A gene TdNRX1.1 related to high oxidative stress resistance of Chinese fir and its application

Abstract

The present invention discloses the use of the Zhongshan fir TdNRX1.1 gene in cultivating plant varieties with high oxidative stress tolerance, belonging to the field of genetic engineering technology. The TdNRX1.1 gene encodes the amino acid sequence shown in SEQ ID NO. 2. By increasing TdNRX1.1 expression, the present invention can improve plant tolerance to high oxidative stress. This gene can be used in plant genetic engineering breeding, providing a new approach for cultivating new germplasm that can withstand high oxidative stress.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a TdNRX1.1 gene sequence of a Chinese fir and its application in regulating plant resistance to abiotic stress and cultivating abiotic stress-resistant varieties. Background Art

[0002] In their natural environments, plants frequently face various abiotic stresses, such as drought, salinization, low and high temperatures, strong sunlight, ultraviolet radiation, and pollution. These adverse conditions pose a serious threat to plant growth and development, and can lead to reduced crop yield and quality. To adapt to and resist these environmental stresses, plants have evolved a complex set of physiological mechanisms, among which the antioxidant system plays a crucial role.

[0003] Against the backdrop of global climate change, extreme weather events are becoming more frequent, posing new challenges to agricultural production. While traditional breeding methods can improve crop stress resistance to a certain extent, their progress is relatively slow and they are unable to meet the demands of a rapidly changing environment. Furthermore, the use of chemical protectants not only increases costs but can also lead to environmental pollution and food safety issues. Therefore, developing new technologies and methods that can enhance a plant's own antioxidant capacity has become a key focus of modern agricultural research. Genetic engineering techniques can more precisely improve the stress resistance of crops, enhancing their ability to survive in harsh environments and increasing yield stability.

[0004] However, the genetic regulatory networks underlying plant responses to abiotic stress are complex, and the molecular regulatory mechanisms vary significantly among plants of different genetic backgrounds. Although some genes that regulate plant responses to abiotic stress have been reported, discovering and cloning more new genes that regulate plant resistance to abiotic stress, identifying new regulatory mechanisms, and developing new methods for breeding plant varieties that are resistant to abiotic stress remain urgent technical challenges. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a Taxodium 'Zhongshanshan' TdNRX1.1 gene sequence and its application in regulating plant resistance to abiotic stress and cultivating abiotic stress-resistant varieties.

[0006] The present invention cloned the TdNRX1.1 gene from C. zhongshanensis and constructed and compared the phenotypes and survival rates of TdNRX1.1-overexpressing strains under high oxidative stress. TdNRX1.1-overexpressing strains and controls were treated with high concentrations of methyl viologen. TdNRX1.1 transgenic Arabidopsis exhibited a higher survival rate and a stronger growth phenotype than the controls. Furthermore, under adverse conditions, the fresh weight and root length of transgenic Arabidopsis plants were significantly increased compared to the controls. These results demonstrate that TdNRX1.1 transgenic plants exhibit enhanced tolerance to high oxidative stress. Since the TdNRX1.1 gene originates from C. zhongshanensis, those skilled in the art have reason to believe that increasing TdNRX1.1 gene expression in C. zhongshanensis plants can improve their tolerance to high oxidative stress, while decreasing TdNRX1.1 gene expression can reduce their tolerance to high oxidative stress, making them more sensitive to it. In addition, since many abiotic stresses can cause oxidative stress, those skilled in the art have reason to believe that plants overexpressing TdNRX1.1 may exhibit higher tolerance under various abiotic stress conditions. The nucleotide sequence of the TdNRX1.1 gene is shown in SEQ ID NO.1, or is completely complementary to the sequence shown in SEQ ID NO.1, or is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2. This gene is expected to be applied to genetic engineering breeding of plants, providing a theoretical basis for the creation or improvement of new germplasm that can resist high oxidative stress in plants. Taking into account the degeneracy of codons, modifications to the bases of the above nucleotide sequence without changing the amino acid sequence also fall within the scope of protection of the present invention.

[0007] In one aspect, the present invention provides a protein for regulating the ability of a plant to cope with high oxidative stress, characterized in that the protein sequence is shown in SEQ ID NO.2.

[0008] Furthermore, the present invention provides a gene for regulating the ability of a plant to cope with high oxidative stress, characterized in that the gene sequence encodes a nucleotide sequence of the amino acid sequence shown in SEQ ID NO.2.

[0009] In another aspect, the present invention provides a use of the aforementioned protein or gene in regulating the ability of a plant to cope with high oxidative stress.

[0010] Furthermore, the regulating the ability of the plant to cope with high oxidative stress is to increase the ability of the plant to resist high oxidative stress by overexpressing the aforementioned protein or the aforementioned gene, or to reduce the ability of the plant to resist high oxidative stress by reducing the expression of the aforementioned protein or the aforementioned gene.

[0011] In a preferred embodiment, the plant is a dicotyledonous plant or a gymnosperm.

[0012] Furthermore, the plant is a plant of the Cruciferae family or the Taxodiaceae family.

[0013] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Baldcypress.

[0014] Furthermore, the plant is Arabidopsis thaliana or Cunninghamia lanceolata.

[0015] In another aspect, the present invention provides a use of the aforementioned protein or gene in breeding plant varieties with high tolerance to high oxidative stress and / or sensitivity to high oxidative stress.

[0016] Furthermore, the cultivation of plant varieties with high tolerance to high oxidative stress is to obtain plant varieties with high resistance to high oxidative stress by overexpressing the aforementioned protein or the aforementioned gene, and the cultivation of plant varieties sensitive to high oxidative stress is to obtain plant varieties sensitive to high oxidative stress by reducing the expression of the aforementioned protein or the aforementioned gene.

[0017] The sensitivity to high oxidative stress means reducing the tolerance of Zhongshan fir to high oxidative stress.

[0018] In a preferred embodiment, the plant is a dicotyledonous plant or a gymnosperm.

[0019] Furthermore, the plant is a plant of the Cruciferae family or the Taxodiaceae family.

[0020] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Baldcypress.

[0021] Furthermore, the plant is Arabidopsis thaliana or Cunninghamia lanceolata.

[0022] In a preferred embodiment, the ability of the plant to resist high oxidative stress means that the plant seeds have a higher survival rate under high oxidative stress conditions.

[0023] In another preferred embodiment, the ability of the plant to resist high oxidative stress refers to that the plant seedlings have a higher fresh weight per plant under high oxidative stress conditions.

[0024] In another preferred embodiment, the ability of the plant to resist high oxidative stress refers to the plant having a longer root length and / or a higher plant height under high oxidative stress conditions.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] 1) The present invention provides a novel protein capable of regulating the ability of plants to cope with high oxidative stress.

[0027] 2) The present invention provides a novel gene capable of regulating the ability of plants to cope with high oxidative stress.

[0028] 3) The present invention provides a gene and protein that can function in very distantly related species. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The beneficial effects of the present invention are described in detail below with reference to the accompanying drawings and specific embodiments.

[0030] Figure 1 Shown are the expression levels of TdNRX1.1 in wild-type and transgenic Arabidopsis.

[0031] Figure 2 Shown are the phenotypic analyses of TdNRX1.1-overexpressing Arabidopsis and wild-type Arabidopsis, where A is the phenotypic comparison of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium; B is the growth phenotype comparison of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium containing methyl viologen; C is the survival rate comparison of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium and medium containing methyl viologen; D is the average fresh weight per plant of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium and medium containing methyl viologen; E is the average root length of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium and medium containing methyl viologen. DETAILED DESCRIPTION

[0032] The nucleotide sequence of the TdNRX1.1 gene of the baldcypress tree in the embodiment is shown in SEQ ID NO.1:

[0033] 5'-ATGGAAGGTTTAAGGTACCTGCTGTGCAGTGAGGACAGAGATTTTCTCATCACAAACAAT

[0034]

[0035] The amino acid sequence of the baldcypress TdNRX1.1 protein is shown in SEQ ID NO.2:

[0036] .

[0037] Example

[0038] Example 1 Construction of the Zhongshan fir TdNRX1.1 gene overexpression vector

[0039] Tender leaves of one-year-old cuttings of "Zhongshanshan 406" were taken and total RNA was extracted using a plant RNA extraction kit (Magen). The target gene was then amplified. The specific experiment is as follows:

[0040] First-strand cDNA was obtained by reverse transcription (Novozymes Reverse Transcription Kit) of 1 μg of high-quality RNA (OD260 / OD280: 1.8-2.0; OD260 / OD230 ≈ 2.0). The open reading frame (ORF) was amplified using La Taq® (Takara, Shanghai, China) using the cDNA as a template. The reaction system consisted of 10 μL of 2× PCR buffer, 2 μL of 2 mM dNTPs, 0.5 μL of F primer (5'-ATGGAAGGTTTAAGGTACCTG-3'), 0.5 μL of R primer (5'-ACCTCTGTAACAATAATCTCCATC-3'), 1 μL of cDNA template, and 0.4 μL of KOD FX (1 U / μL). The volume was made up to 20 μL with water. The reaction conditions were: 95°C for 5 minutes, followed by 35 cycles of 95°C for 15 seconds, 56°C for 30 seconds, and 72°C for 30 seconds, and finally 72°C for 5 minutes. After the reaction, the PCR product was recovered using a gel extraction kit (Magen) and cloned into the pMD19-T vector (Takara, Shanghai, China) for sequencing verification.

[0041] The pCAMBIA1305-GFP vector was linearized by double digestion with the restriction endonucleases XbaI and BamHI (Takara, Shanghai, China). The TdNRX1.1 ORF was cloned into the 1305-GFP vector using the ClonExpress II One-Step Cloning Kit (Vazyme, Nanjing, China) and the primer pairs TdNRX1.1-1305F (aagtccggagctagctctagaATGGAAGGTTTAAGGTACCTGCTG) and TdNRX1.1-1305R (gcccttgctcaccatggatccACCTCTGTAACAATAATCTCCATCACA) containing homology arms to the 1305 vector, creating a recombinant vector (TdNRX1.1::GFP). The entire product was added to 100 μL of competent E. coli DH5α culture medium. The transformed product was then plated onto LB solid medium (containing a kanamycin resistance strain at a concentration of 50 mg / L). The culture was incubated overnight at 37°C, and four single colonies were identified by colony PCR. Two positive clones were selected for sequencing, resulting in clones containing the TdNRX1.1 gene sequence. This resulted in an overexpression vector containing the TdNRX1.1 target gene.

[0042] Example 2 Obtaining and Identifying TdNRX1.1 Transgenic Arabidopsis

[0043] The TdNRX1.1 overexpression construct was transformed into Arabidopsis thaliana using the Agrobacterium-mediated floral dip method to generate transgenic Arabidopsis OE lines. Transgenic seedlings were selected using hygromycin (15 mg / L). All transgenic seedlings were identified by PCR, and the GFP vector fragment was amplified. Ten positive T1 transgenic seedlings were propagated to obtain T2 seeds. T2 seeds were germinated using hygromycin-containing medium. If all seeds grew normally, the line was considered homozygous. Three transgenic lines (OE1, OE2, and OE3) were selected for qRT-PCR analysis and subsequently tested and analyzed.

[0044] The qRT-PCR identification process of the overexpression effect of TdNRX1.1 gene in transgenic Arabidopsis is as follows:

[0045] 1. Total RNA was extracted from 7-day-old Arabidopsis seedlings using a plant RNA extraction kit (Magen). 1 μg of high-quality RNA (OD260 / OD280: 1.8-2.0; OD260 / OD230 ≈ 2.0) was reverse transcribed (Novagen reverse transcription kit) to obtain first-strand cDNA.

[0046] 2. Using the cDNA from step 1 above as a template, the TdNRX1.1 gene expression was detected using the primer pair TdNRX1.1-qF (ATGGAAGGTTTAAGGTACCTG) and TdNRX1.1-qR (ACCTCTGTAACAATAATCTCCATC). The Arabidopsis thaliana housekeeping gene UBQ10 was detected using the primer pair UBQ10-qF (CGGAAAGCAGTTGGAGGATGG) and UBQ10-qR (CGGAGCCTGAGAACAAGATGAAG) as an internal control. SYBR® Premix Ex Taq™ (TAKARA) was used for quantitative PCR, and the instrument was a CFX 96 (Bio-RAD). The reaction system was: 5 μL of 2× PCR buffer, 0.4 μL of qF primer, 0.4 μL of qR primer, 1 μL of cDNA template, 3.2 μL of sterile water, for a total reaction volume of 10 μL. The reaction procedure was: 95°C for 30 seconds, followed by 45 cycles of 95°C for 5 seconds and 68°C for 30 seconds.

[0047] The results are as follows Figure 2 As shown, the expression levels of the TdNRX1.1 gene in the three selected strains were greatly increased, and these three overexpression strains were subsequently selected for experiments.

[0048] Example 3: Phenotypic Analysis of TdNRX1.1 Overexpressing Arabidopsis

[0049] Homozygous overexpressing and wild-type Col-0 plant seeds were surface-sterilized with 0.4% sodium hypochlorite and sown on 1 / 2 MS fixative medium. After refrigeration at 4°C for 3 days, they were placed in a plant growth room for germination and growth. Seven-day-old Arabidopsis seedlings were transferred to 1 / 2 MS fixative medium containing 0.2 μM methyl viologen. Phenotypic differences were observed and recorded after 14 days.

[0050] Phenotypic results are shown in Figure 2 A / B, the results showed that the growth of both wild type and overexpression lines was significantly inhibited under 0.2 μM methyl viologen stress. However, the growth of TdNRX1.1 overexpression Arabidopsis was significantly higher than that of wild type ( Figure 2 B).

[0051] In 1 / 2 MS medium, the survival rates of the wild type and overexpression lines were close to 100%. After 14 days in 1 / 2 MS medium containing 0.2 μM methyl viologen, the survival rate of the wild type was 77.78%, while the survival rates of OE-1, OE-2, and OE-3 were significantly higher than that of the wild type, at 87.5%, 100%, and 91.67%, respectively ( Figure 2 C).

[0052] Under 0.2 μm methyl viologen stress, the fresh weight of Col-0 was 2 mg per plant, while the fresh weight of OE-1, OE-2, and OE-3 was between 3.1 mg and 5.2 mg ( Figure 2 D).

[0053] Under stress, the average maximum root length of Col-0 was 7.8 mm, while that of OE-1, OE-2, and OE-3 was 9.9 mm, 11.5 mm, and 12.9 mm, respectively. That is, under 0.2 μm methyl viologen stress, the survival rate, fresh weight, and root length of the overexpression lines were significantly higher than those of the wild type ( Figure 2 E).

[0054] Based on the above results, it is confirmed that the TdNRX1.1 gene can improve the ability of plants to tolerate oxidative stress, and can therefore be used to improve the adaptability of plants to abiotic stress and can be used in plant breeding for abiotic stress resistance.

[0055] Based on the disclosure and teachings of the above description, those skilled in the art may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and any modifications and variations of the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although certain specific terms are used in this description, these terms are only for convenience of description and do not constitute any limitation to the present invention.

Claims

1. A protein that regulates a plant's ability to adapt to abiotic stress, characterized in that: The sequence of the protein is shown in SEQ ID NO.

2.

2. A gene that regulates a plant's ability to adapt to abiotic stress, characterized in that: The gene encodes the amino acid sequence shown in SEQ ID NO.

2.

3. Use of the protein according to claim 1 or the gene according to claim 2 in regulating the ability of a plant to cope with abiotic stress, characterized in that: The abiotic stress is oxidative stress, and the regulating the plant's ability to cope with abiotic stress is to improve the plant's ability to tolerate high oxidative stress by overexpressing the protein of claim 1 or the gene of claim 2, and the plant is Arabidopsis thaliana.

4. Use of the protein according to claim 1 or the gene according to claim 2 in cultivating plant varieties with high tolerance to abiotic stress, wherein the plant varieties cultivated with high tolerance to abiotic stress are plant varieties with high tolerance to abiotic stress obtained by overexpressing the protein according to claim 1 or the gene according to claim 2, wherein the abiotic stress is oxidative stress, and the plant is Arabidopsis thaliana.

Images