Recombinant measles virus vector for expressing Marburg virus protein and Ebola virus protein and application of recombinant measles virus vector

Abstract

The invention discloses a recombinant measles virus vector for expressing Marburg virus protein and Ebola virus protein and application of the recombinant measles virus vector, and relates to the technical field of recombinant vaccines. The invention provides a measles virus vector capable of delivering protective antigen GP protein of Marburg virus, and on the basis of the vector, exogenous glycoprotein can be expressed on the surface of a host cell to stimulate an organism to generate immune response aiming at the Marburg virus. Besides, the invention further provides a measles virus vector capable of delivering protective antigen GP protein of the Marburg virus and the Ebola virus, an exogenous glycoprotein can be expressed on the surface of a host cell based on the vector, an organism is stimulated to generate immune response aiming at the two antigens of the Marburg virus and the Ebola virus, and the immune response is enhanced. An organism is stimulated to generate humoral immunity and cellular immunity, and simultaneous protection of two pathogens by single-needle immunity is realized.

Description

Technical Field

[0001] The present invention relates to the technical field of recombinant vaccines, and in particular to a recombinant measles virus vector expressing Marburg virus protein and Ebola virus protein and an application thereof. Background Art

[0002] The Filoviridae family includes the genera Cuevavirus, Marburgvirus, and Ebolavirus. The Ebolavirus genus includes six viruses: Zaire, Bundibugyo, Sudan, Tai Forest, Reston, and Bombali. The average case fatality rate of Ebola virus is about 50%, ranging from 25% to 90% in different outbreaks (WHO. "Ebola virus disease." World Health Organization. https: / / www.who.int / news-room / fact-sheets / detail / ebola-virus-disease.). Among them, Zaire Ebola virus has a mortality rate of up to 90%, making it the most deadly virus. In addition, Sudan virus and Bundibugyo virus cause a mortality rate of about 50% and 30%, respectively. Tai Forest virus is relatively rare.

[0003] Vaccines to prevent certain types of Ebola virus disease have been used to control the spread of the Ebola outbreak. On November 6, 2017, the State Food and Drug Administration approved the new drug registration of the adenovirus type 5 vector Ebola virus disease vaccine jointly developed by the Institute of Bioengineering, Academy of Military Medical Sciences, Chinese Academy of Military Sciences and CanSino Biologics. The Russian Ministry of Health approved GamEvac-Combi, an Ebola vaccine developed by the Gamaleya Research Center for Epidemiology and Microbiology of the Russian Federation. In October 2019, the European Medicines Agency granted conditional marketing approval to the rVSVΔG-ZEBOV-GP candidate vaccine produced by Merck in the United States; on December 19 of the same year, the U.S. Food and Drug Administration approved the vaccine. During the Ebola outbreak in the Democratic Republic of the Congo from 2018 to 2020, about 300,000 people were vaccinated with the rVSVΔG-ZEBOV-GP vaccine, which effectively curbed the risk of further spread of the virus. In 2020, the European Union approved the marketing of Janssen's two-dose Ebola vaccine, including Ad26.ZEBOV based on human adenovirus type 26 vector and MVA-BN-Filo based on modified poxvirus vector. The above vaccines have been proven to be effective in preventing infection with Zaire type Ebola virus, but are not effective against different types of Ebola virus. Several teams have tried to develop vaccines for both Ebola virus and Marburg virus, but no vaccine that can prevent both viruses has been approved for marketing.

[0004] Measles virus belongs to the genus Morbillivirus and is a member of the family Paramyxoviridae. It is an enveloped, non-segmented, single-stranded negative-sense RNA virus with a genome of approximately 16 kilobases. The genome encodes six structural proteins: nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin protein (H), and large protein (L). In addition, the P gene encodes two non-structural proteins: V protein and C protein. H and F proteins form heterodimers and play a key role in viral invasion and syncytium formation. Recombinant vaccines using measles virus as a vector can provide a wider range of protection during the immunization process. Measles virus has become an ideal viral vector for the development of recombinant vaccines due to its good immunogenicity and safety. As a vector, measles virus can carry antigen genes of other pathogens and induce the host to produce an immune response against these antigens. Since the measles virus itself can effectively infect and activate the host's immune system, the recombinant vaccine can produce strong cellular and humoral immune responses.

[0005] Schwarz, Edmonston-Zagreb, AIK-C and other strains are currently the safest and most effective measles live vaccines and are widely used in immunization programs around the world. Since Radecke et al. established the measles virus reverse genetics platform in 1995, measles virus has shown great potential as a vaccine vector. This vector system is highly flexible and can be modified and expressed in a variety of protective antigens for the prevention of emerging infectious diseases. For example, measles virus vectors are used to express antigens of West Nile virus, Chikungunya virus, HIV-1 and Lassa virus, and some vaccines have entered clinical trials. The measles virus vector vaccine platform has several key advantages. First, measles virus vaccines have been widely used since the 1960s and have extremely high safety and mature production processes. Second, even if the vaccine recipient is already immune to measles, the vaccine can still effectively induce a strong immune response and can express heterologous antigens. In addition, the platform can flexibly insert exogenous transcription units of up to 6 kilobases to adapt to the antigen design of different pathogens. Most importantly, measles virus can directly deliver antigens to dendritic cells, macrophages, and B cells, inducing potent and long-lasting immune responses.

[0006] Ebola and Marburg are non-segmented negative-strand RNA viruses with a genome length of about 19 kb. The genome structure from the 3' end to the 5' end is Leader-NP-VP35-VP40-GP-VP30-VP24-L-trailer. They encode nucleoprotein (NP), glycoprotein (GP), four small viral proteins (VP24, VP30, VP35, VP40) and RNA-dependent RNA polymerase (L protein), respectively, and all genes are located on a negative-strand RNA. Among them, GP is a type I transmembrane protein distributed on the surface of the virus, which plays an important role in mediating the entry of viral particles into cells. GP is highly glycosylated when transported to the Golgi apparatus in the cell, forming antigenic epitopes on the mucin-like domain. GP plays a key role in the pathogenicity of Ebola virus, promoting viral invasion by binding to host cell receptors, and can destroy the integrity of microvessels and cause vascular leakage. At the same time, GP is also the main target for inducing protective immune responses. As the main antigen of filovirus, GP has also become a hot target for vaccine development. Vaccines based on live virus vectors use GP as the target antigen and show good animal protection effects.

[0007] In view of this, the present invention is proposed. Summary of the invention

[0008] The object of the present invention is to provide a recombinant measles virus vector expressing Marburg virus protein and Ebola virus protein and its application to solve the above technical problems.

[0009] The present invention is achieved in that:

[0010] In a first aspect, the present invention provides a recombinant measles virus vector expressing Marburg virus protein, comprising: a negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP is inserted into the measles virus vector, and the negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP is shown in SEQ ID NO:1.

[0011] In a second aspect, the present invention provides a recombinant measles virus vector expressing Ebola virus protein and Marburg virus protein, comprising: a negative-strand RNA coding sequence of Ebola virus glycoprotein GP and a negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP are inserted into the measles virus vector, the negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP is as shown in SEQ ID NO: 1; the negative-strand RNA coding sequence of Ebola virus glycoprotein GP is as shown in SEQ ID NO: 8.

[0012] In a third aspect, the present invention provides a nucleic acid molecule comprising any one of the following (1)-(2):

[0013] (1) operably linking the negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP in the above-mentioned recombinant measles virus vector to the cDNA sequence encoding the negative-strand RNA of the measles virus antigenome;

[0014] (2) The negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP and the negative-strand RNA coding sequence of Ebola virus glycoprotein GP in the above-mentioned recombinant measles virus vector are operably linked to the cDNA sequence encoding the negative-strand RNA of the measles virus antigenome.

[0015] In a fourth aspect, the present invention provides a reverse genetics system for rescuing a recombinant measles virus vector expressing Marburg virus protein, which comprises: a) an antigen expression plasmid comprising the above-mentioned nucleic acid molecule; b) an auxiliary plasmid 1 comprising a measles virus nucleocapsid protein coding sequence; c) an auxiliary plasmid 2 comprising a measles virus phosphoprotein coding sequence; and d) an auxiliary plasmid 3 comprising a measles virus RNA polymerase coding sequence.

[0016] In a fifth aspect, the present invention provides a method for preparing recombinant measles virus particles, comprising any one of the following methods:

[0017] Method 1: co-transfect the plasmids in the above reverse genetics system into the first cell line;

[0018] Method 2: Transfect the antigen expression plasmid in the above-mentioned reverse genetics system into the helper cell line.

[0019] In a sixth aspect, the present invention provides a recombinant measles virus particle obtained by the above method.

[0020] In a seventh aspect, the present invention provides a host cell obtained by transfecting a cell with the above-mentioned nucleic acid molecule or the above-mentioned recombinant measles virus vector or the above-mentioned recombinant measles virus vector.

[0021] In an eighth aspect, the present invention provides a composition comprising the above-mentioned recombinant measles virus particles and a pharmaceutically acceptable carrier.

[0022] In a ninth aspect, the present invention provides the use of recombinant measles virus particles or the above-mentioned composition in the preparation of drugs or vaccines for preventing and / or treating Ebola virus infection and / or Marburg virus infection.

[0023] The present invention has the following beneficial effects:

[0024] The present invention constructs a measles virus vector that can deliver the protective antigen GP protein of Marburg virus. Based on the vector, the exogenous glycoprotein can be expressed on the surface of host cells, stimulating the body to produce an immune response to Marburg virus, namely humoral immunity and cellular immunity. In addition, a measles virus vector that can deliver the protective antigen GP protein of Marburg virus and Ebola virus is also provided. Based on the vector, the exogenous glycoprotein can be expressed on the surface of host cells, stimulating the body to produce an immune response to the two antigens of Marburg virus and Ebola virus, namely humoral immunity and cellular immunity, achieving single-shot immunity and achieving simultaneous protection against two pathogens.

[0025] The recombinant measles virus particles provided by the present invention can be used to prepare vaccines, and the preparation method is simple and can be mass-produced in a short period of time to respond to sudden Ebola and Marburg virus epidemics and biological terrorist attacks.

[0026] The present invention constructs and designs a filovirus vaccine based on a measles virus vector, which significantly improves the immunogenicity and broad spectrum of the vaccine, and provides a new idea for the development of a new filovirus vaccine. Through this innovative vaccine design, not only can the prevention effect of filovirus be improved, but also a new solution can be provided for future response to emerging viral threats. This broad-spectrum vaccine platform based on measles virus will help improve global public health security. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0028] Figure 1 pGF-MVMARV GP Plasmid map;

[0029] Figure 2 pGF-MVEBOV GP +MARV GP Plasmid map;

[0030] Figure 3 Enzyme digestion identification diagram;

[0031] Figure 4 Stability identification of recombinant measles virus;

[0032] Figure 5 WB identification of recombinant measles virus;

[0033] Figure 6 Immunofluorescence identification of recombinant measles virus;

[0034] Figure 7 Schematic diagram of pseudovirus neutralization experiment to detect serum antibody levels 28 days after immunization;

[0035] Figure 8 Schematic diagram of pseudovirus neutralization;

[0036] Fig. 9 IFN-γ cytokine secretion was detected by flow cytometry;

[0037] Fig.10 ELISpot detection results of cytokines;

[0038] Fig.11 This is the weight change curve and survival curve of mice after MA-EBOV challenge;

[0039] Fig.12 This is the weight change curve and survival curve of mice after rVSV-MARV challenge;

[0040] Fig.13 pGFMV schwarz Plasmid map;

[0041] Fig.14 This is the vector map of T-F1 plasmid. DETAILED DESCRIPTION

[0042] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0043] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc.); Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0044] In the present invention, "glycoprotein GP" is synonymous with "GP protein".

[0045] As used herein, the term "negative strand RNA", such as the negative strand RNA of the measles virus genome, refers to RNA that cannot function as mRNA and must first synthesize a complementary strand (positive strand RNA) as mRNA before protein translation. Accordingly, its complementary sequence is called a positive strand RNA sequence. The positive strand RNA corresponding to the negative strand RNA of the measles virus genome is also called the antigenomic positive strand RNA.

[0046] The attenuated strain of measles virus refers to a strain that has been serially passaged on selected cells and, possibly, adapted to other cells to produce a seed strain suitable for preparing a vaccine strain, and has a stable genome that does not allow reversion to pathogenicity nor integration into the host chromosome. As a specific "attenuated strain", the strain confirmed for vaccine is an attenuated strain suitable for the present invention, that is, after a rigorous review of laboratory and clinical data, it meets the safety, efficacy, quality and repeatability rules.

[0047] In a first aspect, the present invention provides a recombinant measles virus vector expressing Marburg virus protein, comprising: a positive-strand RNA coding sequence of Marburg virus protein glycoprotein GP is inserted into the measles virus vector, and the positive-strand RNA coding sequence of Marburg virus protein glycoprotein GP is shown in SEQ ID NO:1.

[0048] Through codon optimization technology, a negative-strand RNA coding sequence of the Marburg virus protein glycoprotein GP as shown in SEQ ID NO: 1 is provided, and the expression level of the Marburg virus GP protein is enhanced. After the GP protein codon is optimized, although the cellular immunity level of the Marburg virus recombinant measles virus vector vaccine remains unchanged in the mouse model, the humoral immunity level is significantly increased. Both cellular and humoral immune responses are crucial for the body to resist Marburg virus infection. Therefore, the recombinant measles virus vector expressing Marburg virus protein provided by the present invention can simultaneously induce the body to produce cellular and humoral immune responses against MARV GP in a short period of time, enhance the body's immune protection effect, and help improve global public health security.

[0049] In a preferred embodiment of the present invention, the measles virus vector also includes complementary sequences of the P gene, M gene, H gene and L gene, and the positive-strand RNA coding sequence of the Marburg virus protein glycoprotein GP is located in the non-coding region between the P gene and the M gene, thereby achieving efficient expression of the protein.

[0050] In a preferred embodiment of the present invention, the measles virus vector also includes complementary sequences of the N gene and the F gene, and the structure of the measles virus vector includes: 5'-N gene complementary sequence-P gene complementary sequence-Marburg virus protein glycoprotein GP negative strand RNA coding sequence-M gene complementary sequence-F gene complementary sequence-H gene complementary sequence-L gene complementary sequence.

[0051] The above-mentioned N gene complementary sequence, P gene complementary sequence, M gene complementary sequence, F gene complementary sequence, H gene complementary sequence and L gene complementary sequence are all complementary sequences of the negative-strand RNA of each gene.

[0052] In a preferred embodiment of the present invention, the N gene, P gene, M gene, F gene, H gene and L gene on the measles virus are all from an attenuated measles virus strain, the attenuated measles virus strain is Schwarz, and the Genebank number is AF266291.1.

[0053] In a preferred embodiment of the present invention, the N gene complementary sequence, the P gene complementary sequence, the M gene complementary sequence, the F gene complementary sequence, the H gene complementary sequence and the L gene complementary sequence are shown as SEQ ID NOs: 2-7, respectively.

[0054] In a preferred embodiment of the present invention, the measles virus vector further comprises at least one of the following regulatory elements: a transcription promoter, a termination sequence, an enhancer, and other cis-acting elements. The above regulatory elements may be homologous or heterologous to the measles virus strain used. Other cis-acting elements may be silencers.

[0055] In a second aspect, the present invention provides a recombinant measles virus vector expressing Ebola virus protein and Marburg virus protein, comprising: a negative-strand RNA coding sequence of Ebola virus glycoprotein GP and a negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP are inserted into the measles virus vector, and the negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP is as shown in (1) or (2): (1) as shown in SEQ ID NO: 1; (2) having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO: 1;

[0056] The negative-strand RNA coding sequence of the Ebola virus glycoprotein GP is as shown in (1) or (2): (1) as shown in SEQ ID NO:8; (2) having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO:8.

[0057] In a preferred embodiment of the present invention, the Ebola virus glycoprotein GP protein is from the Zaire type Ebola virus Mayinga strain, Genbank number: AF086833.2.

[0058] In a preferred embodiment of the present invention, the measles virus vector further includes an N gene complementary sequence, a P gene complementary sequence, an M gene complementary sequence, an F gene complementary sequence, an H gene complementary sequence and an L gene complementary sequence, and the negative-strand RNA coding sequence of the Marburg virus protein glycoprotein GP and the negative-strand RNA coding sequence of the Ebola virus glycoprotein GP are both located in the non-coding region between the P gene and the M gene, or between the H gene and the L gene; and a self-cleaving protein gene is connected between the negative-strand RNA coding sequence of the Marburg virus protein glycoprotein GP and the negative-strand RNA coding sequence of the Ebola virus glycoprotein GP;

[0059] In a preferred embodiment of the present invention, the self-cleaving protein is selected from T2A, P2A, E2A, F2A or a combination thereof. In a more preferred embodiment of the present invention, the self-cleaving protein is P2A.

[0060] In a preferred embodiment of the present invention, the structure of the measles virus vector includes: 5'-N gene complementary sequence-P gene complementary sequence-Ebola virus glycoprotein GP negative strand RNA coding sequence-self-cleaving protein gene-Marburg virus protein glycoprotein GP negative strand RNA coding sequence-M gene complementary sequence-F gene complementary sequence-H gene complementary sequence-L gene complementary sequence;

[0061] In a preferred embodiment of the present invention, the N gene, P gene, M gene, F gene, H gene and L gene on the measles virus are all from an attenuated measles virus strain, the attenuated measles virus strain is Schwarz, and the Genebank number is AF266291.1;

[0062] In a preferred embodiment of the present invention, the N gene complementary sequence, the P gene complementary sequence, the M gene complementary sequence, the F gene complementary sequence, the H gene complementary sequence and the L gene complementary sequence are shown in SEQ ID NOs: 2-7, respectively;

[0063] In a preferred embodiment of the present invention, the measles virus vector further comprises at least one of the following regulatory elements: a transcription promoter, a termination sequence, an enhancer and other cis-acting elements.

[0064] In a third aspect, the present invention provides a nucleic acid molecule comprising any one of the following (1)-(2):

[0065] (1) operably linking the positive-strand RNA coding sequence of Marburg virus protein glycoprotein GP in the above-mentioned recombinant measles virus vector to the cDNA sequence encoding the positive-strand RNA of the measles virus antigenome;

[0066] (2) The positive-strand RNA coding sequence of Marburg virus protein glycoprotein GP and the positive-strand RNA coding sequence of Ebola virus glycoprotein GP in the above-mentioned recombinant measles virus vector are operably linked to the cDNA sequence encoding the positive-strand RNA of the measles virus antigenome.

[0067] For example, it can be inserted into the intergenic region, for example, between the N and P genes, between the P and M genes, between the M and F genes, between the F and H genes, or between the H and L genes of the measles virus.

[0068] The negative-strand RNA coding sequence of the Marburg virus protein glycoprotein GP and the negative-strand RNA coding sequence of the Ebola virus glycoprotein GP are both located in the non-coding region between the P gene and the M gene, or between the H gene and the L gene.

[0069] In some cases, the recombinant measles virus vector may further comprise a negative-strand RNA sequence corresponding to a plurality of elements for controlling expression, including but not limited to a promoter sequence, a transcription initiation sequence, an enhancer sequence, an intron, a kozak sequence, a polyA sequence, a selection element, and a reporter gene. These regulatory elements may be homologous or heterologous to the measles virus coding sequence.

[0070] As used herein, the term "operably linked" in the present invention refers to the presence of a functional connection between different polynucleotides in the vector, whereby the different polynucleotides and nucleic acid constructs are effectively transcribed and, where appropriate, translated, particularly in a cell or cell line, particularly in a cell or cell line or host cell used as part of a rescue system to produce the recombinant infectious measles virus particles of the present invention.

[0071] In a fourth aspect, the present invention provides a reverse genetics system for rescuing a recombinant measles virus vector expressing Marburg virus protein, which comprises: a) an antigen expression plasmid comprising the above-mentioned nucleic acid molecule; b) an auxiliary plasmid 1 comprising a measles virus nucleocapsid protein coding sequence; c) an auxiliary plasmid 2 comprising a measles virus phosphoprotein coding sequence; and d) an auxiliary plasmid 3 comprising a measles virus RNA polymerase coding sequence.

[0072] Reverse genetics is a genetic research method that determines the function of a gene by site-directed mutation of a gene and studying its phenotype. When studying viruses, reverse genetics can express and manipulate viruses containing specific mutations in cell culture through DNA recombination, thereby evaluating the effects of mutations on viral replication and transcription, pathogenicity, virus-host interaction, inhibition of host cell responses, and host range or transmissibility. Various reverse genetic methods have been used to recover recombinant viruses of various virus families, including positive-strand RNA viruses such as tubular viruses, picornaviruses, and flaviviruses; negative-strand RNA viruses such as influenza viruses and arenaviruses. Reverse genetics has also been used to develop vaccines based on attenuated forms of viruses and to produce recombinant viruses carrying reporter genes to track viral infections. Due to the many advantages of reverse genetics, such as rapid production and mutation of viruses (including rearrangements), it is an effective tool for virology and vaccine manufacturing.

[0073] In a preferred embodiment of the present invention, the antigen expression plasmid is a eukaryotic expression plasmid;

[0074] In a preferred embodiment of the present invention, the antigen expression plasmid is an animal-animal shuttle plasmid;

[0075] In a preferred embodiment of the present invention, the antigen expression plasmid and the auxiliary plasmids 1-3 are plasmids containing a T7 promoter.

[0076] In a fifth aspect, the present invention provides a method for preparing recombinant measles virus particles, comprising any one of the following methods:

[0077] Method 1: co-transfect the plasmids in the above reverse genetics system into the first cell line;

[0078] Method 2: Transfect the antigen expression plasmid in the above-mentioned reverse genetics system into the helper cell line.

[0079] In a preferred embodiment of the present invention, the method further comprises: collecting the cell supernatant after transfection, infecting a second cell line and culturing it;

[0080] In a preferred embodiment of the present invention, the cell supernatant is collected and purified to obtain recombinant measles virus particles expressing Marburg virus protein, or expressing Ebola virus protein and Marburg virus protein;

[0081] In a preferred embodiment of the present invention, the mass ratio of the added amount of the antigen expression plasmid to the auxiliary plasmid 1, the auxiliary plasmid 2 and the auxiliary plasmid 3 is: 4-4.1:2.5-2.6:1.5-1.6:0.8-1, for example, 4:2.5:1.5:0.8;

[0082] In a preferred embodiment of the present invention, the first cell line is a cell line stably expressing T7 RNA polymerase, and the second cell line is a Vero cell line.

[0083] Cell lines expressing T7 RNA polymerase such as BHK-T7 cell line and BSR-T7 cell line.

[0084] In a sixth aspect, the present invention provides a recombinant measles virus particle obtained by the above method.

[0085] In a seventh aspect, the present invention provides a host cell obtained by transfecting a cell with the above-mentioned nucleic acid molecule or the above-mentioned recombinant measles virus vector or the above-mentioned recombinant measles virus vector.

[0086] In an eighth aspect, the present invention provides a composition comprising the above-mentioned recombinant measles virus particles and a pharmaceutically acceptable carrier;

[0087] In a preferred embodiment of the present invention, the composition is a vaccine composition.

[0088] These compositions induce immune responses, especially protective immune responses, against Marburg virus and Ebola virus, and particularly induce antibody production against Marburg virus and Ebola virus antigenic proteins and / or induce cellular immune responses against Marburg virus and Ebola virus infection. These compositions may accordingly comprise a suitable carrier, such as a pharmaceutically acceptable carrier, for administration to a host, especially a human host, and may further comprise, but not necessarily, an adjuvant to enhance the immune response in the host.

[0089] The term "pharmaceutically acceptable" refers to a pharmaceutical composition or a vaccine composition (e.g., an immunogenic or vaccine formulation) that is listed as being available for animals, especially humans, as approved by regulatory agencies or listed in the pharmacopoeias of various countries or other generally recognized pharmacopoeias. The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which a pharmaceutical composition or vaccine composition (e.g., an immunogenic or vaccine formulation) is administered. Saline solutions, as well as aqueous glucose solutions and glycerol solutions can also be used as liquid carriers, particularly for injection solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene, ethylene glycol, water, ethanol, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EWMartin. The preparation should be suitable for the mode of administration.

[0090] In a preferred embodiment of the present invention, the composition is an immunogenic composition, in particular a vaccine composition. The composition or vaccine is used to prevent Ebola virus infection in preventive therapy, and optionally, to prevent Marburg virus and Ebola virus infection at the same time. The vaccine composition advantageously comprises recombinant measles virus particles rescued from a reverse genetics system.

[0091] In a ninth aspect, the present invention provides the use of recombinant measles virus particles or the above-mentioned composition in the preparation of a drug or vaccine for preventing and / or treating Ebola virus infection and / or Marburg virus infection;

[0092] In a preferred embodiment of the present invention, the subject is a human.

[0093] The vaccine can be administered to mammalian subjects, such as monkeys, apes, chimpanzees, cats, dogs, cows, horses, mice, rats, rabbits and humans (including adults and children).

[0094] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0095] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0096] The construction method of recombinant measles virus is summarized as follows:

[0097] Reverse genetics systems used to rescue measles viruses include:

[0098] (1) Helper plasmid 1 (pCAGGS-N) containing the gene encoding the nucleocapsid protein of measles virus (the nucleotide sequence of which is shown in SEQ ID NO: 2);

[0099] (2) Helper plasmid 2 (pCAGGS-P) containing the gene encoding the phosphoprotein of measles virus (the nucleotide sequence of which is shown in SEQ ID NO: 3);

[0100] (3) Helper plasmid 3 (pCAGGS-L) containing the gene encoding measles virus RNA polymerase (the nucleotide sequence of which is shown in SEQ ID NO: 7);

[0101] (4) pGFMV-MARV GP Recombinant measles virus plasmid; pGFMV-EBOV GP +MARV GP Recombinant measles virus plasmid.

[0102] The measles virus is the attenuated measles vaccine strain Schwarz, and the transcription plasmid containing the full-length measles antigenome is the plasmid pGFMV containing the full-length measles antigenome schwarz Among them, pGFMV schwarz Plasmid map reference Fig.13 shown.

[0103] Example 1

[0104] This example provides a method for constructing pGFMV-MARV GP Recombinant measles virus plasmid and pGFMV-EBOV GP +MARV GP Method for constructing recombinant measles virus plasmid.

[0105] (1) Design primers: Using the plasmid containing the target gene EBOV-GP / MARV-GP as a template, PCR was used to amplify the target DNA fragments I, II, and III. The DNA fragment I contained some bases in the non-coding region of the 3' end of PacI, the Marburg virus glycoprotein MARV-GP, and some bases in the non-coding region of the 5' end of MluI. The primers used for amplification were MARV-PACI-F and MARV-MLUI-R. DNA fragment II contained some bases in the non-coding region of the 3' end of PacI, the Ebola virus glycoprotein EBOV-GP, and some bases in the P2A sequence; the primer sequences used were EBOV-PACI-F, EBOV-G-P2A-R; DNA fragment III contained some bases in the P2A sequence, the Marburg virus glycoprotein MARV-GP, and some bases in the non-coding region of the 5' end of MluI. The primer sequences used were P2A-MARV-OF, MARV-MLUI-R.

[0106] (2) Design primers. The primer sequences are Reapeat-enzyme-F and Reapeat-enzyme-R, respectively. The T-F1 plasmid is used as a template ( Fig.14 ); The vector was linearized by PCR amplification, and the two ends of the linearized vector were PacI 3' end and MluI 5' end respectively;

[0107] (3) Design primers, using the above-mentioned DNA fragment II and DNA fragment III as templates, and obtain fragment IV by Overlap PCR amplification. This DNA fragment contains part of the bases of the non-coding region of the 3' end of PacI, the Ebola virus glycoprotein EBOV-GP, the P2A sequence, the Marburg virus glycoprotein MARV-GP, and part of the bases of the non-coding region of the 5' end of MluI;

[0108] (4) The DNA fragment I described in (1) and the DNA fragment IV described in (3) were respectively combined with the linearized vector described in (2) using seamless cloning technology to obtain intermediate plasmids, namely T-MARV GP , T-EBOV GP +MARV GP .

[0109] (5) Design primers to amplify the measles virus plasmid pGFMV Schawarz The plasmid was linearized into three fragments using PCR as a template, namely pGFMV Schawarz -1(AaTII-F and PGF-R), pGFMV Schawarz -2 (PGF-F and LR), pGFMV Schawarz -3 (LF and PflFI-R).

[0110] (6) Design primers (AaTII-RE-F, PflFI-RE-R) to the intermediate plasmid T-MARV described in (4) GP， T-EBOV GP +MARV GP As a template, PCR amplification technology was used to obtain the DNA fragment containing the target MARV-GP and the DNA fragment EBOV GP +MARV GP The above DNA fragment includes partial nucleotides of measles virus N gene, EBOV-GP and partial genes of measles virus P gene.

[0111] (7) The three fragments of (5) and the two DNA fragments of (6) (the DNA fragment containing the target MARV-GP and the DNA fragment EBOV GP +MARV GP ) The measles recombinant virus plasmid pGFMV-MARV was obtained by recombining the four fragments through seamless cloning technology. GP, pGFMV-EBOV GP +MARV GP . Construct plasmid map as Figure 1 and Figure 2 shown.

[0112] The measles virus plasmid and the recombinant measles virus plasmid constructed based on the above description were identified by enzyme digestion. The XhoI restriction endonuclease was selected to digest 0.5 μg of the plasmid. The band sizes were consistent, such as Figure 3 shown.

[0113] Table 1: Primers for constructing intermediate plasmids for recombinant measles virus

[0114]

[0115] Table 2 List of primers for constructing intermediate plasmids of recombinant measles virus

[0116]

[0117] Example 2

[0118] Rescue of measles virus and recombinant virus vaccine strains.

[0119] The three helper plasmids expressing measles virus N / P / L and the three vectors pGFMV constructed above were schwarz / pGFMV-MARV GP / pGFMV-EBOV GP +MARV GP , and transfected into BSR-T7 cells using Lipofectamine2000. The specific experimental methods are as follows:

[0120] Transfection: Helper BSR-T7 cells were seeded in six-well plates, with 5×10 5 The cells were cultured in DMEM + 10% FBS at 37°C in a cell culture incubator containing 5% CO2 overnight. On the day of transfection, the medium was changed and culture was continued with fresh DMEM medium containing 10% FBS. When the cell confluence reached 70-80%, each transfection well was given a measles virus plasmid pGFMV. schwarz / / pGFMV-MARV GP / pGFMV-EBOV GP +MARV GP 4μg, auxiliary plasmid 1 2.5μg, auxiliary plasmid 2 1.5μg, auxiliary plasmid 3 0.8μg, all added to 300μl OPTI-MEM, mixed evenly, and placed at room temperature for 5min. Take 14μL liposomes and dilute them with 300μL OPTI-MEM culture medium and place at room temperature for 5min. Mix the two evenly and place at room temperature for 20min. The cells showed lesions, and the supernatant was collected for WB detection, and the expression of measles virus N protein could be detected. Prove that measles virus was successfully rescued. The cell culture flask was placed in a -80℃ ultra-low temperature refrigerator and repeatedly frozen and thawed 3 times, the culture medium and cell mixture were collected, and the cell and supernatant mixture was added to Vero-E6 cells, passaged, and expanded to culture and rescue the obtained measles virus and recombinant measles virus vaccine strain. The rescued measles virus or recombinant virus vaccine strain expressing Vero-E6 cells was observed to show obvious measles-induced specific cytopathic effects. The frozen and thawed cells were collected from the cell culture flask and centrifuged at 3000g in a low-temperature high-speed centrifuge for 10-15 minutes. The supernatant of the cell lysate was collected, a portion of which was used to continue infecting the Vero cells that had grown throughout the culture flask and continued to be passaged, and a portion of the supernatant was frozen in a -80 degree ultra-low temperature refrigerator for storage for later use.

[0121] Example 3

[0122] Identification and titer determination of purified samples of recombinant measles virus vector vaccine strains

[0123] 1. Stability evaluation of recombinant measles virus

[0124] Measles virus and recombinant measles virus were propagated for 10 generations, and viruses were collected in each generation. RNA was extracted from cell lysates using a nucleic acid extractor according to the instructions of the DNA / RNA extraction kit of Novezan. RT-PCR detection: RNA extracted in the above steps was used as a template, and the reverse transcription kit HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) of Novezan was used to reverse transcribe the genomic RNA into cDNA using random primers according to the instructions.

[0125] Primers were designed, and the cDNA in the above step was used as a template to obtain fragments I, II, and III by PCR amplification. DNA fragment I amplified the nucleotides (MNF and MNR) of the measles virus N gene; DNA fragment II amplified the nucleotides (EBOV-GP-F and EBOV-GP-R) of the Ebola virus glycoprotein EBOV-GP gene;

[0126] MNF ATGGCCACACTTTTAAGGAG MNR CTAGTCTAGAAGATTTCTGTC EVP40-F atgaggcgggttatattgc EVP40-R ttacttctcaatcacagctgg EBOV-GP-F atgggcgttacaggaatattg EBOV-GP-R TTAaaagacaaatttgcatatacag MARV-GP-F atgaagaccacatgtttccttatc MARV-GP-R ttatccgatatatttagtaaagatac

[0127] 2.WB detection

[0128] Vero-E6 cells were infected with measles virus and recombinant measles virus at MOI=1. Cells were collected 48 hours after infection for Western blot detection. The detected proteins included measles virus N protein, Ebola glycoprotein EBOV-GP, Marburg glycoprotein EBOV-GP, and internal reference protein GAPDH. Figure 5 Shown, from left to right, 1: Recombinant measles virus MV-MARV GP Infected cell sample 2: recombinant measles virus MV-EBOV GP +MARV GP infected cell sample; 3 (NC): blank cell sample.

[0129] Figure 5 The results showed that the expression of measles virus N protein could be detected in all recombinant measles virus infected samples. GP ,MV-EBOV GP +MARV GP The expression of Marburg virus protective antigen MARV-GP was detected in infected cells, and MV-EBOV GP +MARV GP The expression of Ebola virus protective antigen EBOV-GP can be detected in infected cells.

[0130] 3. Cell Immunofluorescence Detection

[0131] Fixation: Vero-E6 cells were infected with measles virus and recombinant measles virus at MOI=1. 48 hours after infection, the samples were fixed in 4% paraformaldehyde at room temperature for 15-20 minutes, and washed with PBS 3 times, 5 minutes each time.

[0132] Permeabilization and blocking: The permeabilization solution was prepared with 0.5% Triton X-100 in PBS buffer, and the cell samples were covered with the permeabilization solution and placed on ice for 10 minutes. Wash with PBS 3 times, 5 minutes each time.

[0133] Blocking: The blocking solution was PBS buffer with 2% FBS. Block at 37°C for 1 hour.

[0134] Primary antibody incubation: Dilute the primary antibody with blocking solution according to the recommended dosage in the instruction manual, dilute EBOV-GP antibody at a ratio of 1:500, and dilute MARV-GP antibody at a ratio of 1:100, and incubate with cells at 37°C in the dark for 2 hours. Wash with PBS 3 times, 5 minutes each time.

[0135] Secondary antibody incubation: Dilute the fluorescent labeled secondary antibody with blocking solution according to the recommended dosage in the instruction manual. The Alexa Fluor 488 / Alexa Fluor 568 conjugates in this experiment were diluted at a ratio of 1:1000. The antibody and cells were incubated at 37°C in the dark for 1 hour. Wash with PBS 3 times, 5 minutes each time.

[0136] Nuclear staining: Use DAPI diluted in PBS to 1 μg / mL, incubate the cells with the staining solution at room temperature in the dark for 10 minutes, and wash twice with PBS, 5 minutes each time.

[0137] Observation and analysis: Use an inverted fluorescence microscope to observe the distribution of fluorescence and imaging observation. Figure 6 As shown. In MV-MARV GP The expression of MARV-GP can be detected in infected cells. GP +MARV GP The expression of EBOV-GP and MARV-GP could be detected in infected cells.

[0138] 3. Titer Determination

[0139] IFA was used to determine the titer of recombinant measles virus. The specific method is as follows:

[0140] Here are the steps:

[0141] 1) Vero-E6 cells were seeded in a 24-well plate at a density of 2*10^5 / ml, and titers were measured when the cells grew into a monolayer and the cell confluence reached 80%-90%, so as to ensure that the cells fully grew the monolayer when measuring the titer.

[0142] 2) The obtained measles virus sample or recombinant measles virus sample was diluted 10 times in a gradient, with a total of 8 dilution gradients. The cell supernatant was aspirated and 500ul of the virus dilution solution was added to the cells. Two duplicate wells were made for each dilution. After two hours of infection, the virus liquid was discarded and added to DMEM containing 5% FBS and 1% methylcellulose, and cultured at 32°C for 6 days.

[0143] 3) Add 4% paraformaldehyde to the cells at a dose of 500ul per well and fix at room temperature for 30 minutes. Wash the cells three times with PBS, add 500ul 2% Triton-X100 to each well, place on ice for 15 minutes for permeabilization, and then wash the cells three times with PBS.

[0144] 4) Antibody Measles-N was diluted with 1% BSA in PBS at a dilution ratio of 1:500, and 200ul of the diluted antibody was added to each well and incubated at 37°C for 1 hour;

[0145] 5) Aspirate the antibody, wash the cells three times with PBS, add 0.25 mL of Alex-488 labeled Rat Anti-Mouse Antibody (1:100 dilution) to each well, and incubate at 37°C for 1 hour;

[0146] h) Aspirate and discard the Rat Anti-Mouse Antibody dilution solution, wash the cells three times with PBS, and count the green fluorophore under a fluorescence microscope.

[0147] The titer determination results showed that the recombinant measles virus infection titer reached 5*10 5 FFU / mL, and then the virus titer was increased to 5*10 by virus concentration. 6 FFU / mL to meet the experimental requirements.

[0148] Example 4

[0149] In this example, the measles virus-based Marburg virus disease vaccine and the Marburg virus and Ebola virus disease vaccines were immunologically evaluated in a mouse model.

[0150] 1. Experimental materials.

[0151] 1.1 Experimental animals

[0152] SPF female BALB / c mice (4-6 weeks old) were purchased from Vital River. Mice were raised at the Animal Center of Wuhan Institute of Virology, Chinese Academy of Sciences.

[0153] 1.2 Experimental Materials

[0154] Fluorescently labeled antibodies FITC Hamster Anti-Mouse CD3e (145-2C11), PerCP-Cy5.5 Rat Anti-Mouse CD8a (53-6.7), BV421 Rat Anti-Mouse CD4 (GK1.5), Rat Anti-Mouse IFN-γ (XMG1.2); Cytofix / CytopermTM Fixation and Permeabilizaiton Solution, Perm / WashTM Buffer, BDTM ELISPOT set, BDTM ELISPOTAEC substrate set and blocking agent were purchased from BD Pharmingen; red blood cell lysis buffer was purchased from Solebol; RPMI1640 culture medium was purchased from Gibco; BSA was purchased from Merck; HRP-labeled anti-mouse IgG antibody was purchased from Proteintec; truncated secretory GP was purified in this laboratory.

[0155] 2. Immunization of mice.

[0156] According to the experimental design, the purified recombinant measles virus Marburg vaccine (MV-MARV GP ), recombinant measles virus Marburg Ebola vaccine (MV-EBOV GP +MARV GP ) and the recombinant measles virus vector control vaccine (MV-Schwarz) were diluted with saline to an infection titer of 2×10 6 FFU / mL, 50 μL per mouse was injected into the inner muscle of the left hind leg using a 1 mL syringe, and the immunization dose per mouse was 1×10 5 FFU. The mice were immunized and grouped as follows:

[0157] Mouse immunization group list

[0158] Immunization group Immunization dose Number of mice MV-Schwarz <![CDATA[1×10 5 TCID 50 ]]> 5 <![CDATA[MV-MARV GP ]]> <![CDATA[1×10 5 TCID 50 ]]> 5 <![CDATA[MV-EBOV GP +MARV GP ]]> <![CDATA[1×10 5 TCID 50 ]]> 5

[0159] 3. Detection of humoral immunity level.

[0160] 3.1 Blood collection and serum separation

[0161] After the mice are immunized, blood is collected from the tail vein at a specific time point. The blood is left to stand at room temperature for more than 1 hour. After the serum is formed, it is centrifuged at 5000 rpm for 10 minutes, and the serum is transferred to a new centrifuge tube and frozen at -20°C for later use.

[0162] 3.2 ELISA test for serum antibody levels

[0163] One day before the experiment, the ELISA strips were coated with truncated secretory MARV-GP or EBOV-GP polypeptides at a concentration of 4 μg / mL and placed overnight at 4° C. On the day of the experiment, the liquid in the wells was discarded and washed three times with ELISA washing solution (PBS+1% Tween 20).

[0164] Discard the washing solution, tap the liquid in the wells on clean absorbent paper, add 120μL 2% BSA to each well, and block at 37°C for 1 hour. Discard the blocking solution, wash the plate 3 times, and add 100μL sample diluent (PBST + 0.2% BSA) to each well. Serum samples are diluted in multiples at a specific initial dilution (the initial dilution is determined by preliminary experiments), and 7 dilutions are set for each sample. After the serum is diluted, it is added to the ELISA plate coated with a specific antigen and incubated at 37°C for 1 hour.

[0165] The ELISA plate was washed 4 times with washing solution, and 100 μL of HRP-conjugated anti-mouse IgG secondary antibody (1:10000) was added to each well and incubated at 37°C for 1 hour. The plate was washed 4 times with washing solution, and the liquid in the wells was shaken off for color development reaction.

[0166] The color development process is to add a single-component TMB color development solution to each well, and stop the reaction with ELISA stop solution after 15 minutes of color development. Finally, the absorbance value at 450nm is detected on an ELISA reader.

[0167] The wells with OD450 in the sample greater than 2.1 times the reading of the blank well were set as positive wells. The dilution multiple of the positive well with the largest dilution in each serum sample was recorded as the antibody titer of this sample.

[0168] Test results such as Figure 7 As shown, the recombinant measles virus MV-MARV was detected by ELISA GP and MV-EBOV GP +MARV GP All of them were able to produce high levels of MARV-GP-specific antibodies in a short period of time, and the binding antibody trends were consistent. They also had a high humoral immune effect within 28 days.

[0169] 3.2 Detection of serum neutralizing antibody levels (pseudovirus neutralization experiment - methods and results)

[0170] (1) One day in advance, Vero cells were passaged into 96-well cell culture plates at a cell density of 1*10 5 / ml, and the cells grew into a monolayer on the next day.

[0171] (2) On the day of the experiment, dilute the serum: dilute the sample with serum-free medium at a ratio of 1:10, and then select a 4-fold gradient dilution for a total of 7 concentrations, with 3 replicates for each dilution. Set the cell wells without serum or virus as the negative control, and the cell wells without serum and only virus as the positive control.

[0172] (3) Take out the pseudovirus rVSV-EBOV / HIV-MARV with known titer and melt it according to 1000TCID 50 / well, calculate the total required virus suspension according to the volume of 50ul / well, add the virus dilution to the diluted serum at a dose of 50ul / well, mix evenly and incubate at 37℃ for 1h.

[0173] (4) Take out the mixture of incubated virus and diluted serum. Discard the cell supernatant, wash the cells once with 100ul / well of PBS, and then add the mixture to the cells at a dose of 100ul / well. Mix evenly and incubate at 37°C for 1h. Discard the supernatant, replace with 2% FBSDMEM cell culture medium, and continue to culture in a 37°C incubator.

[0174] (5) After incubation at 37°C for about 48 h, rVSV-EBOV was used to measure the level of neutralizing antibodies against EBOV-GP and then fixed. The supernatant was discarded, and 10% formaldehyde was added twice the volume / well. The cells were fixed at room temperature for 30 min, the formaldehyde was discarded, and the cells were rinsed with tap water. After staining with DAPI at room temperature for 15 min, the high content was scanned to determine the percentage of fluorescence and then data was sorted and analyzed.

[0175] (6) Determination of MARV neutralizing antibody level using HIV-MARV After the cells were lysed, the level of neutralizing antibodies was comprehensively analyzed by detecting the expression level of fluorescein.

[0176] The results are as follows Figure 8 As shown, MV-EBOV was detected by pseudovirus neutralization assay 28 days after immunization GP +MARV GP The vaccine group was able to produce high titers of neutralizing antibodies against rVSV-EBOV, and the pseudovirus HIV-MARV detected the recombinant measles virus MV-MARV GP and MV-EBOV GP +MARV GP All of them were able to produce high levels of MARV-GP-specific neutralizing antibodies, and there was no significant difference in the neutralizing antibody levels between the two groups.

[0177] 4. Detection of cellular immunity level.

[0178] 4.1 Isolation of splenic lymphocytes

[0179] The mice were killed by cervical dislocation and soaked in 70% alcohol for 3 minutes. The spleen of the mouse was aseptically removed in the biosafety cabinet and placed on a 200-mesh cell sieve placed in a sterile plate. 10 mL of RPMI1640 complete medium was added, and the spleen was gently ground into single cells using the piston of a syringe. The spleen cell suspension was transferred to a 15 mL centrifuge tube and centrifuged at 800 g for 5 minutes at 4 ° C. The supernatant was discarded, and the cells were resuspended in 2 mL of Solebol red blood cell lysis buffer, lysed at room temperature for 5 minutes, and 13 mL of RPMI1640 complete medium was added, and centrifuged at 500 g for 5 minutes at 4 ° C. The supernatant was discarded, and the cells were washed once with 10 mL of RPMI1640 complete medium, resuspended with an appropriate amount of medium, filtered through a 200-mesh cell sieve into a 10 mL test tube, and 50 μL was taken and diluted 20 times for counting and set aside.

[0180] 4.2 Flow cytometry was used to detect the secretion of specific cytokines.

[0181] 4.2.1 In vitro stimulation of mouse splenocytes

[0182] Dilute the mouse spleen cells isolated above to 1×10 7 cells / mL, 0.1mL was added to each well of a 96-well plate. The spleen cells of each mouse were set up with specific CTL epitope stimulation wells and non-stimulation wells. The peptides used for specific CTL epitope stimulation were EBOV-GP and MARV-GP. As a positive control, PMA and ionomycin were added to the stimulation wells, where the PMA concentration was 100ng / mL and the ionomycin concentration was 1μg / mL.

[0183] After the cells were cultured in a 37°C, 5% CO2 incubator for 12 hours, they were stained for relevant antigens and used for flow cytometry detection of intracellular cytokines.

[0184] 4.2.2 Staining of cell surface antigens and intracellular cytokines

[0185] After 6 hours of in vitro stimulation, spleen cells were transferred to flow cytometry tubes and centrifuged at 4°C, 500g for 5 minutes, and the supernatant was discarded. Centrifuge at 4°C, 500g for 5 minutes, and the supernatant was discarded. Dilute the appropriate amount of fluorescent labeled antibodies FITC Hamster Anti-Mouse CD3, PerCP-Cy5.5 Rat Anti-Mouse CD8, and BV421 Rat Anti-Mouse CD4 with PBS + 2% FBS according to the recommended usage in the instructions, and place at 4°C for 30 minutes. After 30 minutes, add 3mL PBS + 2% FBS to each tube, centrifuge at 4°C, 500g for 5 minutes, and discard the supernatant. Add Cytofix / CytopermTM Fixation and PermeabilizaitonSolution according to the recommended amount in the instructions, and place at 4°C for 20 minutes to fix and perforate the cells. After 20 minutes, add 1×Perm / WashTMBuffer, centrifuge at 4°C, 600g for 5 minutes, and discard the supernatant. Use 1×Perm / WashTM Buffer to dilute the appropriate amount of BV786 Rat Anti-Mouse IFN-γ antibody according to the recommended usage in the manual, mix gently, and place at 4°C for 30 minutes. Finally, wash each tube once with 1mL1×Perm / WashTM Buffer and 3mL of PBS, discard the supernatant and resuspend with 200μL PBS, and detect on the machine. In order to adjust the fluorescence compensation between the dyes during the detection, set up unstained tubes, single-stained FITC Hamster Anti-Mouse CD3 tubes, single-stained PerCP-Cy5.5 Rat Anti-Mouse CD8 tubes, single-stained BV421 Rat Anti-Mouse CD4 tubes and single-stained BV786 Rat Anti-Mouse IFN-γ tubes. The BV786 Rat Anti-Mouse IFN-γ single-stained tube is treated with the positive stimulator PMA (phorbol ester, protein kinase C activator). The cell detection results are as follows: Figure 8 shown.

[0186] 4.2.3 On-machine testing

[0187] BD was used for flow cytometry. First, the voltage was adjusted appropriately, and the fluorescence compensation between each dye was adjusted using a single fluorescent staining sample, and then the sample was loaded. Lymphocytes were circled by FSC and SSC and set as gate 1. From the cells coming out of gate 1, CD3 cells were circled by FITC and SSC and set as gate 2. From the cells coming out of gate 2, PerCP-Cy5.5 and BV421 were used to set gates 3 and 4, and CD8 was analyzed by BV786 and PerCP-Cy5.5. +The percentage of IFN-γ positive cells in total T cells (CD3 cells) was analyzed by BV786 and BV421. + The percentage of IFN-γ positive cells in the total T cells (CD3 cells) was analyzed using FlowJo flow cytometry software.

[0188] like Fig. 9 The results showed that at 2 weeks and 22 weeks after immunization, the level of IFN-γ secreted by CD8 positive cells and CD4 positive cells of spleen cells of mice immunized with recombinant measles virus Ebola vaccine was significantly higher than that of control vaccine group. GP and MV-EBOV GP +MARV GP There was no statistical difference in the secretion level of IFN-γ between the two recombinant measles virus Ebola vaccines.

[0189] 4.3 ELISPOT detection of cytokines

[0190] The ELISPOT plate was coated with 5 μg / mL anti-mouse IFN-γ antibody and placed at 4°C overnight. Before the experiment, the plate was blocked with RPMI1640+10% FBS medium at room temperature for 2 hours. During the experiment, the blocking solution was discarded and 100 μL of RPMI1640+10% FBS medium containing EBOV-GP / MARV-GP peptide mixture was added to each well. According to the design, 100 μL of isolated mouse spleen cells were added to each well, and the cell concentration was 2×10 6cells / mL. 50ng / mL of PMA was added to each well of the positive control well, and a non-stimulation control was set up at the same time. The cells were cultured in a 37°C, 5% CO2 incubator for 18-24 hours. The next day, the cells in the plate were discarded, and each well was washed twice with 200μL of distilled water, and then washed three times with washing solution PBS+0.1% Tween-20, each time for 2-3 minutes. The washing solution in the plate was discarded, and 100μL of Biotinylated anti-mouse IFN-γ diluted 1:250 in PBS+10% FBS was added to each well, and it was left at room temperature for 2 hours. After 2 hours, the liquid in the well was discarded, and the well was washed three times with washing solution, each time for 2-3 minutes, and 100μL of streptavidin-horseradish peroxidase diluted 1:100 in PBS+10% FBS was added to each well, and it was left at room temperature for 1 hour. The liquid in the well was discarded, and the well was washed four times with washing solution, and then washed three times with PBS. The color reaction was performed using BD ELISPOT AEC substrate set. When the spots in the wells grow to a suitable size, discard the color substrate and rinse with a large amount of distilled water to terminate the reaction. Dry the plate and count the spots using the enzyme-linked spot imaging analysis system.

[0191] The experimental data are collated as follows Fig.10 As shown, MV-MARV GP and MV-EBOV GP +MARV GP The amount of IFN-γ secreted by spleen cells of mice immunized with the vaccine group was significantly higher than that of the control vaccine group. + MV-MARV GP The amount of IFN-γ in MV-EBOV was significantly higher than that in MV-EBOV GP +MARV GP From CD8 + There was no significant difference in the proportion of cells secreting IFN-γ in cells and EliSpot, and both vaccines can stimulate strong antigen-specific cellular immunity.

[0192] Example 5

[0193] According to the experimental design, the recombinant measles virus and measles virus vector control vaccines were diluted with OPTI-MEM to the appropriate infection titer, and 100 μL was injected intraperitoneally using a 1mL syringe. The challenge protection test was performed 4 weeks after the mice were immunized to evaluate the effectiveness of the vaccine, and the weight changes, survival of the mice after the challenge, and the clearance of the virus in the tissues of the mice in each immunized group after infection were continuously monitored. The mouse groups set up to evaluate the effectiveness of the recombinant measles virus vaccine against Ebola virus using rVSV-MARV, MA-EBOV (Ebola virus mouse-adapted strain) are as follows:

[0194] Mouse challenge group list:

[0195] MA-EBOV challenge in mice

[0196] Immunization group Immunization dose MV-Schwarz <![CDATA[1×10 6 TCID 50 ]]> <![CDATA[MV-EBOV GP +MARV GP ]]> <![CDATA[1×10 6 TCID 50 60]]>

[0197] rVSV-MARV challenge in mice

[0198]

[0199]

[0200] Body weight changes and survival curves of mice challenged with MA-EBOV Fig.11 The weight changes and survival curves of mice challenged with rVSV-MARV are shown in Fig.12 Both vaccine strains can achieve 100% effective protection. The experimental results are consistent with the idea that a single-shot vaccine can provide simultaneous protection against multiple pathogens.

[0201] In summary, the present invention provides a novel measles virus vector-based vaccine targeting both Ebola virus and Marburg virus, which has broad spectrum and high efficacy and can provide effective protective measures against possible Ebola epidemics in the future.

[0202] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A recombinant measles virus vector expressing Marburg virus protein, characterized in that: It includes: The negative-strand RNA coding sequence of Marburg virus glycoprotein GP is inserted into the measles virus vector, and the negative-strand RNA coding sequence of Marburg virus glycoprotein GP is shown in SEQ ID NO:

1.

2. The recombinant measles virus vector expressing Marburg virus and Ebola virus glycoprotein according to claim 1, characterized in that: The measles virus vector also includes complementary sequences of the P gene, the M gene, the H gene and the L gene, and the negative-strand RNA coding sequence of the Marburg virus glycoprotein GP is located in the non-coding region between the P gene and the M gene; the negative-strand RNA coding sequence of the Marburg virus protein glycoprotein GP is shown in SEQ ID NO: 1; Preferably, the structure of the measles virus vector includes: 5'-N gene complementary sequence-P gene complementary sequence-Marburg virus glycoprotein GP negative strand RNA coding sequence-M gene complementary sequence-F gene complementary sequence-H gene complementary sequence-L gene complementary sequence; Preferably, the N gene, P gene, M gene, F gene, H gene and L gene on the measles virus are all from an attenuated measles virus strain, the attenuated measles virus strain is Schwarz, and the Genebank number is AF266291.1; Preferably, the N gene complementary sequence, the P gene complementary sequence, the M gene complementary sequence, the F gene complementary sequence, the H gene complementary sequence and the L gene complementary sequence are shown in SEQ ID NOs: 2-7, respectively; Preferably, the measles virus vector further comprises at least one of the following regulatory elements: a transcription promoter, a termination sequence, an enhancer and other cis-acting elements.

3. A recombinant measles virus vector expressing Ebola virus protein and Marburg virus protein, characterized in that: It includes: The negative-strand RNA coding sequence of Ebola virus glycoprotein GP and the negative-strand RNA coding sequence of Marburg virus glycoprotein GP are inserted into the measles virus vector. The negative-strand RNA coding sequences of Marburg virus and Ebola virus glycoprotein GP are as shown in SEQ ID NO: 1, and the negative-strand RNA coding sequence of Ebola virus glycoprotein GP is as shown in SEQ ID NO:

8.

4. The recombinant measles virus vector expressing Ebola virus protein and Marburg virus protein according to claim 3, characterized in that: The measles virus vector also includes an N gene complementary sequence, a P gene complementary sequence, an M gene complementary sequence, an F gene complementary sequence, an H gene complementary sequence and an L gene complementary sequence, the negative-strand RNA coding sequence of the Marburg virus protein glycoprotein GP and the negative-strand RNA coding sequence of the Ebola virus glycoprotein GP are both located in the non-coding region between the P gene and the M gene, and a self-cleaving protein gene is connected between the negative-strand RNA coding sequence of the Marburg virus glycoprotein GP and the negative-strand RNA coding sequence of the Ebola virus glycoprotein GP; Preferably, the self-cleaving protein is selected from T2A, P2A, E2A, F2A or a combination thereof, more preferably, the self-cleaving protein is P2A; Preferably, the structure of the measles virus vector includes: 5'-N gene complementary sequence-P gene complementary sequence-Ebola virus glycoprotein GP negative strand RNA coding sequence-self-cleavage protein gene-Marburg virus protein glycoprotein GP negative strand RNA coding sequence-M gene complementary sequence-F gene complementary sequence-H gene complementary sequence-L gene complementary sequence; Preferably, the N gene, P gene, M gene, F gene, H gene and L gene on the measles virus are all from an attenuated measles virus strain, the attenuated measles virus strain is Schwarz, and the Genebank number is AF266291.1; Preferably, the N gene complementary sequence, the P gene complementary sequence, the M gene complementary sequence, the F gene complementary sequence, the H gene complementary sequence and the L gene complementary sequence are shown in SEQ ID NOs: 2-7, respectively; Preferably, the measles virus vector further comprises at least one of the following regulatory elements: a transcription promoter, a termination sequence, an enhancer and other cis-acting elements.

5. A nucleic acid molecule, characterized in that It includes any one of the following (1)-(2): (1) the negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP in the recombinant measles virus vector according to any one of claims 1 to 2 is operably linked to a cDNA sequence encoding the negative-strand RNA of the measles virus antigenome; (2) The negative-strand RNA coding sequence of Marburg virus protein glycoprotein GP and the negative-strand RNA coding sequence of Ebola virus glycoprotein GP in the recombinant measles virus vector described in any one of claims 3 to 4 are operably linked to a cDNA sequence encoding the negative-strand RNA of the measles virus antigenome.

6. A reverse genetics system for rescuing a recombinant measles virus vector expressing Marburg virus protein, characterized in that: It comprises: a) an antigen expression plasmid, which comprises the nucleic acid molecule described in claim 5; b) an auxiliary plasmid 1 comprising a measles virus nucleocapsid protein coding sequence; c) an auxiliary plasmid 2 comprising a measles virus phosphoprotein coding sequence; and d) an auxiliary plasmid 3 comprising a measles virus RNA polymerase coding sequence.

7. The reverse genetics system according to claim 6, characterized in that wherein the antigen expression plasmid is a eukaryotic expression plasmid; Preferably, the antigen expression plasmid is an animal-to-animal shuttle plasmid; Preferably, the antigen expression plasmid and auxiliary plasmids 1-3 are plasmids containing T7 promoter.

8. A method for preparing recombinant measles virus particles, characterized in that: This includes any of the following methods: Method 1: co-transfecting the plasmid in the reverse genetics system according to any one of claims 6 to 7 into the first cell line; Mode 2: Transfect the antigen expression plasmid in the reverse genetics system as described in any one of claims 6 to 7 into a helper cell line.

9. The method for preparing recombinant measles virus particles according to claim 8, characterized in that: The method further comprises: collecting the cell supernatant after transfection, infecting a second cell line and culturing it; Preferably, the cell supernatant is collected and purified to obtain recombinant measles virus particles expressing Marburg virus protein, or expressing Ebola virus protein and Marburg virus protein; Preferably, the mass ratio of the antigen expression plasmid to the auxiliary plasmid 1, auxiliary plasmid 2 and auxiliary plasmid 3 is: 4-4.1:2.5-2.6:1.5-1.6:0.8-1; Preferably, the first cell line is BSR-T7 cells, and the second cell line is Vero cell line.

10. A recombinant measles virus particle, characterized in that: Obtained by the method according to any one of claims 8-9.

11. A host cell, characterized in that The method is obtained by transfecting cells with the nucleic acid molecule according to claim 5, the recombinant measles virus vector according to any one of claims 1 to 2, or the recombinant measles virus vector according to any one of claims 3 to 4.

12. A composition, characterized in that It comprises the recombinant measles virus particle according to claim 10, and a pharmaceutically acceptable carrier; Preferably, the composition is a vaccine composition.

13. Use of the recombinant measles virus particle according to claim 10 or the composition according to claim 12 in the preparation of a medicament or vaccine for preventing and / or treating Ebola virus infection and / or Marburg virus infection; Preferably, the subject is a human.

Images