comparative example 3 provides a method for preparing nutritious rice, comprising the following steps:

[0113] D1, black rice was ground and pulverized and adjusted to obtain black rice powder after 35% moisture content through 40 mesh screens, black rice powder was added in an extruder with a feeding rate of 8.0kg / h, and the extruder extruded colored rice powder at a screw speed of 130rpm, and after expansion treatment was carried out in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, the material output at the discharge port of the extruder was collected, and puffed rice was obtained after drying in 46 ℃ of hot air drying ovens;

[0114] D2, Aspergillus oryzae M6 was treated with 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 cfu / mL density is inoculated into a potato glucose medium with a pH value of 5.5, and after culturing for 60 hours in an incubator at 37°C and 20% oxygen concentration, sodium hydroxide is added to the medium to adjust the pH value of the medium to 8.0, and then the culture is cultured for 10 hours, and the composite Aspergillus oryzae is collected by centrifugation; wherein the 60-hour culture process includes a 10-hour induction stage, a 40-hour consolidation stage, and a 10-hour reinforcement stage, in which ferrous gluconate is added to the medium in the induction stage to adjust its initial concentration to 20 mg / L, in the consolidation stage, ferrous gluconate is added to the medium to adjust its initial concentration to 100 mg / L, and in the reinforcement stage, ferrous gluconate is added to the medium to adjust its initial concentration to 150 mg / L;

[0115] D3, the composite Aspergillus oryzae was added at 3.8×10 7cuf / g was inoculated into puffed rice with a water content of 40%, and fermented at 37°C in a light-shielded environment for 60 hours, and then dried and sterilized to obtain nutritious rice.

[0116] Comparative Example 4

[0117] This comparative example 4 provides a method for preparing nutritious rice, comprising the following steps:

[0118] D1, black rice was ground and pulverized and adjusted to obtain black rice powder after 35% moisture content through 40 mesh screens, black rice powder was added in an extruder with a feeding rate of 8.0kg / h, and the extruder extruded colored rice powder at a screw speed of 130rpm, and after expansion treatment was carried out in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, the material output at the discharge port of the extruder was collected, and puffed rice was obtained after drying in 46 ℃ of hot air drying ovens;

[0119] D2, Aspergillus oryzae M6 was treated with 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 cfu / mL density is inoculated into a potato glucose medium with a pH value of 5.5, and after culturing for 60 hours in an incubator at 37°C and 20% oxygen concentration, sodium hydroxide is added to the medium to adjust the pH value of the medium to 8.0, and then the culture is cultured for 10 hours, and the composite Aspergillus oryzae is collected by centrifugation; wherein the 60-hour culture process includes a 10-hour induction stage, a 40-hour consolidation stage, and a 10-hour reinforcement stage, in which ferrous gluconate is added to the medium in the induction stage to adjust its initial concentration to 20 mg / L, in the consolidation stage, ferrous gluconate is added to the medium to adjust its initial concentration to 100 mg / L, and in the reinforcement stage, ferrous gluconate is added to the medium to adjust its initial concentration to 150 mg / L;

[0120] D3, the composite Aspergillus oryzae was added at 3.8×10 7 The inoculum amount of cuf / g is inoculated into puffed rice with a moisture content of 40%, and the rice is fermented for 60 hours in a light-shielded environment at 37°C and an alternating magnetic field of 0.5 mT and 50 Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0121] Comparative Example 5

[0122] This comparative example 5 provides a method for preparing nutritious rice, comprising the following steps:

[0123] D1, black rice was ground and pulverized and adjusted to obtain black rice powder after 35% moisture content through 40 mesh screens, black rice powder was added in an extruder with a feeding rate of 8.0kg / h, and the extruder extruded colored rice powder at a screw speed of 130rpm, and after expansion treatment was carried out in five gradient temperature zones of 70 ℃, 100 ℃, 170 ℃, 170 ℃, and 170 ℃, the material output at the discharge port of the extruder was collected, and puffed rice was obtained after drying in 46 ℃ of hot air drying ovens;

[0124] D2, Aspergillus oryzae M6 was treated with 10 5 The density of cfu / mL, lactic acid bacteria CCRC12944 was 10 4 cfu / mL density is inoculated into a potato glucose medium with a pH value of 5.5, and after culturing for 60 hours in an incubator at 37°C and 20% oxygen concentration, sodium hydroxide is added to the medium to adjust the pH value of the medium to 8.0, and then the culture is cultured for 10 hours, and the composite Aspergillus oryzae is collected by centrifugation; wherein the 60-hour culture process includes a 10-hour induction stage, a 40-hour consolidation stage, and a 10-hour reinforcement stage, in which ferrous gluconate is added to the medium in the induction stage to adjust its initial concentration to 20 mg / L, in the consolidation stage, ferrous gluconate is added to the medium to adjust its initial concentration to 100 mg / L, and in the reinforcement stage, ferrous gluconate is added to the medium to adjust its initial concentration to 150 mg / L;

[0125] D3, the composite Aspergillus oryzae was added at 3.8×10 7 The inoculum amount of cuf / g is inoculated into puffed rice with a moisture content of 40%, and fermented for 60 hours in a light-shielded environment at 37°C and an alternating magnetic field of 0.1mT and 50Hz, and then dried and sterilized to obtain nutritious rice; wherein the alternating magnetic field is applied intermittently, and the application time of each alternating magnetic field is 5 hours, and the interval time is 5 hours.

[0126] Performance testing and analysis

[0127] The nutrient rice prepared in Examples 1 to 5 and Comparative Examples 1 to 5 were respectively crushed through a 60-mesh sieve, 1.0 g of nutrient rice powder was weighed and 20 mL of sodium citrate buffer (50 mmol, pH 5.5) was added, stirred and mixed, and then extracted at 30° C. for 30 min, and then centrifuged at 4° C. to obtain a crude enzyme solution, and the enzyme activity in the crude enzyme solution was measured. The measurement method is as shown below, and the measurement results are shown in Table 1.

[0128] α-Amylase: Take 250 μL crude enzyme solution and 1.75 mL 1% soluble starch solution respectively, stir and react in a 50°C water bath for 10 min, immediately add 4 mL 3,5-dinitrosalicylic acid reagent and boil in a water bath for 5 min, then add deionized water to make the volume 10 mL, cool to room temperature, measure the absorbance at 540 nm, and calculate the unit enzyme activity of α-amylase in the crude enzyme solution according to the standard curve (with glucose as the standard);

[0129] Protease: Take 2 mL of crude enzyme solution and 2 mL of 1% casein solution, stir and react in a 40°C water bath for 15 min, add 4 mL of 0.4 mol / L trichloroacetic acid solution to terminate the reaction and let stand for 30 min, then centrifuge at 12000 rpm for 5 min to collect the supernatant, measure the absorbance of the supernatant at 280 nm, and calculate the unit enzyme activity of the protease in the crude enzyme solution according to the standard curve (with tyrosine as the standard);

[0130] Cellulase: Take 1 mL of crude enzyme solution and 2 mL of sodium citrate buffer (0.1 mol / L, pH 4.8) and mix them evenly to prepare enzymatic solution. Add 0.1 g of filter paper strip with a size of 1.0 cm × 6.0 cm and 1 mL of 0.5% solution of sodium carboxymethyl cellulose to the enzymatic solution respectively, and stir the mixture in a 50°C water bath for 1 h. Immediately add 4 mL of 3,5-dinitrosalicylic acid reagent and boil it in a boiling water bath for 5 min. Then add deionized water to make the volume 10 mL. After cooling to room temperature, measure the absorbance at 540 nm, and calculate the unit enzyme activity of cellulase and carboxymethyl cellulase in the crude enzyme solution according to the standard curve (with glucose as the standard).

[0131] Table 1 Unit enzyme activity test results

[0132]

[0133]

[0134] The nutrient rice prepared in Examples 1 to 5 and Comparative Examples 1 to 5 were respectively crushed through a 60-mesh sieve, 1.0 g of nutrient rice powder was weighed, 30 mL of acidified ethanol (95% ethanol and 1 mol / L HCl, volume ratio 85:15) was added, and the mixture was extracted for 30 min. The supernatant was collected by centrifugation at a speed of 3000 rpm, and the supernatant was combined after repeated extraction three times. After evaporation at 45° C., 50% chromatographic methanol was added to make the volume to 10 mL to prepare a test solution. The total phenol content in the test solution was determined by the Folin-Ciocalteu method, and the dry weight of gallic acid in each gram of nutrient rice powder was expressed in μgGAE / gDW. The antioxidant capacity of the test solution was determined by DPPH, and the equivalent of μg Trolox in each gram of nutrient rice powder was expressed in μg Trolox / g DW. The determination results are shown in Table 2 below.

[0135] Table 2 Total phenols and antioxidant performance test results

[0136]

[0137]

[0138] After in vitro digestion of the nutrient rice prepared in Examples 1 to 5 and Comparative Examples 1 to 5, 50 mg of the nutrient rice after in vitro digestion was added to a vial, 1 mL of 25% by mass healthy human feces slurry and 4 mL of PBS solution were added, the vial was sealed and shake-cultured at 100 rpm in a 37°C incubator, and after culturing for 24 hours, the supernatant was taken out by centrifugation to obtain the fermentation liquid.

[0139] 0.4 mL of fermentation broth was taken, 45 μL of ultrapure water and 80 μL of 1 mol / L hydrochloric acid and vortexed for 10 min, and then 65 μL of 0.01 mol / L 2-ethylbutyric acid internal standard solution was added. After vortexing for 15 s, the test solution was passed through an organic filter membrane with a pore size of 22 μm to obtain the test solution, and the concentration of short-chain fatty acids (SCFAs) was determined in a gas chromatograph. The results are shown in Table 3 below. The operating parameters of the gas chromatograph are as follows: HP-FFAP capillary column (Agilent 19091F-433, 30m×250μm×0.25μm); injection volume is 1μL; injection port temperature is 220℃; detector temperature is 250℃; FID flame ionization detector; gradient temperature program is as shown in Table 2-6; carrier gas is nitrogen, flow rate is 30mL / min, split ratio is 10:1; fuel gas is hydrogen, flow rate is 35mL / min; air flow rate is 400mL / min.

[0140] Table 3 Determination of short-chain fatty acid concentration

[0141]

[0142]

[0143] 5 g of the nutritious rice prepared in Examples 1 to 5 and Comparative Examples 1 to 5 were respectively added to a beaker, 35 mL of boiling water was added and stirred for mixing, and the mixture was sealed for 3 minutes. Five grains of nutritious rice were randomly selected and placed on a glass sheet, and another glass sheet was pressed on the rice grains to apply pressure. The rice grains on the glass sheet were observed to see whether there was a hard core. When more than 95% of the rice grains had no hard core, the time recorded was the rehydration time of the nutritious rice, as shown in Table 4 below.

[0144] Table 4 Determination of rehydration time

[0145] Rehydration time (min) Example 1 3.5±0.3 Example 2 3.8±0.2 Example 3 4.5±0.3 Example 4 5.0±0.2 Example 5 5.5±0.3 Comparative Example 1 5.8±0.3 Comparative Example 2 6.0±0.2 Comparative Example 3 4.1±0.3 Comparative Example 4 4.2±0.1 Comparative Example 5 4.4±0.1

[0146] The total starch content of the nutrient rice prepared in Examples 1 to 5 and Comparative Examples 1 to 5 was determined by using a total starch kit from Megazyme Company, and the reducing sugar content of the nutrient rice prepared in Examples 1 to 5 and Comparative Examples 1 to 5 was determined by using a 3,5-dinitrosalicylic acid method, as shown in Table 5 below.

[0147] Table 5 Determination of total starch and reducing sugar content

[0148] Total starch (g / g) Reducing sugar (mg / g) Example 1 0.38±0.02 375.3±11.6 Example 2 0.40±0.04 352.6±10.5 Example 3 0.45±0.03 325.3±13.4 Example 4 0.47±0.05 312.1±6.8 Example 5 0.49±0.04 302.3±8.7 Comparative Example 1 0.52±0.03 281.5±14.2 Comparative Example 2 0.56±0.04 260.5±13.5 Comparative Example 3 0.43±0.04 338.7±10.4 Comparative Example 4 0.42±0.03 338.6±7.5 Comparative Example 5 0.44±0.05 341.3±5.6

[0149] Although the embodiments of the present invention are described in detail above, it is obvious to those skilled in the art that various modifications and variations can be made to these embodiments. However, it should be understood that such modifications and variations are within the scope and spirit of the present invention as described in the claims. Moreover, the present invention described herein may have other embodiments and may be implemented or realized in a variety of ways.

Claims

1. A method for preparing nutritious rice, characterized in that: The following steps are involved: Rice powder is extruded and puffed to obtain puffed rice; Aspergillus oryzae is cultured in a culture medium containing organic iron for 48 hours to 72 hours and then collected to obtain composite Aspergillus oryzae; the composite Aspergillus oryzae is inoculated into puffed rice with a water content of 35 to 50 percent and fermented in a fermentation environment and a magnetic field of 0.3 mT to 0.4 mT, and dried and sterilized to obtain nutritious rice.

2. The preparation method according to claim 1, characterized in that: The water content of the rice powder is 30%-35%; and / or, the rice powder is pre-sieved with a 40-mesh sieve; and / or, the rice powder is extruded and puffed in multiple temperature zones; and / or, the rice in the rice powder includes at least one of brown rice, purple rice, black rice, rice, and red rice; and / or, after extrusion and puffing, the rice powder is dried at 40° C.-50° C.

3. The preparation method according to claim 1, characterized in that: The organic iron comprises at least one of iron amino acid chelate, iron gluconate, iron lactate, iron fumarate, iron citrate, and iron polysaccharide chelate; and / or, the concentration of the organic iron in the culture medium is 10 mg / L-200 mg / L; and / or, the culture medium comprises potato dextrose culture medium; and / or, the initial inoculation density of Aspergillus oryzae in the culture medium is 10 4 cfu / mL-10 6 cfu / mL.

4. The preparation method according to claim 1, characterized in that: The method comprises culturing Aspergillus oryzae in a culture medium containing organic iron, comprising an induction stage, a consolidation stage and a reinforcement stage, wherein the concentration of organic iron in the culture medium increases in a gradient manner during the induction stage, the consolidation stage and the reinforcement stage; and / or, Aspergillus oryzae and lactic acid bacteria are co-cultured in a culture medium containing organic iron and then centrifuged to obtain a composite Aspergillus oryzae.

5. The preparation method according to claim 1, characterized in that: The inoculation amount of the composite Aspergillus oryzae in the puffed rice is 3×10 7 cfu / g-4×10 7 cfu / g; and / or, the temperature of the fermentation environment is 34°C-38°C; and / or, the humidity of the fermentation environment is 90%-95%; and / or, the fermentation environment is a light-proof environment; and / or, the frequency of the magnetic field is 50Hz-100Hz.

6. The preparation method according to claim 1, characterized in that: The composite Aspergillus oryzae is inoculated into the puffed rice for fermentation for 48-72 hours; and / or, during the fermentation process, the magnetic field is intermittently applied to the composite Aspergillus oryzae, and the interval between two adjacent magnetic fields is 4-6 hours.

7. The preparation method according to any one of claims 1 to 6, characterized in that: The Aspergillus oryzae is Aspergillus oryzae M6, which has been deposited in the China Center for Type Culture Collection on April 12, 2023, with a deposit number of CCTCC NO: M2023533, and the deposit address is Wuhan University, Wuhan, China.

8. Nutritious rice prepared by the preparation method according to any one of claims 1 to 7.

Images