Promoter for controlling high expression of insecticidal pathogenic fungi in insect blood cavity and application thereof

Abstract

The invention provides a promoter for controlling high expression of insecticidal pathogenic fungi in an insect blood cavity and application of the promoter. The promoter is specifically expressed in an insect thallus stage, and can also drive a target gene to be efficiently expressed only after entering an insect body. The invention not only provides a new choice for functional gene research and genetic engineering breeding of pathogenic fungi, but also can effectively ensure the environmental safety of the genetic engineering strain and eliminate possible factors of the genetic engineering strain influencing the environment.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural science, and more specifically, relates to a promoter for controlling the high expression of insecticidal pathogenic fungi in insect hemocoel and an application thereof. Background Art

[0002] According to the analysis of the Food and Agriculture Organization of the United Nations (FAO), global crop pests cause a high global food loss every year. Chemical control is an important measure in pest control and plays a positive role in ensuring agricultural production. However, the problems caused by the large-scale use of chemical pesticides have gradually become prominent, including drug residues, non-target organisms, pest resistance and re-outbreak, ecological damage and threats to human health. As humans pay more and more attention to the living environment, the call for reducing the use of chemical pesticides is getting louder and louder, and the research, development and use of safe and environmentally friendly biological pesticides have attracted much attention. Insect pathogenic fungi have the advantages of no residue, easy mass production, safety to non-target organisms, and low resistance to hosts. They have been developed into biological pesticides and are widely used in the prevention and control of agricultural and forestry pests and urban health insects.

[0003] Unlike insect pathogenic bacteria, insect pathogenic fungi are not ingested by the host but directly invade the host through the exoskeleton or epidermis. The infection process is divided into the following steps: conidia attach to the insect body wall and germinate to form infection structures (such as appressorium); hyphae penetrate the insect body wall, and multiply in large quantities in the insect body in the form of insect fungi by budding in the insect body and causing disease to insects. Since insects have evolved an efficient immune defense system to fight fungal infection in the long-term attack and defense and game with pathogens, pathogenic fungi are slow to cause disease, which restricts the widespread application of fungal insecticides. To this end, many studies have genetically improved strains by highly expressing exogenous toxins or virulence proteins to enhance the insecticidal efficacy of biocontrol fungi. The strains improved by genetic engineering have shown great potential in the prevention and control of agricultural pests and urban health pests, showing that insect pathogenic fungi have broad application prospects in the field of biocontrol. Therefore, the use of genetic engineering to regulate the expression of target genes in entomogenous fungi is of great significance for the promotion and application of entomogenous fungi. However, in the research on genetically improved strains of insect pathogenic fungi, most of them are mainly driven by constitutive promoters. Since constitutive expression promoters cannot effectively control the spatiotemporal expression of target genes, they can easily cause excessive consumption of intracellular substances and energy, which can adversely affect the growth of organisms and even the environment. Therefore, there are certain defects in practical operations.

[0004] Therefore, it is urgent to develop regulatory molecules (such as promoters) with tissue-specific expression and high expression levels to genetically improve insecticidal fungi. Summary of the invention

[0005] The purpose of the present invention is to provide a promoter for controlling the high expression of insecticidal pathogenic fungi in the insect hemocoel and its application.

[0006] In a first aspect of the present invention, the use of the promoter of the MAA_06769 gene is provided, which is used as a specific expression promoter to guide the expression of a target gene after the insect pathogenic fungus enters the insect hemocoel.

[0007] In another aspect of the present invention, a method is provided for expressing a target gene after an insect pathogenic fungus enters the insect blood cavity, comprising: (a) operably linking the promoter of the MAA_06769 gene to the target gene to form an expression cassette; introducing the expression cassette into the insect pathogenic fungus; and (b) infecting an insect with the insect pathogenic fungus described in (a), and after the insect pathogenic fungus enters the insect blood cavity, the target gene is expressed.

[0008] In one or more embodiments, the insect is an insect susceptible to the insect pathogenic fungus; preferably, the insect includes (but is not limited to): Lepidoptera, Diptera, Homoptera, Orthoptera, Coleoptera, Hemiptera, and Hymenoptera.

[0009] In one or more embodiments, the insect pathogenic fungi are fungi that infect insects; preferably, they include Metarhizium and Beauveria.

[0010] In one or more embodiments, the pathogenic fungus includes spores thereof.

[0011] In one or more embodiments, the pathogenic fungus includes entomogens formed thereby.

[0012] In another aspect of the present invention, an isolated nucleic acid (promoter of MAA_06769 gene) is provided, comprising a nucleic acid selected from the following groups: (1) a nucleic acid having a nucleotide sequence shown in SEQ ID NO:1 or comprising the nucleotide sequence shown in positions 593 to 911 (-1 bp to -319 bp of MAA_06769 gene); (2) a nucleic acid having more than 80% (preferably more than 85% or 90%, more preferably more than 95%) identity with the nucleotide sequence of (1), having a conserved TATA box (TATAAAA) and a CAAT box (CAAT), and having the function of directing the expression of a target gene after an insect pathogenic fungus enters the insect blood cavity; (3) a nucleic acid that can hybridize with the nucleotide sequence of (1) under stringent conditions, having a conserved TATA box and a CAAT box, and having the function of directing the expression of a target gene after an insect pathogenic fungus enters the insect blood cavity; preferably, the nucleic acid also has a conserved GC box (GGGCGG).

[0013] In one or more embodiments, the nucleic acid includes a nucleic acid selected from: a nucleic acid having a nucleotide sequence shown at positions 593 to 911 (-1bp to -319bp of MAA_06769 gene; P319) in SEQ ID NO:1; a nucleic acid having a nucleotide sequence shown at positions 295 to 911 (-1bp to -617bp of MAA_06769 gene; P617) in SEQ ID NO:1; a nucleic acid having a nucleotide sequence shown at positions 1 to 911 (-1bp to -911bp of MAA_06769 gene; P911) in SEQ ID NO:1.

[0014] In another aspect of the present invention, an expression construct (such as an expression cassette or an expression vector) is provided, comprising the nucleic acid as a promoter element.

[0015] In one or more embodiments, the expression construct further comprises a gene of interest operably linked to the promoter element.

[0016] In one or more embodiments, the target gene includes (but is not limited to): functional gene (gene encoding a protein with a specific function) and structural gene.

[0017] In one or more embodiments, the functional genes include (but are not limited to): reporter genes, genes for proteins that reduce the survivability of insects, such as insect inhibitory toxin genes, genes for insect metabolism and immunosuppressive proteins; interfering molecules (such as shRNA, dsRNA, etc.) that target and interfere with essential genes of insects; for example, the functional genes include perforating toxin protein genes, more specifically hemolysin II.

[0018] In one or more embodiments, the reporter gene includes, but is not limited to, a fluorescent protein encoding gene, a luciferase gene, or a β-galactosidase gene.

[0019] In one or more embodiments, the fluorescent protein includes but is not limited to: green fluorescent protein, yellow fluorescent protein, red fluorescent protein, cyan fluorescent protein, blue fluorescent protein, etc., or enhanced proteins thereof (such as enhanced green fluorescent protein).

[0020] In one or more embodiments, the target gene is located downstream of the promoter element, and the interval between the target gene and the promoter is less than 2000 bp.

[0021] In one or more embodiments, the target gene is located downstream of the promoter element, and the interval with the promoter is less than 1000bp; more preferably less than 500bp, such as less than 200bp, less than 100bp, less than 50bp, less than 30bp, less than 20bp, less than 10bp or no interval.

[0022] In one or more embodiments, the expression construct comprises an expression vector.

[0023] In one or more embodiments, the target gene is an exogenous gene.

[0024] In another aspect of the present invention, a genetically engineered cell (strain cell) is provided, which contains any of the expression constructs described above; or the nucleic acid described above is integrated into its genome as a promoter element; preferably, a target gene is also integrated into its genome, and the target gene is operably linked to the promoter element.

[0025] In one or more embodiments, the cell is an insect pathogenic fungus;

[0026] In another aspect of the present invention, a method for controlling insects (harmful insects) is provided, comprising: (1) providing an insect pathogenic fungus, which can use the insect as a host, infect the insect and enter its blood cavity; (2) introducing the expression construct of claim 7 into the insect pathogenic fungus; (3) applying the insect pathogenic fungus to the insect, which infects the insect and enters its blood cavity, thereby inhibiting the insect.

[0027] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 , Construction of the pMAA_06769::EGFP eukaryotic expression vector of the present invention. ptrpc is the promoter of the tryptophan synthesis gene c of Aspergillus nidulans; Bar is the resistance gene for screening the drug glyphosate; EGFP is the enhanced green fluorescent protein gene, and P319 / P617 / P911 are MAA_06769 promoters of different lengths.

[0029] Figure 2 、The expression pattern of MAA_06769 gene. Spores: conidia grown on PDA plate for 14 days; hyphae: hyphae cultured on SDB for 3 days; appressorium: appressorium formed by induction of black soldier fly wings for 30 hours. Entomophthora: purified entomophthora from greater wax moth; Infected fruit flies: Metarhizium anisopliae M23 (1x10 6 / mL) Drosophila samples infected for 72h.

[0030] Figure 3 , Expression analysis diagram of MAA_06769 during Metarhizium infection of Drosophila melanogaster.

[0031] Figure 4 , Representative images of EGFP fluorescence detection at different developmental stages of Metarhizium anisopliae pMAA_06769::EGFP strain.

[0032] Figure 5 , qPCR quantitative analysis of EGFP expression in Drosophila infected with Metarhizium pMAA_06769::EGFP strain for 72 hours. M23 wild-type strain was used as negative control, and ptef::EGFP constitutively expressed EGFP strain was used as positive control. p319::EGFP, p617::EGFP and p911::EGFP represent strains with different MAA_06769 promoter lengths fused to EGFP.

[0033] Figure 6 , qPCR quantitative analysis of EGFP expression in parasites induced by infection of the greater wax moth with the pMAA_06769::EGFP strain of Metarhizium anisopliae. The wild-type M23 strain was used as a negative control, and the ptef::EGFP constitutively expressing EGFP strain was used as a positive control.

[0034] Figure 7 、Construction of pMAA_06769::HlyII eukaryotic expression vector. ptrpc is the promoter of the tryptophan biosynthesis gene c of Aspergillus nidulans; Bar is the resistance gene for screening drug glyphosate; HlyII is the hemolysin II protein gene; Mcl1(sp): the signal peptide sequence of Mcl1, which guides HlyII to be secreted outside the cell. P319 / P617 / are MAA_06769 promoters of different lengths.

[0035] Figure 8 , quantitative PCR verification of HlyII overexpression strains. A. Expression analysis of HlyII gene in P319::HlyII overexpression strains; B. Expression analysis of HlyII gene in P617::HlyII overexpression strains.

[0036] Fig. 9 , Analysis of the survival rate of Drosophila infected with the HlyII overexpression strain. A. Survival curve of Drosophila infected with the P319::HlyII overexpression strain; B. Half lethal time (LT) of Drosophila infected with the P319::HlyII overexpression strain 50 Statistical analysis; C. Survival curve of fruit flies infected with P617::HlyII overexpression strain; D. Half lethal time (LT) of fruit flies infected with P617::HlyII overexpression strain 50 Statistical analysis. DETAILED DESCRIPTION

[0037] The time it takes for insect pathogenic fungi to knock down insects is mainly determined by the immune fighting time between the insect body and the insect immune system after the fungi enter the insect blood cavity. Insect pathogenic fungi are improved by genetic engineering to enhance the strain's adaptation to the host environment, promote its proliferation in the insect blood cavity, and then enhance the strain's virulence. After in-depth research, the inventors have revealed for the first time a promoter that controls the high expression (specific expression) of insecticidal pathogenic fungi in the insect blood cavity. The promoter is specifically expressed in the insect body stage, which can drive the target gene to be efficiently expressed only after entering the insect body (in the host infection stage). The present invention not only provides new options for functional gene research and genetic engineering breeding of pathogenic fungi, but also effectively ensures the environmental safety of genetically engineered strains, eliminates people's concerns about the possible impact of genetically engineered strains on the environment, and has important value for the application of insect pathogenic fungi.

[0038] the term

[0039] In the present invention, "insecticide pathogenic fungi" and "insect pathogenic fungi" are used interchangeably.

[0040] As used in the present invention, the "insect pathogenic fungi" refers to a type of fungi, whose bodies, genes or gene products or their progeny (such as spores) can be used to reduce harmful organisms. Generally, the "insect pathogenic fungi" have fungi selected from the following characteristics: (a) can parasitize on the surface or body of insects, (b) can infect and kill insects; preferably, it is a type of insect pathogenic fungi that has the ability to infect insects and can parasitize insects. For example, Metarhizium and Beauveria bassiana, as insect pathogenic fungi, can penetrate the insect body surface, enter the blood cavity, inhibit host immunity and proliferation, kill the insect, and then produce spores on the insect body surface and carry out the next round of infection.

[0041] As used in the present invention, the "insect pathogenic fungi" are also called "entomopathogenic fungi", which refer to fungi that can invade insects, parasitize them, and cause them to become sick.

[0042] As used in the present invention, the "host" and "host" are used interchangeably and refer to insects that can be infected by the insect pathogenic fungus.

[0043] As used herein, the "promoter" or "promoter region (domain)" refers to a nucleic acid sequence that is usually present upstream (5' end) of the target gene coding sequence and can guide the transcription of the nucleic acid sequence into mRNA. Generally, the promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for the correct initiation of transcription. In this article, the promoter or promoter region includes variants of the promoter, which are obtained by inserting or deleting regulatory regions, performing random or site-directed mutagenesis, etc.

[0044] As used herein, the term "specific expression" refers to the expression of a target gene at a specific time and / or in a specific tissue. The promoter of the "specific expression" may include "spatiotemporal specific expression", "organ specific expression" or "tissue specific expression" promoters. Under the regulation of such promoters, genes are often only expressed at certain specific stages, or in specific organs or tissues. In the present invention, the promoter is an insect hemocoel-specific expression promoter.

[0045] Generally, a promoter is considered to be organ- or tissue-specific if mRNA is expressed at a level at least 5-fold higher, preferably at least 10-fold higher, more preferably at least 100-fold higher, and more preferably at least 1000-fold higher in a certain tissue or organ than in other tissues or organs.

[0046] As used herein, "target gene" and "target gene" are used interchangeably and refer to genes that can be expressed under the guidance of the promoter of the present invention. Suitable target genes include, but are not limited to, genes related to improving plant quality, traits or metabolism.

[0047] As used herein, "isolated" means that a substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state in living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances that exist with them in their natural state.

[0048] As used herein, the term "operably linked" or "operably connected" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene nucleic acid sequence, so that the transcription of the nucleic acid sequence is guided by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0049] As used herein, "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences that are derived from different sources. For example, a promoter is exogenous to a gene of interest if the combination of the promoter and the gene of interest sequence does not normally occur in nature. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0050] Specific promoters and gene expression directed by them

[0051] The present invention provides a nucleic acid (pMAA_06769 gene promoter) that enables a target gene to be expressed after an insect pathogenic fungus enters the insect blood cavity. The wild type of the promoter is derived from the insect pathogenic fungus Metarhizium anisopliae, and a promoter with insect fungus specific and efficient expression is developed.

[0052] The nucleic acid has a sequence selected from the following groups: (1) a nucleic acid having a nucleotide sequence shown in SEQ ID NO: 1 or containing the nucleotide sequence shown in positions 593 to 911 (-1 bp to -319 bp of the MAA_06769 gene); (2) a nucleic acid having more than 80% (preferably more than 85% or 90%, more preferably more than 95%) identity with the nucleotide sequence of (1) and having the function of directing the expression of a target gene after the insect pathogenic fungus enters the insect blood cavity; (3) a nucleic acid that can hybridize with the nucleotide sequence of (1) under stringent conditions and has the function of directing the expression of a target gene after the insect pathogenic fungus enters the insect blood cavity.

[0053] The promoter sequence of the present invention contains conservative TATA box and CAAT box sequences; preferably, the nucleic acid also has a conservative GC box.

[0054] In the present invention, the promoter is an insect hemocoel-specific expression promoter. It can be called a spatiotemporal specific expression promoter, which has spatiotemporal properties and is specifically expressed after the pathogenic fungus infects the insect (enters the insect hemocoel); it can be called an organ or tissue specific expression promoter, and the organ or tissue is the insect hemocoel.

[0055] The MAA_06769 gene promoter of the present invention is active at -1bp to -319bp, -1bp to -617bp, and -1bp to -911bp before the translation start site, and has the effect of specific and efficient expression in insect bacteria.

[0056] According to the exemplary results in the embodiments of the present invention, MAA_06769 promoter P319, P617 and P911 can all be used. It can be appropriately selected according to the situation of the target gene. For example, if the target gene is large, P617 or P911 can be used.

[0057] Hybridization of polynucleotides is a technique well known to those skilled in the art, and the hybridization characteristics of a particular pair of nucleic acids indicate their similarity or identity. Therefore, the present invention also relates to polynucleotides that hybridize to the aforementioned specified nucleotide sequence and have at least 80%, preferably at least 85%, and more preferably at least 90% (e.g., 92%, 95%, 96%, 97%, 98%, or 99%) identity between the two sequences. The present invention particularly relates to polynucleotides that are hybridizable to the polynucleotides of the present invention under stringent conditions. "Identity" refers to the level of similarity (i.e., sequence homology, similarity, or identity) between two or more nucleic acids in terms of the percentage of identical positions.

[0058] "Stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 80%, preferably 85% or more, 90% or more, 92% or more, 95% or more, 92% or more, or 99% or more. In addition, the hybridizable polynucleotide also has the function of directing the specific expression of the target gene in the insect hemocoel.

[0059] The promoter of the present invention can be operably linked to a target gene, which can be exogenous (heterologous) relative to the promoter. There is no particular limitation on the nucleic acid sequence of the target gene, and preferably some genes that need to be strongly and specifically expressed in entomology, such as functional genes (genes encoding proteins with specific functions) and structural genes.

[0060] Suitable target genes include, but are not limited to: reporter genes, genes of proteins that reduce insect viability, such as insect inhibitory toxin genes, genes of insect metabolism and immunosuppressive proteins, etc.; interfering molecules (such as shRNA, dsRNA, etc.) that target and interfere with essential genes of insects; for example, the functional genes include perforating toxin protein genes, more specifically, hemolysin II. The target genes can be modified to produce various desired characteristics or improved characteristics.

[0061] Any of the aforementioned promoters and / or target gene sequences may be included in an expression construct (recombinant vector).

[0062] As a method, the recombinant vector includes the promoter of the present invention, and contains a multiple cloning site or at least one restriction site downstream of the promoter. When the target gene needs to be expressed, the target gene is connected to a suitable multiple cloning site or restriction site, thereby operably connecting the target gene to the promoter.

[0063] As another way, the recombinant vector includes (from 5' to 3' direction): a promoter for directing transcription of the target gene, and the target gene. If necessary, the recombinant vector may also include a 3' transcription terminator, a 3' polynucleotide signal, other non-translated nucleic acid sequences, transport and targeting nucleic acid sequences, resistance selection markers, enhancers or operators.

[0064] Methods for preparing recombinant vectors are well known in the art. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In short, any plasmid or vector can be used as long as it can replicate and be stable in the host.

[0065] Methods well known to those skilled in the art can be used to construct expression vectors containing the promoter and / or target gene sequence of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0066] In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed cells, such as dihydrofolate reductase, neomycin resistance, hygromycin resistance, and green fluorescent protein (GFP).

[0067] In addition to the promoter of the present invention, the recombinant vector may also contain one or more other promoters. The other promoters are, for example, tissue-specific, constitutive or inducible, such as cauliflower mosaic virus 19S and 35S (CaMV19S CaMV35S) of mannopine synthase, enhanced CaMV, tobacco RB7, etc.

[0068] The vector containing the above-mentioned appropriate promoter and target gene can be used to transform appropriate cells to enable them to express proteins. Considering the characteristics of the promoter, the cells are preferably insecticidal pathogenic fungal cells.

[0069] The insect pathogenic fungi described in the present invention are fungi that can parasitize an insect host, thereby inhibiting the insect host, or can produce metabolites, thereby causing disease in the insect host.

[0070] Insect pathogenic fungi and their transformation

[0071] A variety of insect pathogenic fungi can be used in the present invention, provided that they can transform an expression construct (such as an expression vector), the expression construct contains the promoter of the present invention, and a target gene operably linked to the promoter element; and they can parasitize the host or affect the host with their metabolites.

[0072] The insect pathogenic fungus (called modified fungus or recombinant fungus) carrying the expression construct can be applied to the insect, which infects the insect and enters its blood cavity, thereby inhibiting the insect at a specific time. Therefore, the promoter can be used to genetically improve the insect-borne fungi, add a controllable switch to the expression of the target gene, and can be used to regulate the expression of the gene after entering the host, which can effectively ensure the environmental safety of the genetically engineered strain and eliminate people's concerns about the possible impact of genetically engineered strains on the environment.

[0073] The insects involved in the present invention are generally the hosts of the insect pathogenic fungi described in the present invention. The insects include natural insects that can be infected by the insect pathogenic fungi and some insects that develop drug resistance based on natural insects. In a preferred embodiment, the insects include: Homoptera, Orthoptera, Lepidoptera, Diptera, Coleoptera, Hemiptera, Hymenoptera, etc. The insects themselves belong to the insecticidal range of the wild-type green muscardine / beauveria, etc., which are broad-spectrum insecticides. Therefore, it can be understood that the present invention can also be widely applied to these insects.

[0074] In some preferred embodiments, the insect pathogenic fungi are entomogenous fungi. In some relatively specific preferred embodiments, the insect pathogenic fungi include fungi selected from the group consisting of Metarhizium anisopliae, Beauveria bassiana, Thompson's Polychaete, Verticillium lecanii, Paecilomyces farinosa, Paecilomyces carnosus, Paecilomyces lilacinus, Paecilomyces cicadae, Paecilomyces fumosorum, Gemini shell spore, Citrus whitefly shell spore, Cladosporium budding, Entomophthora freundii, Nomura lecanii, Chain chytrid, and Pythium guiyangensis.

[0075] Metarhizium anisopliae belongs to the kingdom Fungi, the phylum Ascomycota, the class Sordariomycetes, the orders Hypocreales, and the family Clavicipitaceae. It is a broad-spectrum insect pathogen that can parasitize insects of various orders and families, a total of about 200 species of insects, and can also parasitize mites. It can induce insects to produce green muscardine disease. The colonies of Metarhizium anisopliae are fluffy or cotton-like, initially white, and green when spores are produced, hence the name Green Mushroom. Metarhizium anisopliae invades the body of insects by germinating spores, and reproduces and forms toxins in the body, causing the death of the insects, but is not toxic to plants. After the pathogenic spores formed on the surface of dead insects are dispersed, they can infect other healthy insects again, forming repeated infections within the insect population, which can cause the death of insects within a certain period of time. The way that Metarhizium infects insects is that conidia first attach to the host surface. After the spores germinate, hyphae are produced, which invade the insect body by mechanical force and enzyme decomposition, secrete toxins to paralyze or kill the insect body, and finally grow a large number of hyphae and form conidia. Its more common hosts include scarab beetles, weevils, wireworms, lepidopteran insect larvae, stink bugs, etc. However, natural Metarhizium has some defects such as slow insecticidal effect or insufficient toxicity, which need to be improved.

[0076] Beauveria bassiana belongs to the kingdom Fungi, phylum Ascomycota, class Sordariomycetes, order Hypocreales, family Cordycipitaceae, genus Beauveria. The hyphae have septa and branches. Beauveria bassiana can infect more than 700 species of insects and mites from 15 orders and 149 families, reproduce in large numbers, consume nutrients, destroy insect tissues, and produce toxins to disrupt metabolism and cause insect death. The infection process of Beauveria bassiana on the host generally includes: conidia attachment; spore germination; germ tube penetration of the epidermis; hyphae growth in the hemocoel; production of toxins; killing / injuring the host; hyphae invasion of all organs of the host; hyphae spread out of the epidermis; conidia production; conidia diffusion process. Beauveria bassiana mainly invades through the body wall, and can also invade or kill insects through the spiracles, wounds or digestive tract. However, it has been found in the art that the insecticidal speed of natural strains of Beauveria bassiana is not fast enough or the toxicity is not enough, which needs to be improved. In addition, after long-term application, engineered strains of Beauveria bassiana may evolve resistance to insecticidal proteins or toxins in target insects.

[0077] Although preferred control targets of Metarhizium anisopliae are listed in the embodiments of the present invention, it should be understood based on the disclosure of the present invention that other insect hosts of Metarhizium anisopliae / Beau bassiana can also be applied in the present invention.

[0078] The present invention also provides a composition for controlling insects (such as a pesticide composition), wherein the composition contains: an effective amount of the recombinant fungus or its conidia. More preferably, the composition further contains a pesticide-acceptable carrier.

[0079] The insect control composition of the present invention can be prepared into any suitable dosage form. For example, the form of the composition includes (but is not limited to): powder, granule, oil, emulsion, wettable powder, microcapsule, non-woven fabric agent.

[0080] In preparing the composition, suitable solid diluents include, but are not limited to, diatomaceous earth, corn husks, tricalcium phosphate, cork powder, clays such as kaolin, bentonite or attapulgite, or water-soluble polymers.

[0081] The present invention also provides a method for controlling insects, the method comprising: administering an effective amount of the modified insect pathogenic fungus or spores produced thereby to an object in need of controlling insects. In a preferred embodiment, the composition is directly administered to the object in need of controlling insects.

[0082] Suitable methods of applying the spore composition to growing plants include solid broadcasting, foliar spraying, liquid irrigation, and the like.

[0083] The beneficial effects of the present invention are:

[0084] The MAA_06769 gene promoter specifically expressed in the thallus stage was developed in entomogenous fungi, which only allows the target gene to be expressed after the pathogenic fungi enter the insect blood cavity, adding a controllable switch for the expression of the target gene, solving the defect that the constitutively expressed promoter cannot effectively control the temporal and spatial expression of the target gene, and providing a new option for the genetic modification of insect pathogenic fungi. A comparative analysis with the gene (MCL1) specifically expressed in the thallus that has been reported in Metarhizium muscardine found that MAA_06769 has a higher expression level than MCL1, and the use of this promoter in genetically improved engineered bacteria in practical applications will have greater application prospects.

[0085] The MAA_06769 gene promoter of the present invention has good specificity and is specifically expressed only in the insect fungus. After the pathogenic fungus enters the insect body, it can regulate the efficient expression of a specific gene in the insect fungus. The promoter provides a new option for improving and utilizing the insect-borne fungus by molecular biological means. The promoter can be used to regulate the expression of genes after entering the host body, effectively controlling the leakage expression of exogenous genes (target genes) before infecting the host, effectively ensuring the environmental safety of genetically engineered strains, and eliminating people's concerns about the possible impact of genetically engineered strains on the environment.

[0086] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0087] Example 1. MAA_06769 gene promoter (pMAA_06769) and its functional analysis

[0088] 1. MAA_06769 gene promoter sequence

[0089] The nucleotide sequence of the promoter of the MAA_06769 gene (SEQ ID NO: 1; 911 bp):

[0090] Attagaatggaaagcaa gggcggtatacgagcttgtcgggaaaggaccggagtattccacagaaatagacaagtatccatcttgggggcgctgcttctgacttttgcgaaaataattgagtggtagaagtgcggctccaaagtaacatggtcctgtctgtgtatctaaacgcgctggaaaccgtgcaagaggatc caat cgactagtagtatttaatccctgttatattaataacgactcataattagcagctaaattacctatacagccaggggaccctgctctattaaccttgtcaggttacgggtagttcattatacaggggttggaatgtaacgctcgagttggtagactccaaggg gggcgg tgtccatgactggggtatagtagtttgccgcgttgccctgtgccgagcaacactccttccagaaattgataggcaccgcggtagggcaagtaagttaatatagtgagatgttcccgtgtaaatagagatttttatccgtataaatactaatactctatagaatataggcagaaaagcctacttcgtga caat acaagctagacaggagcacgttatgctagggcaaaatgaggcgtttatgcgtccttaaaaatacaaacacatgactcatatttttcgtaagttacgactggtaacttgattcctactcatgcccggccccacgttactaggattcgcttcgcctcacctaccttacgcggcgtctctacgcaacttcgtctatagcgtttgagcgctatagtagtaattagtaacaagcttggagggcacg tataaaa tgggcatgcccgaccttggagggtgttcaacgt caat ttcctcagcttactatccgctgcattctcctactatccgctcactttttgctacacgtacatacatg(SEQ ID NO:1)

[0091] 2. Cloning and Vector Construction of the Promoter of MAA_06769 Gene

[0092] Artificially synthesized primer pairs P319F / PR (amplifying the upstream region of the MAA_06769 gene, i.e., positions -319 to -1; corresponding to positions 593 to 911 in SEQ ID NO: 1; obtaining p319), P617F / PR (amplifying the upstream region of the MAA_06769 gene, i.e., positions -617 to -1; corresponding to positions 295 to 911 in SEQ ID NO: 1; obtaining p617), and P911F / PR (amplifying the upstream region of the MAA_06769 gene, i.e., positions -911 to -1; corresponding to positions 1 to 911 in SEQ ID NO: 1; obtaining p911).

[0093] Among them, P319F / PR amplified the upstream region of MAA_06769 gene, namely -319 to -1, corresponding to positions 593 to 911 in SEQ ID NO: 1, to obtain p319.

[0094] P617F / PR amplified the upstream region of the MAA_06769 gene, i.e., positions -617 to -1; corresponding to positions 295 to 911 in SEQ ID NO: 1; and obtained p617.

[0095] P911F / PR amplified the upstream region of the MAA_06769 gene, i.e., positions -911 to -1; corresponding to positions 1 to 911 in SEQ ID NO: 1; and obtained p911.

[0096] Using the wild-type M. robertsifolia genomic DNA as a template, promoter fragments of the MAA_06769 gene of different lengths were amplified in an attempt to develop a specific promoter with the shortest activity.

[0097] The PCR amplification system was: 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / L primer, 1 μl of genomic DNA template (10 ng / μl), and water was added to make the system 50 μl.

[0098] PCR reaction parameters: 95°C pre-denaturation for 5 (min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min). After 1.2% agarose electrophoresis, the MAA_06769 promoter fragment was recovered, the P319F / PR amplification product fragment was about 320 bp, the P617F / PR amplification product fragment was about 620 bp, and the P911F / PR amplification product fragment was about 920 bp.

[0099] The EGFP fragment was amplified by PCR using the primer pair PegF / PegR and the pk2-bar-EGFP plasmid (obtained by adding the bar-EGFP element to the backbone vector pk2) as a template.

[0100] The P319::EGFP fusion fragment was amplified using primers P319F / PegR and template (P319F / PR amplified fragment and EGFP fragment).

[0101] The P617::EGFP fusion fragment was amplified using primers P617F / PegR and template (P617F / PR amplified fragment and EGFP fragment);.

[0102] The P911::EGFP fusion fragment was amplified using primers 911F / PegR and template (P911F / PR amplified fragment and EGFP fragment).

[0103] The amplification system was: 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / L primer, 1 μl of plasmid template (10 ng / μl), and water was added to make the system 50 μl.

[0104] PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min).

[0105] The EGFP fragment was recovered by gel excision, and the fragments of MAA_06769 promoters of different lengths fused with EGFP were obtained by overlapping PCR amplification.

[0106] Recover the corresponding fragments.

[0107] The plasmid pDht-bar (obtained by adding the bar element to the backbone vector pDht) was digested with SpeI, and the pDht-bar fragment was recovered. The fragments of MAA_06769 promoters of different lengths fused with EGFP were seamlessly cloned with the pDht-bar fragment. The kit used was from Vazyme ( IIOne Step Cloning Kit, C112).

[0108] The vectors constructed by fusion of MAA_06769 promoters of different lengths with EGFP were named pDht-bar-P319::EGFP, pDht-bar-P617::EGFP, and pDht-bar-P911::EGFP, respectively. Figure 1 Schematic diagram of constructing the vector of the present invention.

[0109] The primers used for vector construction are as follows:

[0110] P319F: 5'-accgagatctgatgaactagtaaatgaggcgtttatgcgtc-3' (SEQ ID NO: 2);

[0111] P617F: 5'-accgagatctgatgaactagtgtcaggttacgggtagttca-3' (SEQ ID NO: 3),

[0112] P911F: 5'-accgagatctgatgaactagtattagaatggaaagcaaggg-3' (SEQ ID NO: 4);

[0113] PR: 5'-gcccttgctcaccatcatgtatgtacgtgtagcaa-3' (SEQ ID NO: 5);

[0114] PegF: 5'-acacgtacatacatgatggtgagcaagggcgagga-3' (SEQ ID NO: 6);

[0115] PegR: 5'-ggcggccgctctgaactagtttacttgtacagctcgtcca-3' (SEQ ID NO: 7).

[0116] 3. Agrobacterium genetic transformation

[0117] Take out the competent Agrobacterium (100ul) stored at -80℃, thaw on ice for 10min, add 1ul pDht-bar-P319::EGFP, pDht-bar-P617::EGFP, pDht-bar-P911::EGFP plasmid, mix by pipetting, ice bath for 30min, quick freeze in liquid nitrogen for 5min, water bath at 37℃ for 5min, ice bath immediately for 2min, add 1mL YEB liquid (without antibiotics) (clean bench), culture at 28℃, 150rpm for 3h. Centrifuge at 5000rpm for 5min, pour out the supernatant, keep 100ul, take half of it and coat it on YEB plate (containing Kan+Carb), blow dry, and culture at 28℃ upside down for 2-2.5d. Use the pipette tip to suck up 1ul of 3-5 single colonies, inoculate into 3mL YEB liquid (containing Kan+Carb), culture at 28℃, 220rpm for 14-20h, and take 1ul of bacterial liquid for PCR.

[0118] PCR amplification system: 10 μl of 2×Taq Master Mix (vazyme, P112), 0.5 μl of each of promoter primers of different lengths (P319F, P617F and P911F) and primer PegR (downstream of EGFP), 0.5 ul of bacterial solution as template, and water was added to make the system 20 μl.

[0119] Among them, the P319F / PegR amplified fragment is about 1kb, the P617F / PegR amplified fragment is about 1.4kb, and the P911F / PegR amplified fragment is about 1.7kb.

[0120] Amplification program: 95°C pre-denaturation for 5 (min), 30 cycles: 95°C (30 sec), 56°C (30 sec), 72°C (2 min), 72°C extension for 10 (min). YEB liquid medium (200 mL): sucrose 1 g, bacterial peptone 2 g, yeast extract 0.2 g, MgSO4.7H2O 0.1 g. Add 3 g agar to make it a solid medium.

[0121] 4. Genetic transformation and screening of Metarhizium Robertsii

[0122] The wild-type Metarhizium Robertsii was used as the transformation receptor and the transformation was carried out by using the genetic transformation method mediated by Agrobacterium tumefaciens. The culture medium and specific transformation method used are as follows:

[0123] Culture medium used during transformation:

[0124] YEB liquid medium (200 mL): sucrose 1 g, bacterial peptone 2 g, yeast extract 0.2 g, MgSO4.7H2O 0.1 g.

[0125] IM solid medium (1L): 400mL 2.5×mm salt solution / L, 5mL glycerol / L, 0.9g / L glucose, 15g / L agar powder (add 200μmol / L acetosyringone and 40mmol / L MES before use), high temperature sterilization at 121℃ for 15min.

[0126] IM liquid medium (1L): 400mL 2.5×mm salt solution / L, 5mL glycerol / L, glucose 1.8g / L, (add 200μmol / L acetosyringone and 40mmol / L MES before use), store in dark place)

[0127] M-100 solid culture medium (200 mL): 100× salt solution 12.5 mL, glucose 2 g, KNO3 0.6 g, agar 2 g, water 187.5 mL.

[0128] 2.5×MM salts (liquid, 1L): KH2PO4 3.625g, K2HPO4 5.125g, MgSO4.7H2O 1.250g, NaCl 0.375g, CaCl2.2H2O 0.165g, FeSO4.7H2O 0.0062g, (NH4)2SO4 1.250g, water 1L.

[0129] M-100trace element solution (liquid, 500mL): H3BO3 30mg, MnCl2 4H2O 70mg, ZnCl2200mg, Na2MoO4.2H2O 20mg, FeCl3.6H2O 50mg, CuSO4.5H2O 200mg, water 500mL.

[0130] M-100Salt solution (liquid, 1L): KH2PO4 16g, Na2SO4 4g, KCl 8g, MgSO4.7H2O2g, CaCl2 1g, M-100trace element solution 8mL, water 992mL.

[0131] Inoculate a single colony of Agrobacterium tumefaciens containing the plasmid vector into YEB liquid medium (containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin) and culture overnight at 28°C and 200 rpm in a shaking incubator (16-20 h). Take 3 mL of the bacterial solution and centrifuge at 6000 rpm for 10 min, discard the supernatant, resuspend the bacteria with an equal amount of IM liquid medium, and adjust the concentration to OD600 of 0.15, then culture at 28°C and 180 rpm in a shaking incubator for 6 h. During this period, prepare a 2×10 5 / mL spore suspension. After mixing the above spore suspension and the pre-cultured Agrobacterium culture liquid in equal volumes, take 200μl of the culture liquid and spread it on the IM solid culture medium plate, and culture it at 22℃ for 48h. Cover with 20mL M-100 solid culture medium containing 200ug / mL GA (Glufosinateammonium) and 300ug / mL Cef (Cefotaxim sodiumsalt), culture at 25℃ for 6-7d until resistant colonies appear, then pick a single colony with a toothpick and transfer it to PDA. After culturing at 25℃ for 4d, use the CTAB method to extract the genome and perform PCR verification. The transformant can amplify a fragment of about 800bp.

[0132] CTAB method for genome extraction: put mycelium into a FastPrep tube containing beads, set the FastPrep disruptor to 60 Hz, 60 sec, shake it continuously for 2 times, add 500 ul CTAB extraction solution, mix well and incubate at 55 ℃ for 15 min, add an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1), invert to mix well, centrifuge at 10000 rpm for 5 min, take the supernatant and add an equal volume of cold anhydrous ethanol, invert 3-5 times, place in a -20 ℃ refrigerator for 30 min, centrifuge at 12000 rpm for 10 min, pour out the supernatant, centrifuge for 10 sec, shake off the liquid on the wall of the tube, suck it dry with a pipette tip, let it stand at room temperature with the lid open for 5 min, evaporate to dryness, add 100 ul ddH2O, place in a 4 ℃ refrigerator for 3 h, and dissolve the DNA precipitate. CTAB extraction solution (200mL): CTAB 4g, NaCl 16.364g, 1M Tris-HCl 20mL (pH 8), 0.5M EDTA 8mL. PCR amplification system: 2×Taq Master Mix (vazyme, P112) 10μl, primer PegF 0.5μl, primer PegR 0.5μl, genomic DNA template 1μl (50ng), add water to 20μl system. Amplification program: 95℃ pre-denaturation 5 (min), 32 cycles: 95℃ (30sec), 56℃ (30sec), 72℃ (1min), 72℃ extension 10 (min).

[0133] 5. Analysis of the expression of genes driven by the MAA_06769 promoter at different developmental stages of Metarhizium Robertsii

[0134] Conidia of M. anisopliae M23 (Wang, B. et al., P Natl Acad Sci USA 109:1287-1292) grown on PDA plates for 14 days, mycelium grown in SDB liquid culture for 3 days, appressorium induced by insect wings for 30 hours, insect fungus induced by the hemocoel of greater wax moth larvae, and fruit flies infected with M. anisopliae for 72 hours were collected, RNA was extracted, and reverse transcribed into cDNA (TAKARA, PrimeScript TM RT reagent Kit with gDNA Eraser) was used to determine the expression pattern of the MAA_06769 gene by qPCR, and the MCL1 gene, which is specifically expressed only in the parasite, was used as a control.

[0135] The primer pairs for MAA_06769 are:

[0136] rt06769FA: 5'-tgaggaggataaagacgcc-3' (SEQ ID NO: 8);

[0137] rt06769RA: 5'-tttccaccgaggagttga-3' (SEQ ID NO: 9);

[0138] The primer pairs for the MCL1 gene are:

[0139] rtmclF: 5'-tgaacgacgactggatcactg-3' (SEQ ID NO: 10);

[0140] rtmclR: 5'-tgtcggacttggcatagacg-3' (SEQ ID NO: 11);

[0141] The tublin of Metarhizium Robertsii was used as the internal standard gene, and the primer sequences were:

[0142] ptubF: 5'-ggtcgctatgaaggaggttga-3' (SEQ ID NO: 12);

[0143] ptubR:5'-tcctggatggaggtggagtta-3' (SEQ ID NO: 13).

[0144] qPCR reaction system: 5.0 μl 2x qPCR SYBR Green Master Mix (Yeasen Biotechnology (Shanghai) Co., Ltd)), 0.1 μl cDNA, 0.2 μl of each primer pair, total volume 10 μl.

[0145] qPCR reaction parameters: 95°C (5 min); 40 cycles: 95°C (15 sec), 60°C (25 sec), 60°C (30 sec).

[0146] qPCR results showed that MAA_06769 was not expressed in conidia, hyphae and appressorium, but was highly expressed only in the parasitemia ( Figure 2 ).

[0147] It is worth mentioning that, compared with the gene (MCL1) reported to be specifically expressed in the parasite in Metarhizium, MAA_06769 was found to have a higher expression level than MCL1. The expression analysis of MAA_06769 at different time points of Metarhizium infection in Drosophila showed that MAA_06769 began to express at 36h after infection, and the expression increased with the increase of infection time, reaching a peak at 72h after infection ( Figure 3). This is consistent with the time when Metarhizium infects Drosophila and forms parasitic bodies in its body. This result suggests that MAA_06769 is a gene that is specifically or highly expressed in parasitic bodies and plays an important role in the process of Metarhizium infecting the host. Therefore, researching and developing the promoter of MAA_06769 has greater application prospects.

[0148] Example 2: Detection of EGFP fluorescence signals at different developmental stages of pMAA_06769::EGFP strain

[0149] The upstream of the MAA_06769 gene is 968bp away from the previous gene (MAA_11631). Analysis of the sequence revealed that it has typical promoter core element motifs such as TATA box (-111bp; corresponding to positions 801-807 in SEQ ID NO:1), CAAT Box (-71bp, -356bp, -716bp; corresponding to positions 841-844, 556-559, and 196-199 in SEQ ID NO:1, respectively) and GC box (-550bp, -894bp; corresponding to positions 362-367 and 18-23 in SEQ ID NO:1, respectively; eukaryotic GC box sequence characteristics (GGGCGG or GGGCGGGG), which are often located on both sides of the CAAT box. These three locations meet the above characteristics and are analyzed to be GC boxes).

[0150] To explore the shortest active region of the gene promoter, three different lengths of fragments (319 bp, 617 bp, and 911 bp) fused with EGFP were constructed according to the distribution of the promoter core elements (named P319, P617, and P911, respectively) to detect the optimal promoter activity. The constructed fungal expression vector was transformed into M. anisopliae by Agrobacterium-mediated genetic method.

[0151] Conidia, hyphae, appressoria, and thallus of the pMAA_06769::EGFP Metarhizium strain were collected and fluorescence observation was performed at different developmental stages to study the expression pattern of the MAA_06769 promoter and the optimal promoter activity.

[0152] The detection method is: using the enhanced green fluorescent protein EGFP gene as a reporter gene, constructing a transformant strain containing the pMAA_06769::EGFP fusion gene with promoters of different lengths. When the promoter is expressed, the EGFP reporter gene will be expressed, and green fluorescent protein will be produced in the spores of the recombinant Roberts' Green Anisopliae. The recombinant strain can emit bright green fluorescence under the irradiation of long-wave ultraviolet rays, which is the EGFP green fluorescence signal.

[0153] The observation results showed that the EGFP signal of the pMAA_06769::EGFP strain was not detected in conidia, hyphae, and appressorium, and was only highly expressed in the parasitemia. Figure 4 shown.

[0154] By observing the pMAA_06769::EGFP strains with different promoter lengths, it was found that promoter lengths between 319bp and 911bp all had transcriptional activity, and there was no significant difference in transcriptional activity within this range.

[0155] It is generally believed that the promoter of fungal genes is located 1000bp-1500bp before ATG. However, Metarhizium MAA_06769 has promoter activity in the 319bp region before ATG, which is relatively rare.

[0156] Example 3: Detection of EGFP gene expression in pMAA_06769::EGFP strain during infection of host by Metarhizium Robertsii

[0157] M. anisopliae begins to infect by attaching spores to the host body wall, and then proliferates in the host blood cavity in the form of worms. Under normal circumstances, when M. anisopliae infects fruit flies for 72 hours, it mainly exists in the fruit fly body in the form of worms. In order to analyze the expression of the MAA_06769 promoter in the process of M. anisopliae pathogenic host, the pMAA_06769::EGFP strain was inoculated into the dipteran insect Drosophila melanogaster, and the fruit flies infected for 72 hours were taken to extract RNA for qPCR detection (egfp primers rtegfpF: 5'-gcagaagaacggcatcaa-3' (SEQ ID NO: 14), rtegfpR: 5'-ggtgctcaggtagtggttgt-3' (SEQ ID NO: 15)), and tublin of M. anisopliae was used as the internal standard gene. qPCR results showed that the pMAA_06769::EGFP strain expressed EGFP 72 hours after infection. Compared with the strain transformed with the ptef::EGFP constitutive promoter, there was no significant difference in the expression level of EGFP, and there was no significant difference in the expression of EGFP between the three promoters of different lengths ( Figure 5 ).

[0158] In addition, the pMAA_06769::EGFP strain was used to infect the lepidopteran insect Glechoma galliformis, and the insect cells were purified and RNA was extracted for qPCR detection (egfp primers were the same as above). The qPCR results showed that the EGFP of the pMAA_06769::EGFP strain had a higher level of expression, and there was no significant difference between the strain transformed with the tef::EGFP constitutive promoter, which was consistent with the result of infecting Drosophila for 72 hours ( Figure 6 ).

[0159] The expression pattern of the MAA_06769 promoter in M. anisopliae is summarized, indicating that the promoter of this gene has good specificity, is specifically expressed during the infection of M. anisopliae to the host (in the insect body), and has transcriptional activity from before the translation start point to 319 bp to 911 bp. In other words, as long as the bases from 1 (-1 position) to 319 (-319 position) before the translation start point are included (corresponding to 593 to 911 in SEQ ID NO: 1), the activity is obtained.

[0160] Therefore, the MAA_06769 promoter has important application value. It can regulate specific genes to be efficiently expressed only during the host infection stage, thereby effectively controlling the leaky expression of exogenous genes before infecting the host without endangering environmental safety.

[0161] Example 4: Analysis of using the MAA_06769 gene promoter to express the exogenous gene HlyII (pMAA_06769::HlyII) to improve the insecticidal ability of the Roberts' Metarhizium strain

[0162] Haemolysin II (HlyII) is a perforating toxin protein present in Bacillus. It can induce apoptosis of phagocytes (insect hemocytes, mouse macrophages, human monocytes and dendritic cells) through its perforating activity, thereby producing toxicity to the animal immune system. In order to explore whether the expression of the exogenous gene HlyII by the MAA_06769 gene promoter can improve the insecticidal ability of Metarhizium anisopliae. The codons of the mature Hly II encoding gene were optimized and artificially synthesized, and the signal peptide sequence of the MCL1 gene of Metarhizium anisopliae was added in front of it, so that it is suitable for expression in the Metarhizium anisopliae insect body and secreted into the insect hemocoel. The MAA_06769 gene promoter P319 (-1 bp to -319 bp of the MAA_06769 gene) containing a TATA box and a CAAT box regulatory element and the MAA_06769 gene promoter P617 (-1 bp to -617 bp of the MAA_06769 gene) containing a TATA box, a CAAT box and a GC box regulatory element were used to drive the expression of Hly II. The vector was constructed as follows Figure 7 .

[0163] Artificially synthesize the nucleotide sequence of the HlyII mature protein coding gene and the signal peptide coding sequence of Mcl1:

[0164] atgcgtgaactttcttcggttctcgccctttcgggcttgctggccctggcgtcggca

[0165] The sequence marked with lowercase letters (underline, 57 bp) at the 5' end is the signal peptide coding sequence of Mcl1, and the other sequences (uppercase letters) are the coding gene sequences of the mature HlyII protein.

[0166] 1. Construction of pMAA_06769::HlyII overexpression vector

[0167] Artificially synthesized primer pairs P319F / PhyR (amplify the upstream region of MAA_06769 gene, i.e., positions -319 to -1; corresponding to positions 593 to 911 in SEQ ID NO: 1; obtain p319), P617F / PhyR (amplify the upstream region of MAA_06769 gene, i.e., positions -617 to -1; corresponding to positions 295 to 911 in SEQ ID NO: 1; obtain p617). The promoter fragment of the MAA_06769 gene was amplified using wild-type M. robertsii genomic DNA as a template.

[0168] The PCR amplification system was: 2×Phanta Max Master Mix (vazyme) 25 μl, 1 μl of each 10 μmol / L primer, 1 μl of genomic DNA template (10 ng / μl), and water was added to 50 μl system. PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min). The MAA_06769 promoter fragment was recovered by 1.2% agarose electrophoresis, the P319F / PhyR amplification product fragment was about 320 bp, and the P617F / PR amplification product fragment was about 620 bp.

[0169] The HlyII fragment was amplified by PCR using primers HLYIIF / HLYIIR and artificially synthesized HlyII as template. The HlyII fragment was recovered by gel excision. The P319::HlyII fusion fragment was amplified by primers P319F / HLYIIR and template (P319F / PhyR amplified fragment and HlyII fragment), and the P617::HlyII fusion fragment was amplified by primers P617F / HLYIIR and template (P617F / PhyR amplified fragment and HlyII fragment).

[0170] The PCR amplification system was: 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / L primer, 1 μl of plasmid template (10 ng / μl), and water was added to make the system 50 μl. PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (1 min); 72°C (15 min). The P319::HlyII fusion fragment was recovered by gel cutting. The P319::HlyII fusion fragment and the P617::HlyII fusion fragment were seamlessly cloned with pDht-bar (SpeI-cut plasmid fragment) respectively. The kit used was from vazyme ( IIOne Step Cloning Kit, C112). The vectors constructed by fusion of MAA_06769 promoters of different lengths with HlyII were named pDht-bar-P319::HlyII and pDht-bar-P617::HlyII.

[0171] 2. Obtaining Metarhizium pMAA_06769::HlyII overexpression transformants

[0172] The constructed pDht-bar-P319::HlyII plasmid and pDht-bar-P617::HLYII plasmid were transformed into P319::HLYII and P617::HLYII genetic transformation strains by Agrobacterium-mediated Metarhizium genetic transformation method (same as above). The genome was extracted by CTAB method and PCR was performed to verify that the transformant could amplify a fragment of about 600 bp.

[0173] PCR amplification system: 2×Taq Master Mix (vazyme, P112) 10 μl, primer pair (YZHLYF / YZHLYR) 0.5 μl each, genomic DNA template 1 μl (50 ng), add water to 20 μl system. Amplification program: 95°C pre-denaturation 5 (min), 32 cycles: 95°C (30 sec), 56°C (30 sec), 72°C (1 min), 72°C extension 10 (min).

[0174] The obtained transformants were used to infect Drosophila for 72 hours, and RNA was extracted and reverse transcribed into cDNA (TAKARA, PrimeScript TM RT reagent Kit with gDNA Eraser) and qPCR was used to identify strains with overexpression of the HlyII gene.

[0175] qPCR reaction system: 5.0 μl 2x qPCR SYBR Green Master Mix (Yeasen Biotechnology (Shanghai) Co., Ltd)), 0.1 μl cDNA, 0.2 μl of each primer pair (rtHLYF / rtHLYR), and a total volume of 10 μl.

[0176] qPCR reaction parameters: 95°C (5 min); 40 cycles: 95°C (15 sec), 60°C (25 sec), 60°C (30 sec).

[0177] qPCR results showed that compared with the wild-type strain M23, the HlyII gene was highly expressed in strains P319::HlyII / 23-48, P319::HlyII / 23-54, P617::HlyII / M23-8, and P617::HlyII / M23-9 (e.g. Figure 8 ).

[0178] The primers for vector construction and strain verification are as follows:

[0179] P319F: 5'-accgagatctgatgaactagtaaatgaggcgtttatgcgtc-3' (SEQ ID NO: 2);

[0180] P600F: 5'-accgagatctgatgaactagtgtcaggttacgggtagttca-3' (SEQ ID NO: 3);

[0181] PhyR: 5'-cgaagaaagttcacgcatcatgtatgtacgtgtagcaa-3' (SEQ ID NO: 17);

[0182] HLYIIF: 5'-ctacacgtacatacatgatgcgtgaactttcttcgg-3' (SEQ ID NO: 18);

[0183] HLYIIR: 5'-ggcggccgctctagaactagtttagatcttcttgatctcgat-3' (SEQ ID NO: 19);

[0184] YZHLYF: 5'-tcggcttccagagcttcaact-3' (SEQ ID NO: 20);

[0185] YZHLYR: 5'-ttcagctggttgccgttca-3' (SEQ ID NO: 21);

[0186] rtHLYF: 5'-caagctcgactggaagaacca-3' (SEQ ID NO: 22);

[0187] rtHLYR: 5'-ttctcgccgttgacgaaga-3' (SEQ ID NO: 23).

[0188] Detection method: Using adult Drosophila melanogaster as test insects, the virulence of the strain is determined by body wall infection, and the half-lethal time (LT) is compared. 50 , characterize the effect of heterologous overexpression of gene HlyII on the pathogenicity of the strain. The transformed strains P319::HlyII / M23 and P617::HlyII / M23 of Metarhizium anisopliae overexpressing HlyII were prepared into 1x10 5 The spores were used to infect Drosophila melanogaster, and the wild-type strain M23 was used as a control. The number of dead fruit flies was counted every 12 hours. 50 To characterize the virulence of the strain. 50 The smaller the value, the stronger the insecticidal ability of the strain.

[0189] The results of insect bioassay showed that compared with the wild strain M23, the HlyII-overexpressing strains P319::HlyII / M23 and P617::HlyII / M23 caused the infected fruit flies to die faster, with a half-lethal time LT 50 Significantly reduced ( Fig. 9 ).

[0190] The results showed that the MAA_06769 gene promoter drives HlyII, which can significantly enhance the pathogenicity of the strain to host insects; the results also further showed that the MAA_06769 gene promoter has transcriptional activity as long as it includes the upstream region, i.e., -319 to -1.

[0191] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. The use of the promoter of the MAA_06769 gene is to serve as a specific expression promoter to guide the expression of the target gene after the insect pathogenic fungus enters the insect blood cavity.

2. A method for expressing a target gene after an insect pathogenic fungus enters an insect hemocoel, comprising: (a) operably linking the promoter of the MAA_06769 gene to the target gene to form an expression cassette; introducing the expression cassette into an insect pathogenic fungus; (b) Infecting insects with the insect pathogenic fungus described in (a), and after the fungus enters the insect's hemocoel, the target gene is expressed.

3. The use according to claim 1 or the method according to claim 2, characterized in that The insects are insects susceptible to the insect pathogenic fungi; preferably, the insects include: Lepidoptera, Diptera, Homoptera, Orthoptera, Coleoptera, Hemiptera, and Hymenoptera; Alternatively, the insect pathogenic fungi are fungi that infect insects; preferably include fungi of the genus Metarhizium and Beauveria.

4. An isolated nucleic acid comprising a nucleic acid selected from the group consisting of: (1) A nucleic acid having SEQ ID NO: 1 or a nucleotide sequence comprising nucleotides 593 to 911 thereof; (2) a nucleic acid that has a nucleotide sequence identity of more than 80% with that of (1), has a conserved TATA box and a CAAT box, and has the function of directing the expression of a target gene after the insect pathogenic fungus enters the insect hemocoel; (3) a nucleic acid that can hybridize with the nucleotide sequence of (1) under stringent conditions, has a conserved TATA box and a CAAT box, and has the function of directing the expression of a target gene after the insect pathogenic fungus enters the insect hemocoel; Preferably, the nucleic acid also has a conserved GC box.

5. The isolated nucleic acid according to claim 4, characterized in that The nucleic acid comprises a member selected from the group consisting of: A nucleic acid having the nucleotide sequence shown at positions 593 to 911 in SEQ ID NO:1; A nucleic acid having the nucleotide sequence shown at positions 295 to 911 in SEQ ID NO:1; A nucleic acid having the nucleotide sequence shown at positions 1 to 911 in SEQ ID NO:

1.

6. An expression construct comprising the nucleic acid according to claim 4 or 5 as a promoter element.

7. The expression construct according to claim 6, wherein The expression construct also contains a target gene operably linked to the promoter element.

8. The expression construct according to claim 7, wherein The target genes include: functional genes and structural genes; Preferably, the functional genes include: reporter genes, genes for proteins that reduce the viability of insects, such as insect inhibitory toxin genes, genes for insect metabolism and immunosuppressive proteins, etc., and interfering molecules that target and interfere with essential genes of insects; for example, the functional genes include perforating toxin protein genes, more specifically hemolysin II.

9. A genetically engineered cell comprising the expression construct of any one of claims 6 to 8; or The nucleic acid according to claim 4 is integrated into its genome as a promoter element; preferably, a target gene is also integrated into its genome, and the target gene is operably linked to the promoter element.

10. The cell according to claim 9, characterized in that The cell is an insect pathogenic fungus; Preferably, the insects are insects susceptible to the insect pathogenic fungi; more preferably, they include: Lepidoptera insects, Diptera insects, Homoptera insects, Orthoptera insects, Coleoptera insects, Hemiptera insects, and Hymenoptera insects; Preferably, the insect pathogenic fungi are fungi that infect insects; more preferably, they include fungi of the genus Metarhizium and Beauveria.

11. A method for controlling insects, comprising: (1) providing an insect pathogenic fungus, which can use the insect as a host, infect the insect and enter its hemocoel; (2) introducing the expression construct of claim 7 into the insect pathogenic fungus; the functional genes include: reporter genes, genes of proteins that reduce insect viability, such as insect inhibitory toxin genes, genes of insect metabolism and immunosuppressive proteins, etc.; Interference molecules that target and interfere with essential genes of insects; for example, the functional genes include perforating toxin protein genes, more specifically hemolysin II; (3) The insect pathogenic fungus is applied to the insect, where it infects the insect and enters its hemocoel, thereby inhibiting the insect.

Images