Ester-producing pichia kudriavzevii and application of ester-producing pichia kudriavzevii in rice wine koji

Abstract

The invention discloses ester-producing saccharomycetes, which is classified and named as Pichia kudriavzevii SAU-NN5, and is preserved in the China General Microbiological Culture Collection Center, the address is No.3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC No.32820, and the preservation time is November 27, 2024. The invention also discloses a screening method of the saccharomycetes, a strain fermentation characteristic and an aroma-producing characteristic in rice wine fermentation application. The pichia kudriavzevii SAU-NN5 obtained by the method disclosed by the invention has a huge application potential in the fermentation of the rice wine. The pichia kudriavzevii SAU-NN5 can be used for fermenting the rice wine.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology. The present invention specifically relates to the screening of a strain of Pichia kudriavzevii ( Pichia kudriavzevii ) and the fermentation characteristics of the strain, as well as its aroma production characteristics in bean sprout juice culture medium and its characteristics in the application of rice wine koji. Background Art

[0002] Yeast is one of the key points that affect the flavor of rice wine. In the process of brewing wine, yeast is a very important conversion medium, and the microbial flora in it is relatively rich. Rice wine koji plays a role in fermentation and saccharification and aroma production during the fermentation of rice wine, and ultimately determines the yield and quality flavor of the finished wine. The selection of excellent brewing microorganisms in rice wine koji has an important influence on the quality characteristics of rice wine, such as aroma, sensory taste, and antioxidant properties, and is also one of the hot topics in the field of rice wine research. Yeast is one of the key microorganisms in rice wine koji, and plays a key role mainly in the wine-making stage. Yeast is mainly divided into brewing yeast and non-brewing yeast. Brewing yeast is mainly responsible for the production of ethanol, while the ethanol production capacity of non-brewing yeast is relatively weak, such as Saccharomyces cerevisiae, Candida and Pichia pastoris, but these yeasts have multiple enzyme activities, which are not only conducive to the saccharification and fermentation of rice wine, but also the main microorganisms for metabolic ester production during the fermentation process of rice wine, which can give rice wine a unique aroma. Pichia kudriavzevii ( Pichia kudriavzevii ) is one of the most common representatives of Pichia yeast, which is widely found in fermented foods and fruits. It can synthesize a variety of enzymes to convert precursors in raw materials into flavor substances, such as increasing the glycerol content in wine, reducing the acetic acid content, and producing special flavor substances such as esters and volatile phenols, thereby increasing the flavor of food or beverages. Wang Ning et al. found that the use of Pichia kudriavzevii and Saccharomyces cerevisiae mixed bacteria to ferment whiskey can increase the content and types of ester compounds in the wine sample.

[0003] The present invention provides the Pichia kudriavzevii ( Pichia kudriavzevii )SAU-NN5, has good ester production ability, the yeast can produce more ester aroma substances during growth, can make the aroma complex during fermentation, and has the ability to improve product quality. Pichia kudriavzevii ) SAU-NN5 was used to make rice wine koji. After testing the volatile substances, a total of 43 compounds were found in the rice wine koji, and the types and contents of aroma substances were relatively high. Summary of the invention

[0004] The present invention aims to screen and provide a kind of Pichia kudriavzevii with ester production ability Pichia kudriavzevii )SAU-NN5, and used the yeast to make rice wine koji, providing microbial resources for koji strengthening.

[0005] The strain provided by the present invention is Pichia kudriavzevii ( Pichia kudriavzevii ) SAU-NN5, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (CGMCC), address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.32820 and the deposit date November 27, 2024.

[0006] The Pichia kudriavzevii SAU-NN5 was separated from the koji, and was screened, screened, purified, and identified to have good ester production ability. The storage conditions are as follows: a single colony was picked from a well-growing plate and transferred to a YPD medium, cultured at 28°C for 48 hours, 600 μL of the culture solution was transferred to a storage tube containing 600 μL of 60% glycerol, and stored in a -20°C refrigerator.

[0007] The YPD medium formula is 10g yeast extract, 20g peptone, 20g glucose, 1000mL distilled water, natural pH, and if a solid medium is required, 2% agar is added.

[0008] The bean sprout juice culture medium formula is 10g soybean sprouts, 5g glucose, 100mL distilled water, natural pH, and if a solid culture medium is required, 2% agar is added.

[0009] The culture characteristics of the Pichia kudriavzevii SAU-NN5 are as follows: the colony of the bacteria is cheese-like after being cultured in a YPD solid medium at 28°C for 48 hours, and the colony is round, has regular edges, is soft in texture, has a smooth and moist surface, is opaque, and is milky white in color. The Pichia kudriavzevii SAU-NN5 requires facultative anaerobiosis, and the bacteria are oval in shape and bud on one side under an oil immersion lens (100×10). BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 (a) is the cell morphology of SAU-NN5 under a 100×10 microscope, and (b) is the single colony morphology of SAU-NN5.

[0011] Figure 2 This is a graph showing the growth of SAU-NN5 strain at different temperatures.

[0012] Figure 3 This is a graph showing the growth of SAU-NN5 strain at different pH levels.

[0013] Figure 4 This is a graph showing the growth of SAU-NN5 strain under different alcohol concentrations.

[0014] Figure 5This is a graph showing the growth of SAU-NN5 strain under different sugar contents. DETAILED DESCRIPTION

[0015] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are commercially available unless otherwise specified.

[0016] In the following examples, the percentages are by mass unless otherwise specified.

[0017] The following examples further illustrate the specific implementation of the present invention, but are not limited to these examples.

[0018] Case study 1: Screening and identification of ester-producing yeast

[0019] (1) Isolation and purification of yeast from koji: Powder the koji sample, weigh 5.0 g of koji powder and add it to 45 ml of physiological saline, add a small amount of sterile glass beads, shake and incubate at 200 r / min for 30 min to break up the bacteria. Take the supernatant and dilute it in a gradient manner and apply it to the yeast isolation medium (10 -2 ~10 -6 ), cultured in a constant temperature incubator at 28±1℃ for 48 h, picked single colonies according to the morphological characteristics of the colonies and repeatedly streaked them on YPD plates until a pure strain without contamination by foreign bacteria was obtained, and the purified yeast was transferred to YPD slant culture medium and stored at 4℃ for later use.

[0020] (2) Initial screening of ester-producing yeast: The isolated yeast was inoculated into YPD liquid culture medium and cultured in a constant temperature incubator at 28±1℃ for 48 h. The yeast was screened by olfactory smell. The result of the initial olfactory screening was +++, which was described as a strong aroma.

[0021] (3) Determination of total esters of ester-producing yeast: The yeast obtained in the initial screening was used to ferment bean sprout juice culture medium. After 3 days of cultivation, the total ester content of the fermentation liquid was determined by the saponification reflux method. Among them, SAU-NN5 had a more outstanding ester production effect, and its total ester content was 3.93 g / L.

[0022] (4) Identification of strain SAU-NN5

[0023] Morphological identification: After activating with YPD liquid medium for 24 hours, use a sterile inoculation loop to pick a loop of bacterial liquid and streak it on the YPD plate. After culturing at 28±1℃ for 48 hours, record the characteristics of the colony according to size, color, texture, edge shape, etc.; wash the colony with sterile saline and observe the single cell morphology under a 100x microscope. The colony and cell morphology of strain SAU-NN5 are as follows: Figure 1 shown.

[0024] Molecular identification: Extraction of SAU-NN5 genome: strain SAU-NN5 was inoculated into YPD liquid medium and cultured on a shaker at 28°C and 200 r / min for 48 h. The total genome of SAU-NN5 was extracted according to the instructions of the genome kit. 5 μl of PCR product was separated by 1.2% (1×TAE) agarose gel electrophoresis, detected and imaged by UV gel imaging system, and PCR amplification products were sent to Sangon Biotech Co., Ltd. for sequencing.

[0025] The strain SAU-NN5 was sequenced and the following ITS sequence was obtained: TGCGGAAGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCG GCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATAT

[0026] The sequence was imported into NCBI for BLAST homology comparison, and combined with morphological characteristics, the strain SAU-NN5 was identified as Pichia kudriavzevii ( Pichia kudriavzevii ). It was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No. 32820 and the deposit date is November 27, 2024.

[0027] Implementation case 2: Fermentation and growth characteristics of strain SAU-NN5

[0028] (1) Temperature tolerance test: The purified Pichia kudriavzevii SAU-NN5 strain was activated and inoculated into YPD liquid medium at a 2% inoculation rate (v / v). After culturing at 24°C, 28°C, 32°C, 36°C, and 40°C for 24 h, the uninoculated YPD liquid medium was used as the blank zero parameter to measure the OD 600nm , draw the yeast growth tolerance curve. Figure 2 As shown, the OD value of Pichia kudriavzevii SAU-NN5 strain was the largest at 28°C, indicating that the strain grew best at 28°C.

[0029] (2) pH tolerance test: The activated SAU-NN5 strain seed solution was inoculated at a 2% inoculum (v / v) into YPD liquid medium with pH values ​​of 3.0, 3.5, 4.0, 4.5, and 5.0, respectively. The OD values ​​were measured after culturing at 28±1℃ for 24 h. 600nm , draw the pH growth tolerance curve of yeast. Figure 3 As shown, when the pH was 4.0, the OD value was the largest and the growth amount was the highest.

[0030] (3) Alcohol tolerance test: The activated SAU-NN5 strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with alcohol content (volume concentration) of 3%, 6%, 9%, 12%, and 15%, respectively. The OD was measured after culturing at 28±1℃ for 24h. 600nm , draw the alcohol tolerance curve of yeast. Figure 4 As shown, as the alcohol concentration increases, the OD value decreases and the growth rate decreases. When the alcohol content is 15%, the OD value is lower than 1 and the growth is greatly inhibited, indicating that the yeast has poor alcohol tolerance.

[0031] (4) Sugar tolerance test: The activated SAU-NN5 strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with glucose content of 16%, 20%, 24%, 28%, and 32%, respectively. The OD was measured after culturing at 28±1℃ for 24h. 600nm , draw the sugar tolerance curve of yeast. Figure 5 As shown, when the sugar content is less than 20%, the cell growth increases with the increase of sugar content, but when it is greater than 20%, the cell growth decreases with the increase of sugar content, indicating that high sugar content will inhibit the growth of the strain.

[0032] Case study 3: Determination of volatile substances in fermented bean sprout juice medium inoculated with strain SAU-NN5

[0033] The activated SAU-NN5 seed solution was inoculated into bean sprout juice medium at 2% (v / v), and the volatile substances were determined after culturing at 30±1℃ for 3 days.

[0034] Headspace solid phase micro extraction (SPME) conditions: 4 mL of sample, 1.0 g of sodium chloride, 10 μL of 2-octanol (0.1 mg / mL) were added to the headspace bottle, equilibrated for 30 min, and headspace adsorption at 45 °C for 30 min.

[0035] Gas chromatography conditions: Agilent VF-Waxms column (60m×0.25mm, 0.5μm), helium (He) flow rate 1 m L / min; heating program: splitless injection; initial temperature 40℃, hold for 3 min, increase to 60℃ at 2℃ / min, hold for 1 min, then increase to 120℃ at 4℃ / min, hold for 1 min, then increase to 240℃ at 6℃ / min, hold for 3 min; injection port temperature 260℃, detector temperature 260℃.

[0036] Mass spectrometry conditions: electron ionization (EI) source, interface temperature 250°C, ion source temperature 200°C, electron energy 70 eV, mass spectrometry scanning range 40.00~800.00 m / z.

[0037] The results of volatile substance determination are as follows: among the volatile substances in the fermentation broth of bean sprout juice culture medium of SAU-NN5 strain, there are 8 ester substances, among which ethyl acetate has the highest content; there are also a small amount of esters such as methyl acetate, phenylethyl acetate, and isoamyl acetate. There are 3 alcohol substances, including isoamyl alcohol, 2-ethylhexanol, and 2-amino-1,3-propanediol, among which isoamyl alcohol has the highest content. A small amount of aldehyde and ketone substances such as damascenone, methyl heptenone, phenylacetaldehyde, nonanal, and n-decanal were also detected.

[0038] Case study 4: Determination of volatile substances in rice wine koji made by inoculation of strain SAU-NN5

[0039] Preparation of rice wine koji: Take 500 g glutinous rice flour, 60 g Polygonum hydropiper, 20 g Poria cocos, and 20 g Licorice. Put Polygonum hydropiper, Poria cocos, and Licorice into a wall-breaking machine and grind into powder. After passing through an 80-mesh sieve, mix evenly with the glutinous rice flour. Add 500 g of clean water in small batches, take an appropriate amount of SAU-NN5 bacterial suspension, knead it into a koji ball with a diameter of about 2 cm, cover it with plastic wrap, ferment it in an incubator at 30±1℃ for three days, and finally dry the koji at 45℃ and store it in a vacuum bag at 4℃.

[0040] Determination of volatile substances: Take samples after fermentation and determine the volatile substances in the rice wine koji according to the method in Implementation Case 3.

[0041] The results of volatile substance determination are as follows: 43 chemical substances were detected in the rice wine koji made with the SAU-NN5 strain. Among the many identified compounds, 7 categories were mainly involved, namely esters, alcohols, aldehydes and ketones, acids, alkanes, alkenes and other substances. As shown in Table 1, 9 ester substances were detected in the experiment, among which methyl myristate, methyl laurate, methyl caprate and phenylethyl acetate had relatively high contents. There was 1 alcohol substance with the highest relative content, accounting for 54.65% of the total. There were 6 aldehydes and ketones, among which 3-hydroxy-2-butanone had the highest content, which could contribute to the aroma of cream and cheese; there were also a small amount of aroma substances such as 5-nonanol, sec-octanone and phenylacetaldehyde, which could increase the fullness of the overall aroma. There were also 2 acids, 9 alkanes, 2 alkenes, and 12 other substances, accounting for a small total proportion. Studies have shown that there are many types of volatile substances in the rice wine koji, and the types and contents of aroma substances are high.

[0042] Table 1 Relative content of volatile substances in SAU-NN5 rice wine yeast

Claims

1. A strain of Pichia kudriavzevii ( Pichia Kudryavzevii )SAU-NN5, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.32820 and the deposit date November 27, 2024. Pichia kudriavzevii id='action_msg_1373'> Kudryavzevi )SAU-NN5 is characterized by: The bacterial colony is cheese-like in shape, round, with regular edges, soft texture, smooth and moist surface, opaque, and milky white in color. Pichia Kudryavzevii ) SAU-NN5 or by Pichia kudriavzevii ( Pichia Kudryavzevii )SAU-NN5 was prepared.

2. The bacterial agent is a freeze-dried bacterial agent; the preparation method of the freeze-dried bacterial agent includes: The Pichia kudriavzevii according to claim 1 ( Pichia Kudryavzevii ) SAU-NN5 was cultured to obtain bacterial cells, which were freeze-dried.

3. A method for preparing distiller's yeast, comprising adding the Pichia kudriavzevii according to claim 1 ( Picea Kudryavzevi ) The rice wine koji made by SAU-NN5.

Images