Antigenic epitope peptides of cd40 ligand, antibodies and uses

Abstract

The application relates to the technical field of cellular immunotherapy, in particular to an antigen epitope peptide of CD40 ligand, an antibody and application. The CD40LG target used in the application is mainly expressed by CD4+ T cells, greatly reducing self-killing. Moreover, CD40LG can effectively improve tumor immune escape as a novel target. The antibody provided by the application can specifically recognize CD40LG and has good affinity. The antibody can be used for constructing cells for adoptive immunotherapy or an ADC drug.

Description

[0001] This application claims priority to the Chinese patent application No. 202411814396.3, filed on December 10, 2024, and entitled "Antigen epitope peptide of CD40 ligand, antibody and application", the entire content of which is incorporated herein by reference. TECHNICAL FIELD

[0002] The present application relates to the technical field of cellular immunotherapy, in particular to an antigen epitope peptide of CD40 ligand, an antibody and application thereof. BACKGROUND

[0003] CAR-T and CAR-NK are two cutting-edge cellular immunotherapies that have shown great potential in cancer treatment. They use the patient's own or donor immune cells, which are genetically engineered to recognize and kill tumor cells.

[0004] Among them:

[0005] CAR-T (Chimeric Antigen Receptor T-Cell) therapy is a T-cell-based immunotherapy, where "T cells" are an important cell in the human immune system, responsible for recognizing and attacking pathogens and abnormal cells. Through genetic engineering technology, the surface of T cells is loaded with a chimeric antigen receptor (CAR), which can specifically recognize specific antigens on the surface of tumor cells, triggering the activation of T cells, which in turn kill these tumor cells. The main construction steps include: 1. Cell extraction: T cells are extracted from the patient's peripheral blood. 2. Genetic modification: genes encoding CAR are introduced into T cells through viral vectors or non-viral methods, allowing them to express CAR. 3. In vitro expansion: the modified T cells are expanded in vitro to increase their number. 4. In vivo reinfusion: after chemotherapy or lymphocyte depletion, the patient receives these modified T cells, and CAR-T cells begin to recognize and attack tumor cells.

[0006] CAR-NK (Chimeric Antigen Receptor Natural Killer Cell) therapy is a natural killer (NK) cell-based immunotherapy. NK cells are part of the innate immune system and have natural tumor cell and virus-infected cell killing ability. Unlike T cells, NK cells do not rely on antigen presentation and MHC molecule recognition, so they can attack malignant cells widely. Through genetic engineering, CAR chimeric antigen receptors are introduced into NK cells, allowing them to more specifically recognize and kill tumor cells. The main construction steps of CAR-NK are basically similar to those of CAR-T, with the main difference being the cell source: NK cells can be obtained from various sources, including peripheral blood, umbilical cord blood and induced pluripotent stem cells (iPSC).

[0007] T cell hematological diseases are treated with CAR-T or CAR-NK because these therapies have shown significant efficacy in targeting specific types of hematological malignancies, especially in cases where traditional therapies have limited effectiveness. However, this therapy also has certain drawbacks, for example: ① Because the chimeric antigen receptors expressed on the surface of CAR-T or CAR-NK cells can recognize and bind to antigens on the surface of the same type of cells, these cells kill each other (suicide killing), thereby reducing the survival rate and expansion ability of the treatment cells, affecting the treatment effect. ② The antigen targeted by CAR-T or CAR-NK not only exists on tumor cells but also is distributed on the surface of normal T cells. CAR-T or CAR-NK treatment can cause a large number of normal T cells to be reduced, thereby triggering immune deficiency and increasing the risk of infection in patients. ③ Tumor cells can escape the recognition and killing of immune cells by down-regulating or losing the expression of the targeted antigen, or by other mechanisms, leading to a lack of persistence or recurrence of the treatment effect. Currently, the main treatment targets for T cell hematological diseases are CD5, CD7, CD30, etc. With the advancement of CAR-T / CAR-NK treatment, tumor cells will undergo antigen modulation, down-regulating or not expressing the above targets. ④ The manufacturing process of CAR-T and CAR-NK cell therapy is complex, involving cell extraction, genetic modification, expansion, and other steps, which is costly and requires strict production environment and technical requirements, limiting its widespread application. The in vivo construction scheme involved in the present scheme can significantly reduce the above complex survival processes, thereby reducing costs.

[0008] CD40L (or denoted as CD40LG) is the receptor of CD40, and CD40 interacts with CD40L, thereby playing a key role in the regulation of immune response. The binding of CD40L to CD40 triggers the activation of the CD40 pathway, which up-regulates costimulatory molecules such as CD80 and CD86. Previous studies have shown that the expression of CD40LG in all normal tissues is significantly increased in T lymphoma, and the killing and destruction of normal tissues can be reduced by affinity adjustment, while CD40LG is mainly expressed in CD4+ T cells, causing less damage to T cells CD8+ T cells responsible for killing, which can reduce the risk of infection in patients. Therefore, CD40LG as a new target is expected to effectively improve tumor immune escape. However, there is currently a lack of antibodies with good affinity for CD40L. SUMMARY

[0009] Therefore, the technical problem to be solved by the present application is to provide an antigenic epitope peptide of CD40 ligand, an antibody and applications thereof.

[0010] The amino acid sequence of the antigen epitope peptide of the CD40 ligand provided by the application is KDIMLNKEETKKENSFE. Alternatively, it has a sequence of 1 or more amino acids substituted, deleted, added and / or replaced on the basis of the amino acid sequence as shown above; or a sequence with more than 80% homology with the amino acid sequence as shown in any one of the above.

[0011] The epitope peptide provided by the application is obtained through screening and optimization. Compared with fragments of other peptide sequences, the antigen epitope peptide with the amino acid sequence KDIMLNKEETKKENSFE is used to immunize animals, and the antibody of the CD40 ligand prepared therefrom has more excellent immunogenicity and good affinity with the CD40 ligand.

[0012] The application also provides an immunogen comprising the antigen epitope peptide and the auxiliary protein as described above.

[0013] In the application, the auxiliary protein is BSA, KLH or OVA, and the application does not limit the auxiliary protein. The KLH has good immunogenicity after being connected with the epitope peptide, and the protein with KLH located at the N terminal and the epitope peptide located at the C terminal is more suitable as an immunogen.

[0014] Further, the application also provides an antibody of the CD40 ligand, which comprises:

[0015] VHCDR1, VHCDR2 and VHCDR3,

[0016] VLCDR1, VLCDR2 and VLCDR3.

[0017] Specifically:

[0018] The amino acid sequence of VHCDR1 is GIDLSX1YG, wherein X1 is Q or S;

[0019] The amino acid sequence of VHCDR2 is X2X3TGGX4X5, wherein X2 is V or I, X3 is T or S, X4 is I, R or Y, and X5 is T or V;

[0020] The amino acid sequence of VHCDR3 is ARGNIDYLX6L, wherein X6 is K or N;

[0021] The amino acid sequence of VLCDR1 is KX7X8YKNNW, wherein X7 is S or T, and X8 is V or I;

[0022] The amino acid sequence of VLCDR2 is EX9S, wherein X9 is A or T;

[0023] The amino acid sequence of VLCDR3 is AGGYX10X11DSDDX12, wherein X10 is S or N, X11 is S or G, and X12 is G or S.

[0024] In some embodiments, the amino acid sequences of the heavy chain CDR1-3 of the antibody of the CD40 ligand are GIDLSQYG, VTTGGIT, ARGNIDYLKL in turn, and the amino acid sequences of the light chain CDR1-3 are KSVYKNNW, EAS, AGGYSSDSDDG in turn.

[0025] In some embodiments, the amino acid sequences of the heavy chain CDR1-3 of the antibody of the CD40 ligand are GIDLSSYG, ISTGGRV, ARGNIDYLNL in turn, and the amino acid sequences of the light chain CDR1-3 are KSIYKNNW, EAS, AGGYNSDSDDS in turn.

[0026] In some embodiments, the amino acid sequences of the heavy chain CDR1-3 of the antibody of the CD40 ligand are GIDLSSYG, ISTGGYT, ARGNIDYLNL in turn, and the amino acid sequences of the light chain CDR1-3 are KTVYKNNW, ETS, AGGYSGDSDDS in turn.

[0027] In the embodiments of the present application, the heavy chain variable region of the antibody has an amino acid sequence as shown in any one of SEQ ID NO: 7-9; or has a sequence in which one or more amino acids are substituted, deleted, added and / or replaced on the basis of the amino acid sequence as shown above; or has a sequence with more than 80% homology with the amino acid sequence as shown in any one of the above.

[0028] In the embodiments of the present application, the light chain variable region of the antibody has an amino acid sequence as shown in any one of SEQ ID NO: 10-12. Or it has a sequence in which one or more amino acids are substituted, deleted, added and / or replaced on the basis of the amino acid sequence as shown above; or has a sequence with more than 80% homology with the amino acid sequence as shown in any one of the above.

[0029] In some embodiments, the amino acid sequence of the heavy chain variable region of the antibody is as shown in SEQ ID NO: 7, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO: 10.

[0030] In other embodiments, the amino acid sequence of the heavy chain variable region of the antibody is as shown in SEQ ID NO: 7, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO: 11.

[0031] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 7 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 12.

[0032] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 8 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 10.

[0033] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 8 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 11.

[0034] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 8 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 12.

[0035] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 9 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 10.

[0036] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 9 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 11.

[0037] In some embodiments, the antibody has a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 9 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 12.

[0038] In some embodiments, the antibody provided by the present application is a single chain antibody. The present application does not limit the order of the heavy chain and the light chain in the single chain antibody. For example, the N-terminus can be the light chain or the heavy chain. The light chain and the heavy chain are connected by a linker. The present application does not limit the linker connecting the two fragments. In some embodiments, the linker connecting the heavy chain variable region and the light chain variable region is (G4S)3.

[0039] Further, the present application also provides a chimeric antigen receptor comprising an extracellular domain, a transmembrane domain and an intracellular domain, wherein the antigen binding domain of the extracellular domain comprises an antibody as described above.

[0040] As a feasible case, the transmembrane domain in the chimeric antigen receptor is CD8, CD3z or CD28.

[0041] As a feasibility case, the intracellular domain in the chimeric antigen receptor is CD3 or at least one of the following molecules: CD28, ICOS, 4-1BB, OX40, CD27 or 2B4. For example, the intracellular domain is CD3 and one or two of CD28, ICOS, 4-1BB, OX40, CD27 or 2B4. Or the intracellular domain is a fourth-generation genetically edited CAR.

[0042] As a feasibility case, the extracellular domain in the chimeric antigen receptor is an antibody of CD40 ligand as described above.

[0043] As a feasibility case, the chimeric antigen receptor further comprises a hinge region CD8, Fc, IgG4, IgG1, DAP12 or CD28.

[0044] Further, the present application also provides a nucleic acid, which is any one of the following:

[0045] I) a nucleic acid encoding an antibody as described above;

[0046] II) a nucleic acid encoding an antigenic epitope peptide as described above;

[0047] III) a nucleic acid encoding an immunogen as described above;

[0048] IV) a nucleic acid encoding a chimeric antigen receptor as described above.

[0049] The nucleic acid provided by the present application is DNA or RNA, which can be used to construct a plasmid vector for expressing a protein, and can also be used as a transcription expression baculovirus, adenovirus, adeno-associated virus or lentivirus.

[0050] Further, the present application also provides an expression unit, which comprises a promoter and a nucleic acid as described above.

[0051] In the present application, the promoter is selected from CAG promoter, CMV promoter, EF1α promoter, PGK promoter, T7 promoter, SV40 promoter, SFFV promoter, MSCV promoter, UBC promoter, TRE promoter, Rh2 promoter. The expression unit further comprises a terminator, and the terminator is selected from a simple terminator and a ρ-dependent terminator. In addition, the expression unit can further comprise an enhancer, a signal peptide sequence, a tailing signal, a kozak element, an enzyme cutting site and / or an intron.

[0052] Further, the present application also provides a plasmid vector, which comprises a nucleic acid as described above and / or an expression unit as described above.

[0053] In the present application, the backbone vector of the plasmid vector is a mammalian cell expression vector or a bacterial expression vector, which is not limited by the present application.

[0054] Further, the present application also provides a cell expressing the antibody as described above, and / or the chimeric antigen receptor as described above.

[0055] In some possible cases, the cell is a T cell or a NK cell, for example, it is a T cell or a NK cell expressing the chimeric antigen receptor as described above.

[0056] The method for constructing the T cell or the NK cell according to the present application comprises: transfecting a T cell or a NK cell with a viral vector containing a nucleic acid.

[0057] In some possible cases, the cell is an E. coli or a yeast. For example, it is an E. coli or a yeast expressing the antibody or the chimeric antigen receptor as described above.

[0058] The method for constructing the E. coli according to the present application comprises: transforming a host with a plasmid vector containing a nucleic acid as described above.

[0059] Further, the present application also provides a labeled antibody formed by connecting the antibody with a label; the label is a chemical label or a biological label. In the present application, the connection between the antibody and the label can be through an amide bond or through a streptavidin-biotin system, and the present application does not limit the connection.

[0060] In some embodiments, the label is a fluorescent indicator, a chemiluminescent indicator, an isotope, a colloidal indicator, biotin, avidin, or an enzyme label.

[0061] In some specific embodiments, the fluorescent indicator is selected from one or more of AF350, AF488, AF532, AF546, AF555, AF568, AF594, AF633, AF647, AF660, AF680, FITC, TRITC, RB200, phycoerythrin, APC, Cy5, Oregon Green 488, Pacific Blue dye, Pacific Orange dye, Texas Red, or PerCP dye.

[0062] In some specific embodiments, the chemiluminescent indicator is selected from one or more of acridinium ester, acridinium sulfonamide and derivatives thereof, luminol, isoluminol, isoluminol isothiocyanate and derivatives thereof, N-(4-aminobutyl)-N-ethylisoluminol, 4,5-diaminobenzhydrazide, or aminobutylethylbenzhydrazide.

[0063] In some specific embodiments, the isotope is selected from 125 I、1 31 I、 124 I、 3H、 14 C、 111 In、 89 Zr or 32 one or more of P.

[0064] In some embodiments, the colloidal indicator is selected from one or more of colloidal gold, colloidal carbon, or colloidal selenium.

[0065] In some embodiments, the enzyme label is selected from one or more of horseradish peroxidase, alkaline phosphatase, beta-galactosidase, peroxidase-anti-peroxidase bridge, alkaline phosphatase-anti-alkaline phosphatase bridge, beta-galactosidase-anti-beta-galactosidase bridge.

[0066] Further, the present application also provides a conjugate of the antibody and a medium; the medium is colloidal gold, an enzyme-labeled plate, magnetic beads, or latex microspheres. In the present application, the antibody and the medium can be connected by an amide bond or by a streptavidin-biotin system, and the present application does not limit this.

[0067] Further, the present application also provides an antibody-conjugated drug of the antibody and a drug; the drug includes a microtubule inhibitor, a DNA damaging agent, a DNA alkylating agent, or a topoisomerase inhibitor.

[0068] The microtubule inhibitor includes, but is not limited to, a maytansine derivative (such as DM1, DM4) or an auristatin derivative (such as MMAE (monomethyl auristatin E) or MMAF (monomethyl auristatin F)).

[0069] The DNA damaging agent includes, but is not limited to, a calicheamicin or a pyrrolobenzodiazepine (PBD).

[0070] The DNA alkylating agent includes, but is not limited to, Deruxtecan.

[0071] The topoisomerase inhibitor includes, but is not limited to, SN-38.

[0072] In the present application, the antibody and the drug can be connected by an amide bond or by a streptavidin-biotin system, and the present application does not limit this.

[0073] Further, the present application also provides the use of the cell and / or the antibody-conjugated drug in the preparation of a drug for treating tumors.

[0074] The tumor in the present application is a tumor with CD40LG on the cell surface. It includes but is not limited to peripheral T-cell lymphoma, AITL (angioimmunoblastic T-cell lymphoma), ALCL (anaplastic large cell lymphoma) or ATLL (adult T-cell leukemia lymphoma).

[0075] Further, the present application also provides a medicine comprising the cell and / or the antibody binding medicine.

[0076] In the present application, the medicine further comprises a pharmaceutically acceptable excipient. In the present application, the dosage form of the medicine includes but is not limited to oral preparations, injections, aerosols or suppositories. The oral preparations include but are not limited to tablets, capsules, pills, oral liquids or dispersions. The injections include but are not limited to injection liquids or injection powders for injection.

[0077] The medicine in the present application further comprises other anti-tumor drugs, for example, the anti-tumor drugs include but are not limited to chemotherapy drugs, targeted drugs, immunotherapy drugs or traditional Chinese medicines. As a feasible case, the chemotherapy drugs include paclitaxel, docetaxel, vinorelbine, gemcitabine, cisplatin, carboplatin, nedaplatin, 5-fluorouracil, capecitabine, tegafur capsules, irinotecan or amrubicin. The targeted drugs include gefitinib, erlotinib, afatinib, osimertinib, crizotinib, sunitinib, sorafenib, lenvatinib mesylate, apatinib mesylate, bevacizumab, cetuximab or anlotinib. The immunotherapy drugs include pembrolizumab, nivolumab, tremelimumab, durvalumab, sintilimab or atezolizumab. The traditional Chinese medicines include ganoderma, taxus, toad, cordyceps, scorpion, American ginseng, astragalus, angelica, panax notoginseng or gynostemma pentaphyllum.

[0078] Further, the present application also provides a method for treating a tumor, which comprises administering the medicine as described above. The administration mode of the medicine or the pharmaceutical composition includes but is not limited to oral administration, spray inhalation, buccal administration, nasal administration, vaginal administration, rectal administration, topical administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal and intracranial injection or infusion, or administration by means of an external implant reservoir. Among them, oral administration, intraperitoneal administration or intravenous administration are preferred.

[0079] Further, the present application also provides the use of the antibody, the labeled antibody or the conjugate in the preparation of a reagent for detecting CD40 ligand.

[0080] Further, the present application also provides a detection reagent for CD40 ligand, which comprises the antibody, the labeled antibody or the conjugate.

[0081] Further, the present application also provides a method for detecting CD40 ligand, which comprises detecting a sample with a detection reagent as described above.

[0082] In the present application, the detection method is an immunological detection method, including but not limited to ELISA, flow cytometry and / or immunohistochemistry. The sample includes but is not limited to cells, blood, sections or tissue homogenate. The detection method of the present application can be for diagnostic or therapeutic purposes, or for non-diagnostic or non-therapeutic purposes, which is not limited by the present application. The sample includes but is not limited to cells, blood, sections or tissue homogenate.

[0083] The present application provides an antigenic epitope peptide and an antibody of CD40 ligand, which has at least one of the following advantages:

[0084] ① The CD40LG target used in the present application is mainly expressed in CD4+ T cells, while the T cells used in the construction of CAR-T are mainly CD8+ T cells, and the expression of CD40LG on the surface of NK cells is also low, thus greatly reducing self-killing. Moreover, CD40LG as a new target can effectively improve tumor immune escape.

[0085] ② Through large sample transcriptome sequencing analysis of T lymphoma tumor tissues of patients, it is found that the expression of CD40LG in T lymphoma is significantly higher than that in all normal tissues in the TCGA database, which can be reduced by affinity adjustment to reduce damage to normal tissues, and CD40LG is mainly expressed in CD4+ T cells, which can reduce the damage to T cells CD8+ T cells mainly responsible for killing, and can reduce the risk of infection of patients.

[0086] ③ The antibody provided by the present application can specifically recognize CD40LG and has good affinity. It can be used to construct CAR-T cells or CAR-NK cells.

[0087] ④ The in vivo construction scheme (direct transfection of cells with viral vectors) involved in the present application significantly reduces the above complex production process, thereby reducing costs. BRIEF DESCRIPTION OF DRAWINGS

[0088] Figure 1 Flow cytometry detection showed that specific antibodies against KLH-KDIMLNKEETKKENSFE immunopeptide existed in the sera of two rabbits;

[0089] Figure 2 Flow cytometry detection results of 33 monoclonal B cells against KLH-KDIMLNKEETKKENSFE immunopeptide;

[0090] Figure 3 ELISA and flow cytometry detection results of 10 monoclonal cell strains;

[0091] Figure 4 SPR affinity of the antibodies to CD40LG purified protein is shown;

[0092] Figure 5 CAR-T cell self-killing detection is shown;

[0093] Figure 6 CAR-T cell killing ability to tumor detection is shown;

[0094] Figure 7 CD40L expression in CD4 and CD8+ T cells is shown

[0095] Figure 8 CD3+CAR-CD40L effect on T cell tumor killing is shown. DETAILED DESCRIPTION

[0096] The present application provides antigenic epitope peptides of CD40 ligand, antibodies and applications, those skilled in the art can learn from the content of this paper, and appropriate improvement process parameters are realized. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are regarded as included in the present application. The method and application of the present application have been described by the preferred embodiment, and the relevant personnel can obviously change or appropriately change and combine the method and application of this paper without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0097] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have meanings that are commonly understood by those of ordinary skill in the art.

[0098] In this application, "at least one" means one or more, and "multiple" means two or more. "At least one of the following" or similar expressions means any combination of these items, including any combination of single or multiple items.

[0099] The terms "comprise", "contain" and "have" are used interchangeably in this application, and are intended to mean the inclusiveness of the scheme, meaning that the scheme can have other elements in addition to the listed elements. It should also be understood that the use of "comprise", "contain" and "have" in this paper also provides "consisting of" scheme.

[0100] The term "and / or" is used in this paper, including "and", "or" and "all or any other combination of elements linked by the term". The meaning of "and / or".

[0101] The term "identity" as used herein can be calculated as follows: to determine the percent "identity" of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[0102] The comparison of sequences and calculation of percent identity between two sequences can be accomplished using a mathematical algorithm. For instance, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a gap length weight of 1, 2, 3, 4, 5, or 6. For instance, the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a gap length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the set that should be used unless otherwise specified) is a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0103] The percent identity between two amino acid sequences or two nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller ((1989) CABIOS, 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.

[0104] In the present application, the identity of 80% or more means that the identity is greater than 85%, or greater than 90%, or greater than 95%, or greater than 96%, or greater than 97%, or greater than 98%, or greater than 98%, or greater than 99%, or greater than 99.5%, or greater than 99.8%, or greater than 99.9%.

[0105] The materials used in the present application are all ordinary commercially available products, which can be purchased in the market.

[0106] The heavy chain and light chain sequences of the main antibodies involved in the embodiments of the present application are as follows, wherein the ___ indicates a signal peptide (SEQ ID NO: 13), the lower case letters indicate CDR regions, and the upper case letters indicate FR regions.

[0107] >4B8-VH

[0108] METDTLLLWVLLLWVPGSTG QSMEESGGRLVTPGGSLTLTCTVSgidlsqygVTWVRQAPGKGLEWIGYvttggitYYADWAKGRFTISKSSPTVDLKMTSLTTEDTATYFCargnidylklWGPGTVVTVSS

[0109] >4B8-VL

[0110] METDTLLLWVLLLWVPGSTG AAVLTQTPSPVSAAVGGTVSISCQSSksvyknnwLSWFQQKPGQPPKLLIYeasKLASGVPSRFSGSGSGTQFTLTISDVQCADAATYYCaggyssdsddgFGGGTEMVVK

[0111] >6C11-VH

[0112] METDTLLLWVLLLWVPGSTG QSVEESGGRLVTPGTPLTLTCTVSgidlssygMSWVRQAPGKGLEYIGYistggrvYYASWAKGRFTISKTSTTVDLKITSPTTEDTATYFCargnidylnlWGPGTLVTVSS

[0113] >6C11-VL

[0114] METDTLLLWVLLLWVPGSTG AAVLTQTPSSVSAAVGGTVTINCQSSksiyknnwLSWFQQKPGQPPKLLIYeasKLASGVPSRFSGSGSGTQFTLTISGVQCADAATYYCaggynsdsddsFGGGTEVVVK

[0115] >6D6-VH

[0116] METDTLLLWVLLLWVPGSTGQSVEESGGRLVTPGTPLTLTCTVSgidlssygMSWVRQAPGKGLEYIGYistggytNYASWAKGRFTISKTSTTVDLKITSPTTVDTATYFCargnidylnlWGPGTLVTVSS

[0117] >6D6-VH

[0118] METDTLLLWVLLLWVPGSTG AAVLTQTPSSVSAAVGGTVTINCQSSktvyknnwLSWFQQKPGQPPKLLIYetsKLASGVPSRFSGSGSGTQFTLTISGVQCADAATYYCaggysgdsddsFGGGTEVVVK

[0119] >7G8-VH

[0120] METDTLLLWVLLLWVPGSTG QSVEESGGRLVTPGTPLTLTCTVSgfslssynMQWVRQAPGKGLEWIGAisrsgntYYASWPKGRATISRTSTTVHLQMTSLTTEDTATYFCarglgrnnlWGPGTLVTVSS

[0121] >7G8-VL

[0122] METDTLLLWVLLLWVPGSTG AIVMTQTPSSKSVPVGDTVTINCQASenvyennqLSWFQQKPGQPPKLLIYeasKLASGVPSRFKGSGSGTHFTLTISDVVCDDAATYYCagfdasyndntaFGGGTEVVVK

[0123] Table 1 Antibody CDR Region Sequences

[0124]

[0125] >4B8_VH_(G4S)3_VL

[0126] CAGAGCATGGAAGAGTCTGGCGGTAGGCTGGTCACACCTGGAGGCTCACTGACCTTGACCTGCACCGTGTCCGGAATCGACCTGAGCCAGTATGGTGTGACCTGGGTCAGGCAGGCACCTGGCAAGGGTCTGGAGTGGATTGGCTACGTCACTACCGGCGGCATCACTTACTACGCCGACTGGGCCAAGGGCAGGTTCACCATCTCCAAGTCTAGCCCAACAGTCGATTTGAAGATGACAAGCCTGACAACCGAAGACACCGCTACCTACTTCTGTGCTAGAGGCAACATCGACTACCTGAAGCTGTGGGGACCTGGCACAGTGGTCACCGTGTCTAGCGGAGGTGGCGGTAGCGGAGGCGGAGGTTCTGGTGGAGGTGGCAGTGCTGCCGTGCTGACACAGACACCTAGTCCAGTTAGCGCTGCAGTGGGTGGTACTGTCTCCATCAGCTGCCAGAGCAGCAAGTCTGTCTACAAGAACAACTGGCTGTCTTGGTTCCAGCAGAAGCCTGGTCAGCCACCTAAGCTGCTGATCTACGAAGCCAGCAAGTTGGCCTCTGGCGTGCCAAGCAGGTTCTCCGGATCTGGTTCTGGCACTCAGTTCACACTGACCATCTCAGATGTCCAGTGTGCTGACGCCGCCACATACTATTGCGCCGGCGGATACAGCTCCGATTCCGATGACGGCTTTGGAGGTGGTACAGAGATGGTGGTGAAG

[0127] >4B8_VL_(G4S)3_VH

[0128] GCTGCAGTGCTGACTCAAACACCTTCTCCAGTCTCTGCTGCTGTGGGTGGCACAGTTTCTATCTCTTGTCAGAGCAGCAAGTCCGTCTACAAGAACAACTGGCTGTCTTGGTTCCAGCAGAAGCCTGGACAGCCTCCAAAGCTGTTGATCTACGAGGCTAGTAAGCTGGCTTCCGGTGTGCCAAGCCGCTTCTCTGGCAGTGGATCTGGCACACAGTTTACACTCACCATCAGCGATGTGCAGTGCGCAGATGCCGCAACCTACTATTGCGCCGGTGGCTACTCCAGCGATTCCGACGACGGTTTCGGCGGAGGCACAGAGATGGTGGTCAAGGGAGGTGGTGGTAGCGGCGGCGGTGGCTCTGGAGGTGGCGGCTCTCAGTCTATGGAAGAGTCCGGCGGCAGACTGGTCACGCCAGGTGGCTCTCTGACACTGACCTGTACCGTTAGCGGCATCGATCTGAGTCAGTACGGAGTCACTTGGGTGAGACAGGCTCCAGGTAAGGGTCTGGAGTGGATCGGCTACGTGACCACCGGAGGCATCACCTACTATGCCGACTGGGCCAAGGGCAGGTTCACCATAAGCAAGTCCAGCCCAACAGTGGACCTCAAGATGACCAGCCTGACAACCGAAGACACAGCCACCTACTTCTGTGCCAGAGGCAACATCGATTACCTGAAGCTGTGGGGACCAGGTACAGTGGTCACCGTCTCTTCC

[0129] >6C11_VH_(G4S)3_VL

[0130] CAGTCCGTGGAAGAATCTGGCGGTAGACTGGTCACACCAGGTACACCTCTGACCTTGACCTGCACCGTGTCCGGTATCGACCTGTCTTCTTACGGCATGAGCTGGGTGAGACAGGCACCAGGCAAGGGATTGGAGTACATCGGTTATATCTCCACAGGTGGCAGGGTGTATTACGCCTCTTGGGCCAAGGGCAGGTTCACCATTAGCAAGACCAGCACAACCGTGGACCTCAAGATCACCTCTCCAACAACTGAAGACACCGCAACCTACTTCTGCGCCAGAGGCAACATCGACTACCTGAACCTGTGGGGCCCTGGTACACTGGTGACCGTCAGTTCCGGTGGCGGTGGTTCCGGTGGAGGTGGCTCCGGTGGTGGAGGCTCCGCTGCCGTCTTGACTCAGACACCTAGCAGCGTCTCCGCTGCTGTTGGAGGCACCGTCACCATCAACTGTCAGAGCAGCAAGAGCATCTATAAGAACAACTGGCTGTCTTGGTTCCAGCAGAAGCCTGGTCAGCCACCAAAGTTGCTCATCTACGAGGCCTCCAAACTGGCCAGTGGCGTGCCTTCTCGCTTCTCTGGCAGCGGTTCTGGCACACAGTTCACACTGACAATCTCCGGAGTCCAGTGTGCTGACGCAGCCACTTACTACTGTGCTGGAGGCTACAACAGCGACAGCGATGATAGCTTCGGTGGTGGCACAGAAGTCGTGGTGAAG

[0131] >6C11_VL_(G4S)3_VH

[0132] GCCGCCGTCTTGACTCAGACACCAAGCTCTGTATCTGCCGCAGTAGGCGGTACAGTGACTATCAACTGCCAGAGCAGCAAGTCCATCTACAAGAACAACTGGCTGTCTTGGTTCCAGCAGAAGCCAGGTCAGCCTCCAAAGCTGCTGATCTATGAAGCCAGCAAACTGGCATCCGGAGTGCCAAGCAGATTCTCCGGTTCTGGTAGCGGTACACAGTTTACACTGACCATCAGCGGTGTGCAGTGTGCAGATGCTGCCACCTACTACTGCGCCGGCGGCTACAACTCCGACTCCGATGATAGCTTCGGAGGCGGCACCGAAGTGGTGGTGAAGGGTGGCGGTGGATCTGGAGGTGGCGGATCTGGCGGAGGTGGAAGCCAGAGCGTGGAAGAATCCGGTGGTAGGCTGGTCACACCAGGCACACCACTGACATTGACCTGCACAGTGAGCGGTATCGATCTGTCTTCTTACGGCATGAGCTGGGTCCGACAGGCTCCAGGCAAAGGCCTGGAGTACATCGGCTACATCTCCACTGGTGGACGGGTGTACTATGCCAGCTGGGCTAAAGGCAGATTCACCATCTCTAAGACCTCTACAACCGTGGACCTGAAGATTACATCTCCAACTACCGAAGATACTGCAACCTATTTCTGCGCTAGAGGCAACATCGACTATCTGAACCTCTGGGGACCAGGTACACTGGTGACCGTGAGTTCC

[0133] >6D6_VH_(G4S)3_VL

[0134] CAGAGCGTGGAAGAGAGCGGAGGCAGGCTTGTGACACCTGGTACACCACTGACCTTGACCTGCACAGTGTCTGGCATCGACCTGTCAAGCTACGGCATGTCTTGGGTGAGACAGGCCCCTGGCAAGGGCCTGGAATACATCGGCTACATCTCCACAGGCGGCTACACCAACTACGCCTCTTGGGCAAAGGGAAGATTTACCATCTCCAAGACCAGTACCACTGTGGACCTGAAGATCACCTCACCTACAACTGTCGATACCGCAACATACTTCTGCGCAAGAGGCAACATCGACTACCTCAACTTGTGGGGTCCAGGTACACTCGTCACAGTCTCAAGCGGTGGCGGCGGTTCTGGCGGAGGTGGTTCAGGCGGTGGTGGTTCCGCCGCTGTCTTGACACAGACACCATCTAGCGTGTCTGCTGCTGTCGGTGGCACCGTCACAATCAACTGCCAGTCTTCCAAGACCGTGTACAAGAACAACTGGCTCAGCTGGTTCCAGCAGAAGCCTGGTCAGCCTCCAAAGCTGCTGATCTACGAGACCTCCAAGCTGGCAAGCGGCGTGCCATCTCGGTTCTCTGGTTCTGGCAGCGGCACACAGTTCACCTTGACAATCTCCGGCGTTCAGTGTGCCGACGCTGCCACCTACTACTGCGCTGGAGGCTACTCTGGCGACTCTGACGACTCTTTCGGCGGTGGTACTGAGGTGGTGGTGAAG

[0135] >6D6_VL_(G4S)3_VH

[0136] GCCGCCGTACTGACACAGACACCAAGTTCCGTCAGTGCTGCTGTTGGTGGTACAGTCACCATTAACTGTCAGAGTTCCAAGACCGTGTACAAGAACAACTGGCTGTCTTGGTTCCAGCAGAAGCCAGGCCAGCCACCTAAACTGCTGATCTACGAGACTAGCAAGCTGGCCTCCGGTGTGCCTTCCAGATTCTCTGGTAGTGGCAGCGGCACTCAGTTTACCTTGACCATCAGCGGTGTGCAGTGTGCCGACGCTGCAACCTACTACTGCGCTGGCGGCTACTCTGGTGATTCTGACGACAGCTTTGGCGGTGGCACAGAGGTGGTCGTGAAAGGCGGAGGCGGTTCTGGAGGCGGCGGAAGTGGCGGTGGCGGCAGTCAGTCCGTGGAAGAGAGCGGCGGAAGACTGGTGACACCTGGTACACCTTTGACACTGACCTGCACCGTCTCCGGTATTGACTTGTCTAGCTACGGTATGAGCTGGGTGAGACAGGCTCCAGGCAAGGGATTGGAGTACATTGGCTACATCAGCACCGGCGGTTATACCAACTACGCAAGCTGGGCTAAGGGCAGATTCACCATCAGCAAGACCTCTACAACCGTGGATCTGAAGATCACCTCACCTACTACCGTGGACACAGCCACATACTTCTGCGCACGCGGCAACATCGACTACCTGAACCTGTGGGGTCCAGGCACCTTGGTCACTGTGAGCAGC

[0137] The application will be further described below in connection with examples:

[0138] Example

[0139] 1. scFV screening process:

[0140] Pre-immune background screening: 1 ml from each of the 4 rabbits was taken for background detection, ELISA routine detection: 2 rabbits with lower background were selected for subsequent immunization against detection of original-biotin-KDIMLNKEETKKENSFE.

[0141] 2. Immunization stage:

[0142] The KLH-KDIMLNKEETKKENSFE was used to immunize the two rabbits with low background selected above for a total of 5 times. For the serum of the two rabbits immunized five times, 2 ml / rabbit was purified by protein A antibody. The purified antibody was detected by ELISA: ELISA detection was performed against the original-biotin-KDIMLNKEETKKENSFE, and one rabbit with high antibody titer was selected. At the same time, flow detection was performed on CD40LG positive cell lines, and significant transition was observed. Rabbit 33 was selected for subsequent experiments. Figure 1

[0143] 3. B cell sorting stage:

[0144] The spleen of the rabbit selected above was taken out to separate single B cells, which were then plated and expanded in 96-well plates. The supernatant of single B cells was detected by ELISA antibody titer and flow cytometry to screen positive clones. Figure 2

[0145] 4. Linear expression stage:

[0146] According to the ELISA and flow cytometry detection results in step 3, the top 10 monoclonal B cell lines were selected for sequencing. According to the sequencing results, plasmids were constructed, and linear expression was performed in 293T cells. The supernatant was detected by polypeptide-coated ELISA, CD40LG protein-coated ELISA, and flow cytometry. Four monoclonal antibodies (4B8, 6C11, 6D6, and 7GB) that showed significant binding in the above three experiments were selected for subsequent experiments. Figure 3

[0147] 5. Complete antibody construction:

[0148] The above four monoclonal antibodies were constructed into IgG1 complete antibodies. Each clone was divided into two clones according to the linkage mode of light and heavy chains: VLVH and VHVL.

[0149] The nucleic acid sequences are as follows:

[0150] 4B8_VH_(G4S)3_VL, 4B8_VL_(G4S)3_VH, 6C11_VH_(G4S)3_VL, 6C11_VL_(G4S)3_VH, 6D6_VH_(G4S)3_VL, 6D6_VL_(G4S)3_VH.

[0151] The obtained antibodies were subjected to SPR affinity ranking with CD40LG purified protein. The specific affinity is shown in Table 1 and Figure 4 :

[0152] Table 2

[0153] Injection variables Analyte 1 Solution 1 : 1 binding ka kd KD (M) 4B8 VH VL 9.03E+04 7.96E-03 8.82E-08 4B8 VL VH 1.55E+05 6.58E-03 4.25E-08 6C11 VH VL 1.76E+05 1.29E-02 7.34E-08 6C11 VL VH 9.13E+04 7.75E-03 8.49E-08 6D6 VH VL 1.03E+05 4.95E-03 4.79E-08 6D6 VL VH 8.46E+04 4.75E-03 5.62E-08 7GB VH VL 5.53E+04 3.99E-03 7.20E-08 7GB VL VH 1.15E+05 3.46E-03 3.00E-08 ​​​

[0154] Results showed that VHVL and VLVH of 7GB had no significant binding, excluding the clone, and the remaining clones had significant binding force. CAR plasmid and virus were constructed, and in vivo and in vitro tumor killing activity detection was performed.

[0155] 6. In vitro CAR-T construction process

[0156] 6.1 T cell separation

[0157] Step: T cells are isolated from the peripheral blood of patients by leukapheresis. The commonly used equipment is a cell separator, which can separate white blood cells from blood by centrifugation.

[0158] Objective: To obtain enriched T cells for subsequent gene editing and culture.

[0159] 6.2 T cell activation

[0160] Step: Under in vitro culture conditions, the isolated T cells are activated by using anti-CD3 antibodies and anti-CD28 antibodies or other costimulatory molecules. CD3 antibodies mimic the natural stimulation of T cell receptors (TCR), and CD28 provides a costimulatory signal to synergistically promote T cell activation and proliferation.

[0161] Objective: To make T cells from a resting state to a proliferative activated state, ready for gene modification.

[0162] 6.3 Gene transduction (introduction of CAR gene)

[0163] Step: Use viral vectors (such as lentivirus or retrovirus) to introduce the designed CAR gene into T cells. CAR gene encodes a chimeric antigen receptor that can specifically recognize tumor surface antigens. After transduction, T cells will express this chimeric receptor, allowing them to recognize and kill specific tumor cells.

[0164] Method: ① The commonly used transduction method is viral transduction (lentivirus or retrovirus vector). Viral vectors have high gene delivery capacity and can stably integrate CAR genes into T cell genomes, allowing long-term expression.

[0165] ② Nanoparticle carriers: Nanoparticles are another delivery system that can encapsulate and protect CAR plasmids and deliver them to target cells through the blood system. The surface of nanoparticles can be modified with targeting molecules to improve selectivity for T cells. Common types of nanoparticles include:

[0166] ③ Lipid nanoparticles (LNP): These nanoparticles are widely used for delivering mRNA and plasmid DNA, and have been successfully used in COVID-19 vaccines. By encapsulating plasmid-encoded CARs in lipid nanoparticles, they can be injected into the body, allowing the plasmid to directly enter T cells.

[0167] ④ Polymer nanoparticles: These particles are based on biocompatible polymers such as PLA or PLGA, and can carry genetic materials to T cells through electrostatic adsorption or chemical bonding.

[0168] Objective: Through gene editing, T cells express CAR receptors that specifically recognize tumor antigens.

[0169] 6.4 T cell expansion

[0170] Step: Successfully transduced CAR-T cells are cultured in vitro, and cytokines such as IL-2 are used to promote the massive proliferation of CAR-T cells. The culture environment is usually a closed sterile system that can provide conditions suitable for T cell growth.

[0171] 6.5 Quality detection

[0172] Step: During and after expansion, the number of viable cells generated by CAR-T cells is detected. Meanwhile, CAR-CD40L cells, WT CD3+ T cells and CAR-CD19 cells constructed as before are cultured, and the number of cells is detected on days 4, 8 and 12, respectively. The results are as follows Figure 5 : The results show that the proliferation ability of CAR-CD40L is about 25% lower than that of WT CD3+ T cells and CAR-CD19; while the self-killing rate of previous CAR-CD7 is more than 80%; indicating that CAR-CD40L constructed as before will not significantly weaken the function due to self-killing.

[0173] 7, In vitro tumor killing detection

[0174] Successfully constructed CAR-T cells need to be functionally detected to verify whether they can effectively kill targeted tumor cells. In vitro tumor killing detection is usually carried out in the laboratory by co-culturing tumor cells and CAR-T cells to observe the killing effect of CAR-T cells on tumors.

[0175] 7.1 Target cell preparation (tumor cell line)

[0176] Step: Select appropriate tumor cell lines (Jurkat cells, karpas299 cells and H9 cells), which should express tumor antigens targeted by CAR design (such as CD40L positive tumor cells). These tumor cells can be primary tumor cells derived from patients, or common commercial tumor cell lines.

[0177] Objective: To mimic the tumor cell environment in vivo as a target for CAR-T cells.

[0178] 7.2 Cell co-culture

[0179] Procedure: The constructed CAR-T cells and tumor cells are co-cultured at different effector to target ratios (E ratio). Multiple E ratios are usually set, such as 1:1, 5:1, 10:1, etc., to observe the killing effect of CAR-T cells under different conditions.

[0180] Objective: To mimic the interaction between CAR-T cells and tumor cells in vivo and observe their killing efficiency.

[0181] 7.3 Tumor cell survival rate detection

[0182] Method: Various methods can be used to evaluate tumor cell survival rate and CAR-T cell killing efficiency. Common methods include:

[0183] 7.3.1 Flow Cytometry: Use dyes such as 7-AAD or Annexin V / PI staining to label cells and detect the total amount of viable cells by flow cytometry.

[0184] Objective: Through the above methods, the tumor killing efficiency of CAR-T cells in vitro can be quantitatively evaluated. As shown in Figure 6 , compared with CD3+ T cells and CAR-CD19, the CAR-CD40L prepared as before has better killing effect on T cell tumors, as shown in Figures 7-8 , the expression of CD40L in CD4 is higher than that in CD8+ T cells, but the killing effect of CD3+ CAR-CD40L on T cell tumors does not weaken.

[0185] 7.4 Cytokine analysis

[0186] Procedure: Detect the cytokines secreted by CAR-T cells during the process of killing tumor cells (such as CD4+ T, CD8+ T). Common methods are enzyme-linked immunosorbent assay (ELISA) or flow cytometry combined with cytokine capture reagents.

[0187] Objective: Through the level of cytokine release, evaluate the activation degree and functional effect of CAR-T cells. CAR-T cells usually secrete a large amount of cytokines when attacking tumor cells, which is also an indicator of their activity.

[0188] The above merely is the preferred embodiment of the present application, it should be pointed out that, for ordinary skilled in the art, without departing from the principles of the present application, can also make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. An antibody of CD40 ligand, characterized in that, the amino acid sequences of CDR1-3 of the heavy chain are GIDLSQYG, VTTGGIT, ARGNIDYLKL in turn, and the amino acid sequences of CDR1-3 of the light chain are KSVYKNNW, EAS, AGGYSSDSDDG in turn; or the amino acid sequences of CDR1-3 of the heavy chain are GIDLSSYG, ISTGGRV, ARGNIDYLNL in turn, and the amino acid sequences of CDR1-3 of the light chain are KSIYKNNW, EAS, AGGYNSDSDDS in turn; or the amino acid sequences of CDR1-3 of the heavy chain are GIDLSSYG, ISTGGYT, ARGNIDYLNL in turn, and the amino acid sequences of CDR1-3 of the light chain are KTVYKNNW, ETS, AGGYSGDSDDS in turn. 2.The antibody of claim 1, characterized in that, the variable region of the heavy chain has an amino acid sequence as shown in any one of SEQ ID NO: 7-9; the variable region of the light chain has an amino acid sequence as shown in any one of SEQ ID NO: 10-12.

3. The antibody according to claim 1 or 2, characterized in that, it is a single-chain antibody, and the linker connecting the variable region of the heavy chain and the variable region of the light chain is (G4S) 3. 4.An epitope peptide of CD40 ligand, with an amino acid sequence of KDIMLNKEETKKENSFE. 5.An immunogen for preparing the antibody of any one of claims 1-3, consisting of the epitope peptide of claim 4 and KLH protein. 6.A chimeric antigen receptor, comprising an extracellular domain, a transmembrane domain and an intracellular domain, wherein the antigen binding domain of the extracellular domain is an antibody of CD40 ligand, with the amino acid sequences of CDR1-3 of the heavy chain being GIDLSSYG, ISTGGYT, ARGNIDYLNL in turn, and the amino acid sequences of CDR1-3 of the light chain being KTVYKNNW, ETS, AGGYSGDSDDS in turn. 7.A biological material, comprising at least one of: A) a nucleic acid, which is a nucleic acid encoding the antibody of any one of claims 1-3, or a nucleic acid encoding the epitope peptide of claim 4, or a nucleic acid encoding the immunogen of claim 5, or a nucleic acid encoding the chimeric antigen receptor of claim 6; B) an expression unit, comprising a promoter and the nucleic acid of A) ; C) a plasmid vector, comprising the nucleic acid of A) and / or the expression unit of B) ; D) a cell, expressing the nucleic acid of A) and / or the expression unit of B) ; E) a labeled antibody, which is the antibody of any one of claims 1-3 connected with a label; the label is a chemical label or a biological label.

8. The biomaterial of claim 7, wherein, The cell is a T cell or an NK cell. 9.A medicament, which is a cell expressing the chimeric antigen receptor of claim 6, and the cell is a T cell or an NK cell. 10.Use of the antibody of any one of claims 1-3 or the labeled antibody of claim 7 in the preparation of a reagent for detecting CD40 ligand.

11. A test reagent for CD40 ligand, characterized by The raw material thereof includes: the antibody according to any one of claims 1 to 3 or the labeled antibody according to claim 7.

12. A method for detecting CD40 ligand for non-therapeutic and / or diagnostic purposes, comprising detecting a sample with the detection reagent according to claim 11.

Images