Use of a composition for the manufacture of a medicament for the treatment of breast tumors

Abstract

The present application relates to a kind of compositions in the application of preparing the drug for treating breast tumor.The composition is the combination of the substance for inhibiting the expression of PSMD14 gene and unsaturated fatty acid, the substance for inhibiting the expression of PSMD14 gene is the substance for reducing the expression amount of PSMD14 gene using the specific shRNA of PSMD14 gene, and the unsaturated fatty acid can be arachidonic acid.The present application proves by experiment, the expression of inhibiting PSMD14 gene is combined with unsaturated fatty acid, can promote the death of breast tumor cell, inhibits the growth of tumor, and delays the speed of mouse tumorigenesis.It is shown that the content of PSMD14 can inhibit the growth of TNBC implantation tumor, after adding unsaturated fatty acid, TNBC implantation tumor can be further inhibited, and PSMD14 can be used as potential target for treating TNBC patients, to provide new non-surgical treatment for breast tumor.

Description

Technical field:

[0001] The present invention relates to the field of biomedicine, and in particular to an application of a composition of a substance that inhibits PSMD14 gene expression and unsaturated fatty acids in the preparation of a drug for treating breast tumors. Background technology:

[0002] Breast cancer is the most common malignant tumor in women and the second leading cause of cancer-related death worldwide. Published reports indicate that an estimated 287,850 new cases of breast cancer (31%) will occur in 2022, with an estimated 15% of all breast cancer deaths. Among all breast cancer subtypes, triple-negative breast cancer (TNBC) has the worst prognosis and overall survival (OS). Therefore, further elucidating the molecular mechanisms underlying the development and progression of TNBC is of great significance.

[0003] TNBC refers to breast cancer that is negative for ER, PR, and HER2 receptors, accounting for approximately 15% to 20% of the overall breast cancer population. Compared with other subtypes, it has the characteristics of "low differentiation, strong invasiveness, high recurrence rate, and overall poor prognosis." Because the tumor lacks the corresponding receptors, patients cannot benefit from endocrine therapy and HER2 targeted therapy, and current treatment options are relatively limited, mainly a combination of surgery and chemotherapy. The clinical treatment effect of most patients is not ideal, and recurrence and metastasis are prone to occur during treatment, seriously affecting the patient's survival prognosis. Therefore, elucidating the molecular regulatory mechanism of TNBC invasion and metastasis provides a new theoretical basis and molecular targets for the treatment of TNBC, which will help improve the treatment dilemma of TNBC. Summary of the invention:

[0004] (1) Technical problems solved

[0005] Against this background, the present invention provides a composition for use in the preparation of a drug for treating breast tumors. The composition comprises a substance that inhibits PSMD14 gene expression and unsaturated fatty acids. Experiments conducted in the present invention demonstrate that inhibiting PSMD14 gene expression in combination with unsaturated fatty acids can promote breast tumor cell death, inhibit tumor growth, and slow tumor formation in mice. This indicates that reducing PSMD14 levels can inhibit the growth of TNBC xenografts, and that adding unsaturated fatty acids further inhibits growth. This demonstrates that PSMD14 may serve as a potential target for treating TNBC patients, opening up broader prospects for non-surgical breast tumor treatment.

[0006] (2) Technical solution

[0007] To solve the above technical problems, the present invention provides a composition for use in preparing a drug for treating breast tumors, wherein the composition is a combination of a substance that inhibits PSMD14 gene expression and an unsaturated fatty acid, and the substance that inhibits PSMD14 gene expression is a substance that uses a specific shRNA of the PSMD14 gene to reduce the expression level of the PSMD14 gene.

[0008] Furthermore, the substance that utilizes the PSMD14 gene-specific shRNA to reduce the expression of the PSMD14 gene is an shRNA that can specifically reduce the expression of the PSMD14 gene, or an expression cassette that can express the shRNA, or a recombinant vector containing the expression cassette, or a cell line containing the recombinant vector.

[0009] Furthermore, the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2, specifically:

[0010] The PSMD14 shRNA positive strand sequence is:

[0011] CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTCG AAGTTTTTG;

[0012] The reverse strand sequence of PSMD14 shRNA is:

[0013] AATTCAAAAACTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCA GATTCGAAG.

[0014] Furthermore, the vector is a viral vector and / or a plasmid, the viral vector is specifically a lentivirus, and the plasmid is a pLKO.1puro vector.

[0015] Furthermore, the unsaturated fatty acid may be arachidonic acid AA.

[0016] Furthermore, the composition also includes a GSH peroxidase 4 inhibitor RSL3. When the substance inhibiting PSMD14 gene expression is a cell infected with the sh-PSMD14 virus, the mass ratio of the sh-PSMD14 virus contained in the composition, the arachidonic acid AA and the RSL3 is 1:3:3.

[0017] Furthermore, the breast tumor may be triple-negative breast cancer, and the specific types of triple-negative breast cancer cells are MDA-MB-231, BT-549 or HCC1973.

[0018] The invention relates to an application of the substance for inhibiting the expression of PSMD14 gene in preparing unsaturated fatty acids for incubating breast tumor cells.

[0019] In the above applications, the treatment and / or prevention of breast tumors can be reflected in reducing the activity of breast tumor cells and / or delaying the growth of breast tumors in animals.

[0020] The animal can be a mammal, which can be a human or a mouse. In one embodiment of the present invention, the mouse is an immunodeficient Balb / c nude mouse. Animal models include tumor xenograft models, patient-derived tumor xenograft (PDX) models, and patient-derived tumor organoid (PDO) models.

[0021] The present invention also provides the use of the composition in preparing a product having any of the following uses:

[0022] X1. Inhibit the growth of breast tumor cells;

[0023] X2, inhibiting the tumorigenicity of breast tumor cells;

[0024] X3, reduce breast tumor cell viability;

[0025] X4. Reduce the self-renewal ability of breast tumor cells.

[0026] The tumorigenicity can be reflected in the ability of the breast tumor cells to form spheres (including tumor xenograft models, PDX models, and PDO models). In the above applications, the breast tumor cells can be triple-negative breast cancer cells. The triple-negative breast cancer cells can be MDA-MB-231, BT-549, or HCC1973.

[0027] The use of the substance that inhibits the content and / or activity of PSMD14 in the preparation of unsaturated fatty acids for incubating breast tumor cells also falls within the scope of protection of the present invention.

[0028] In the present invention, PSMD14 is a protein encoded by the PSMD14 gene (NCBI ID: 10213, updated on November 3, 2024).

[0029] The breast tumor can be a mammalian breast tumor. The breast tumor cells and the triple-negative breast cancer cells can both be mammalian cells. The mammal can be a human or a mouse. In one embodiment of the present invention, the mouse is an immunodeficient Balb / c nude mouse.

[0030] (3) Beneficial effects

[0031] The present invention has the following beneficial effects: The authors discovered that knocking down the PSMD14 gene combined with unsaturated fatty acids can promote breast tumor cell death, inhibit tumor growth, and slow tumor formation in mice. This suggests that reduced PSMD14 levels can inhibit the growth of TNBC xenografts, and that the addition of unsaturated fatty acids further inhibits growth. This demonstrates that PSMD14 may serve as a potential target for the treatment of TNBC patients, providing a new approach for breast tumor treatment. Description of the drawings:

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments.

[0033] Figure 1 The expression of PSMD14 was detected by Western blot and IHC, including:

[0034] A shows the expression of PSMD14 detected in TNBC samples and adjacent adjacent tissues;

[0035] B: Detection of PSMD14 expression in TNBC cells;

[0036] C is the expression of PSMD14 in TNBC sample cancer and adjacent tissues detected by IHC;

[0037] D is the WB detection of PSMD14 protein expression after PSMD14 knockout in MDA-MB-231 and BT-549;

[0038] E: WB detection of PSMD14 protein expression after overexpression of PSMD14 in MDA-MB-231 and BT-549.

[0039] Figure 2 Knockdown of the PSMD14 gene combined with unsaturated fatty acids can promote the death of breast tumor cells.

[0040] A, responses of xenografts expressing vector or sh-PSMD14 to PBS or RSL3 / AA treatment, showing xenograft tumors in each group (n=4);

[0041] B: Tumor volume was measured twice a week and growth curve was drawn;

[0042] C: The tumor weights of the four groups were analyzed.

[0043] Figure 3 OPA plus AA supplementation induces synthetic lethality in triple-negative cancer PDX and PDO with high PSMD14 expression.

[0044] A is a graphic illustration of the PSMD14-overexpressing TNBC PDX and PDO mouse models.

[0045] B: Xenograft tumors were collected from PDX mice treated with OPA, AA / RSL3, OPA combined with AA / RSL3, and vehicle control.

[0046] C: The tumor volume of PDX mice was monitored every three days, and the tumor growth curve was plotted.

[0047] D: Tumors of PDX mice were extracted and weighed.

[0048] E: Tumor sections from PDX mice were stained by IHC (scale bar = 20 μm) with anti-Ki-67, anti-p-AKT, and anti-p-MTOR antibodies.

[0049] F, Quantification of Ki-67, p-AKT, and p-MTOR positive staining in PDX tumors.

[0050] G depicts the main phenotypes of TNBC organoids treated with OPA, AA / RSL3, OPA and AA / RSSL3 combined, and vehicle control.

[0051] H is after the designated treatment described in (G), the cells were 3D cell viability assay was used to detect the viability of organoids.

[0052] I is the quantification of Ki-67 positive staining in organoids.

[0053] J, histological and immunohistochemical images showing the organization and status of the proliferation marker (Ki-67) in organoids after the indicated treatments as described in (G) (scale bar = 50 μm).

[0054] In the above figures and descriptions, OPA is a substance that inhibits the content and / or activity of PSMD14; RSL3 is a ferroptosis inducer. Specific implementation method:

[0055] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0056] The examples provided below can serve as a guide for those of ordinary skill in the art to make further improvements and do not constitute a limitation of the present invention in any way. The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0057] The MDA-MB-231, BT-549, and HCC1973 in the following examples are all described in the literature (LRPPRC promotes glycolysis by stabilizing LDHA mRNA and its knockdown plus glutamine inhibitor induces synthetic lethality via m6 A modification in triple-negative breast cancer. Clin Transl Med. 2024Feb; 14(2):e1583.doi:10.1002 / ctm2.1583) (Figures G and H on page 9), which are available to the public from the applicant. These biological materials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. MDA-MB-231, BT-549, and HCC1973 are all tumor cells isolated from tumor tissues of different breast cancer patients, and also have the ability to self-renew, proliferate indefinitely, and develop tumors.

[0058] sh-PSMD14#1, sh-PSMD14#2, and sh-PSMD14#3 as well as the PSMD14 overexpression plasmid were synthesized by GenePharma (China);

[0059] PSMD14(12059-1-AP,1:1000,Proteintech),

[0060] p-AKT(66444-1-Ig,1:1000,Proteintech),

[0061] p-mTOR(67778-1-Ig,1:1000,Proteintech),

[0062] β-actin (8457S, 1:1000, CST),

[0063] Ki67(27309-1-AP,1:200,Proteintech).

[0064] Secondary antibody: rabbit secondary antibody AffiniPure Goat Anti-Rabbit IgG (H+L), Jackson ImmunoResearch (Cat. No. 111-005-003); mouse secondary antibody

[0065] AffiniPure Goat Anti-Mouse IgG (H+L), Jackson ImmunoResearch (Cat. No. 115-005-003).

[0066] Example 1: PSMD14 gene knockdown combined with unsaturated fatty acids can inhibit TNBC progression

[0067] 1. Detection of PSDM14 expression in TNBC

[0068] (1) Collection of cancer and adjacent tissue specimens from TNBC patients

[0069] (2) Western blot assay was used to detect the expression level of PSMD14 in TNBC patients' cancer and adjacent tissue samples. Figure 1 A), the primary antibodies used were PSMD14 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0070] (3) IHC detection of PSMD14 expression levels in cancer and adjacent tissues of TNBC patients ( Figure 1 C)

[0071] (4) Western blot assay to detect the expression level of PSMD14 in TNBC cells ( Figure 1 B), the primary antibodies used were PSMD14 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0072] 2. PSMD14 gene knockdown

[0073] Knockdown of PSMD14 gene using pLKO.1puro-shPSMD14

[0074] The PSMD14 gene was knocked out in MDA-MB-231 and BT-549 cells using the pLKO.1puro-shPSMD14 inducible knockdown method. The specific steps are as follows:

[0075] (1) Construction of pLKO.1puro-shPSMD14 plasmid

[0076] 1) Design and synthesis of PSMD14 shRNA primer sequences. Based on the shRNA sequences provided by the Public TRC Portal and the Sigma website, PSMD14 shRNA interference sequences specific for the PSMD14 gene and validated for use in the pLKO.1-puro vector (Addgene, Catalog #21915) were selected. The designed PSMD14 shRNA sequences were sent to Invitrogen for synthesis. The primer sequences are shown in Table 1:

[0077] Table 1. PSMD14 shRNA primer sequences

[0078]

[0079]

[0080] 2) PSMD14 shRNA Primer Annealing: The company's synthesized primers were diluted with water to a final concentration of 10 μmol / L and then annealed. The annealing system is shown in Table 2:

[0081] Table 2. PSMD14 shRNA annealing system

[0082] Element Volume / μL Upstream primer F 5 Downstream primer R 5 0.5mol / LNaCl 6 ddH2O 24 Total volume 40

[0083] The mixed annealing system was placed in a 95°C water bath and heated for 10 min. The water bath was then closed and the temperature was slowly lowered to room temperature. The annealed product was stored in a refrigerator at 4°C.

[0084] 3) Enzyme digestion of the pLKO.1-puro empty vector

[0085] pLKO.1-puro was double-digested with EcoRI and AgeⅠ to recover the pLKO.1-puro vector backbone.

[0086] 4) Connect

[0087] The pLKO.1-puro vector backbone obtained in step (3) and the three groups of annealing products obtained in step (2) were connected, and the resulting recombinant vectors with correct sequences were recorded as pLKO.1puro-shPSMD14#1, pLKO.1puro-shPSMD14#2, and pLKO.1puro-shPSMD14#3 (the vectors without annealing products were recorded as the corresponding pLKO.1puro-shNC).

[0088] (2) Virus packaging

[0089] 24 hours in advance, 1.5×10 HEK293 cells were seeded in a 10 cm dish and transfected with the lentiviral packaging plasmids psPAX2 (5 μg) and pCI-VSVG (5 μg), as well as the three successfully constructed pLKO.1puro-shPSMD14 plasmids, using the calcium phosphate transfection method. Complete medium was replaced 12 hours after transfection. After 72 hours of cell culture, the viral supernatant was collected and centrifuged at 3000 rpm for 3 minutes. The supernatant was filtered through a 0.45 μm filter, and the filtered viruses (designated shPSMD14#1, shPSMD14#2, and shPSMD14#3 viruses, respectively; the control virus was designated shNC virus) and stored at −80°C.

[0090] (3) Verify knockdown / knockout effects after infection and screening

[0091] 1.5×10 TNBC (MDA-MB-31 or BT-549) cells were inoculated into a 10 cm culture dish, 5 mL of supernatant containing shPSMD14 virus (or shNC virus) was added, and then the volume was filled up to 10 mL with complete culture medium. The cells were cultured in an incubator for 48 h, and then digested with Accutase (trypsin) to single cells. The cells were resuspended in complete culture medium containing 1 μg / mL of puromycin for screening, and the positive cells after screening were continued to be cultured. The transfected cells were designated as MDA-MB-231-shPSMD14#1 and BT-549-shPSMD14#1, MDA-MB-231-shPSMD14#2 and BT-549-shPSMD14#2, and MDA-MB-231-shPSMD14#3 and BT-549-shPSMD14#3. The cells in the control group were labeled as MDA-MB-231-shN and BT-549-shNC. The expression levels of PSDM14 in MDA-MB-231-shPSMD14#1 and BT-549-shPSMD14#1, MDA-MB-231-shPSMD14#2 and BT-549-shPSMD14#2, MDA-MB-231-shPSMD14#3 and BT-549-shPSMD14#3, and MB-231-shN and BT-549-shNC were detected by Western blotting. Figure 1 D) Experimental results showed that the expression level of PSMD14 in MDA-MB-231-shPSMD14#1, BT-549-shPSMD14#1, MDA-MB-231-shPSMD14#2, and BT-549-shPSMD14#2 was significantly lower than that in MB-231-shN and BT-549-shNC, with the lower expression in shPSMD14#2 being more pronounced. The primary antibodies used were anti-PSMD14 and anti-β-actin, respectively, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0092] 3. In vivo knockdown of PSMD14 gene combined with unsaturated fatty acids for the treatment of breast cancer

[0093] Immunodeficient mice: Balb / c nude (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.), 4 weeks old, weighing 15-17 grams.

[0094] (1) Tumor xenograft model

[0095] Sixteen mice were randomly divided into four groups:

[0096] ①sh-NC group: MDA-MB-231 cells (1×10 7 ) were injected subcutaneously into nude mice. The reference experimental group was regularly given an equal volume of distilled water;

[0097] ②sh-PSMD14 group: MDA-MB-231 cells (1×10 7 ) were injected subcutaneously into nude mice. The reference experimental group was regularly given an equal volume of distilled water;

[0098] ③sh-NC+AA / RSL3 group: MDA-MB-231 cells (1×10 7 ) were injected subcutaneously into nude mice. AA and RSL3 were dissolved in DMSO and administered orally at a concentration of 0.15% for 7 consecutive days. The AA / RSL3 mass ratio was 1:1.

[0099] ④sh-PSMD14+AA / RSL3 group: MDA-MB-231 cells (1×10 7 ) were injected subcutaneously into nude mice. AA and RSL3 were dissolved in DMSO and administered orally at a dose of 50 mg kg per mouse. -1 Calculations were made after 7 days of continuous treatment, in which the mass ratio of sh-PSMD14 virus, AA, and RSL3 in cells infected with sh-PSMD14 virus was 1:3:3;

[0100] After the above grouping and treatment, the length and width of the subcutaneous tumor were recorded every four days, and the subcutaneous tumor volume was calculated. The tumor volume was calculated according to the formula: (length × width 2 ) / 2. After 5 weeks, the mice were euthanized, and the tumors were removed and weighed.

[0101] (2) Patient-derived tumor xenograft (PDX)

[0102] Preparation and culture of breast cancer organoids:

[0103] 1) Sampling: Place fresh tissue samples in prepared DMEM / F12 medium (containing double-antibody), store on ice, and transport to the laboratory. Weigh and record.

[0104] 2) Mechanical cutting: Use a scalpel or ophthalmic scissors to remove fat, necrotic tissue, etc., wash with DMEM / F12 medium (containing double-antibody), and then cut the tumor into small pieces with a diameter of 1-3 mm;

[0105] 3) Enzymatic hydrolysis: Use a Pasteur pipette to transfer the remaining tissue fragment suspension into a 15 mL centrifuge tube, add AdDF++ medium to 10 mL, and centrifuge for recovery at 300 g for 5 min.

[0106] 4) Histochemical Digestion: Resuspend the pellet in 10 mL of BCO digestion buffer, transfer to a conical flask, and place in a suspension incubator at 37°C, 5% CO2, 120 rpm / min for 1-1.5 hours. Terminate the enzymatic digestion with serum-containing culture medium and pipette the digestion product in the conical flask with a 3 mL plastic Pasteur pipette.

[0107] 5) Filtration: Pass the cells through 100 μm and 40 μm filters in sequence, and centrifuge at 300 g for 5 minutes to recover cells with a size of 40-100 μm. These cells are used for organoid culture, and cell pellets smaller than 40 μm are cryopreserved.

[0108] 6) Seeding: Resuspend the cell pellet in frozen-thawed BME, blow evenly, and drop 40 μl / well into a 24-well plate. Incubate at 37°C for 20 min, and slowly add 400 μl / well of culture medium.

[0109] Subcutaneous tumors and grouping:

[0110] Take 20 mice and transfer the cells (1×10 7 ) were injected subcutaneously into nude mice and then randomly divided into 4 groups.

[0111] ①Control group: The same volume of distilled water was regularly administered orally to the experimental group;

[0112] ②OPA group: OPA was dissolved in DMSO and administered orally at a dose of 50 mg / kg per rat. -1 Calculation, continuous treatment for 7 days;

[0113] ③AA / RSL3 group: AA and RSL3 were dissolved in DMSO at the same time and administered orally at a concentration of 0.15% for 7 consecutive days;

[0114] ④OPA+AA / RSL3 group: OPA, AA and RSL3 were dissolved in DMSO at the same time and administered orally at a concentration of 1 mg / ml for 7 consecutive days;

[0115] After the above grouping and treatment, the length and width of the subcutaneous tumor were recorded every 3 days, and the subcutaneous tumor volume was calculated. The tumor volume was calculated according to the formula: (length × width 2 ) / 2. After 5 weeks, the mice were euthanized, and the tumors were removed and weighed ( Figure 3 A).

[0116] The above-mentioned OPA is a small molecule inhibitor of PSMD14, purchased from MERCK (CAS No.: 5144-89-8).

[0117] Immunohistochemistry:

[0118] The above 4 groups of tumors were respectively stained by Ki67, p-AKT, p-MTOR immunohistochemistry, and scored. The antibodies used were:

[0119] Ki67 (27309-1-AP, 1:200, Proteintech), p-AKT (66444-1-Ig, 1:1000, Proteintech), p-mTOR (67778-1-Ig, 1:1000, Proteintech).

[0120] (3) Tumor organoid model (Patient-derived tumor organoid, PDO)

[0121] PDO model preparation:

[0122] 1) We use a sterile brush to mechanically crush fresh active human or murine breast cancer tissue.

[0123] 2) Filter the breast cancer tissue with a 100 pm filter, and take the filtrate.

[0124] 3) Filter the breast cancer tissue in reverse with a 40 pm filter, and take the filtrate.

[0125] 4) Centrifuge at 800 rpm / min to obtain the cell sediment, resuspend the cells with a mixture of organoid culture medium and BME 1:3, and plant in a 96-well plate, 10 μl per well.

[0126] 5) Place the well plate in a 37°C cell culture incubator for 0.5 h, and prepare the organoid culture medium as needed.

[0127] 6) After the gel solidifies, add 100 ul / well of organoid culture medium.

[0128] 7) Take the tumor cells cultured from 3 patients, and randomly divide them into 4 groups, with the same grouping as (2).

[0129] 8) Take a photo after 7 days to detect the activity of the organoids. Figure 3 A).

[0130] Breast cancer organoid formula: Advanced DF12500 ml, R-spondin 100ng / ml, Noggin 100ng / ml, EGF 50ng / ml, FGF1010ng / ml, FGF210 ng / ml, N-Acegglytene 25mmol / ml, Nicotinamide10mmol / ml, ProstaglandinE21μmol / ml, SB0219010μmol / ml, A8301500nmol / ml, Y2763210μmol / ml, HEPES1X, Glutanmax 1X.

[0131] Organoid viability assay:

[0132] CellTiter- 3D is a luminescent assay kit for measuring cell viability in 3D cell culture. The following are detailed steps for its use:

[0133] 1) Reagent preparation: CellTiter- Thaw the 3D reagent overnight at 4°C. Do not place the frozen bottle directly into a water bath to thaw, as this may cause the bottle to crack. Before use, equilibrate the reagent to room temperature in a 22°C water bath, which takes approximately 30 minutes. Gently invert the bottle contents to obtain a homogenous solution. Be careful when sealing the 3D reagent bottles to avoid introducing ATP contamination.

[0134] 2) Cell culture: Prepare opaque-walled multiwell plates containing microtissues and culture medium. Sample volume and microtissue characteristics (e.g., size, number, and number of days in culture) should be optimized based on experimental conditions.

[0135] 3) Experimental processing: Add test compounds to the experimental wells and incubate according to the incubation protocol. Ensure that the volume of sample plus test compound is low enough to allow the addition of equal volumes of reagents and subsequent mixing without cross-well contamination.

[0136] 4) Detection step: Equilibrate the plate and its contents to room temperature (22-25°C) for approximately 30 minutes. Add CellTiter- 3D reagent (96-well plate, add 100 μl of CellTiter- 3D reagent). Mix the well contents vigorously for 5 minutes to induce cell lysis. Incubate the plate at room temperature for an additional 25 minutes to stabilize the luminescent signal.

[0137] 5) Record the luminescence signal.

[0138] HE staining and immunohistochemistry:

[0139] The above three groups of tumors were stained with HE and Ki67 immunohistochemically, and scored. The antibodies used were:

[0140] Ki67(27309-1-AP,1:200,Proteintech).

[0141] (4) Result analysis

[0142] The experimental results showed that compared with the subcutaneous tumors of MDA-MB-231 cells infected with sh-NC lentivirus, the subcutaneous tumors of MDA-MB-231 cells infected with sh-PSMD14 lentivirus had significantly smaller tumor volume and weight at 5 weeks ( Figure 2 AC). Among them, Figure 2 B proves that the anti-cancer effect of PSMD14 inhibitor combined with AA / RSL3 is significantly greater than that of using PSMD inhibitor alone, and is also significantly greater than that of using AA / RSL3 alone, proving that the combination of drugs has achieved significant therapeutic effects.

[0143] At week 5, the average tumor volume and weight in the OPA group were smaller than those in the Control group, indicating that OPA can inhibit the growth of breast cancer cells. However, the average tumor volume and weight were further reduced after the addition of arachidonic acid to OPA. Figure 3 BD).

[0144] Microscopy was used to evaluate changes in cells after single and combined treatment in three patient-derived PDO models. The results showed that in the OPA group, the cells lost their normal shape and became shrunken, while in the combined OPA+AA / RSL3 group, condensation and cristae became more pronounced ( Figure 3 G). Similarly, the combination therapy resulted in the most significant reduction in tumor organoid cell viability ( Figure 3 H). In addition, Ki67 immunostaining of PDOs showed that Ki67 expression was significantly reduced in the OPA plus AA / RSL3 group ( Figure 3 IJ). These results indicate that knockdown of PSMD14 significantly inhibits breast tumor cell growth in the presence of AA and RSL3 supplementation.

[0145] These results suggest that downregulation of PSMD14 expression combined with unsaturated fatty acids inhibits the growth of breast tumor cells, and PSMD14 can be used as a potential target for the treatment of TNBC patients.

[0146] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Use of a composition in preparing a drug for treating breast tumors, characterized in that: The composition includes a composition of a substance that inhibits PSMD14 gene expression and an unsaturated fatty acid. The substance that inhibits PSMD14 gene expression is a substance that reduces the expression of PSMD14 gene using a specific shRNA for PSMD14 gene. The substance that reduces the expression of PSMD14 gene using a specific shRNA for PSMD14 gene is an shRNA that specifically reduces the expression of PSMD14 gene, or an expression cassette that expresses the shRNA, or a recombinant vector containing the expression cassette, or a cell line containing the recombinant vector. The nucleotide sequence of the shRNA is as shown in SEQ ID NO: 1 and SEQ ID NO: 2, specifically: The PSMD14 shRNA positive strand sequence is: CCGGCTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCCAGATTC GAAGTTTTTG; The reverse strand sequence of PSMD14 shRNA is: AATTCAAAAACTTCGAATCTGGGTCACTTAACTCGAGTTAAGTGACCC AGATTCGAAG; The unsaturated fatty acid is arachidonic acid AA, the composition further comprises a GSH peroxidase 4 inhibitor RSL3, and the breast tumor is triple-negative breast cancer.

2. Use of a composition according to claim 1 in preparing a drug for treating breast tumors, characterized in that: The vector is a viral vector and / or a plasmid, the viral vector is specifically a lentivirus, and the plasmid is a pLKO.1puro vector.

3. Use of a composition according to claim 1 in preparing a drug for treating breast tumors, characterized in that: When the substance inhibiting PSMD14 gene expression is cells infected with sh-PSMD14 virus, the mass ratio of the sh-PSMD14 virus, the arachidonic acid AA and the RSL3 contained in the composition is 1:3:

3.

4. Use of a composition according to claim 1 in preparing a drug for treating breast tumors, characterized in that: The specific types of triple-negative breast cancer cells are MDA-MB-231, BT-549 or HCC1973.

Images