Application of Fads gene in regulating the yield of erythritol produced by Yarrowia lipolytica fermentation
By knocking out or knocking down the Fads gene in yeast cells, using sgRNA and editing vectors targeting knocking out the Fads gene, the problem of low erythritol production in traditional yeast fermentation was solved, and a significant increase in erythritol production was achieved.
Patent Information
- Application Number
- CN202510323084.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-19
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-03-19
AI Technical Summary
Traditional yeast fermentation produces erythritol with lower yields and higher production costs, which limits the large-scale production and wider application of erythritol.
Knock out or knock down the Fads gene in yeast cells, and use sgRNA and editing vectors that target the knockout of the Fads gene to increase the yield of erythritol.
The yield of yeast erythritol was significantly improved, and the total yield of erythritol in Yarrow's lipolytica engineering strain increased by 1.67 times, and the growth rate was not affected.
Smart Images

Figure CN119824045B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to Fads the application of a gene in regulating the yield of erythritol produced by fermentation of Yarrowia lipolytica. Background Art
[0002] Erythritol is a polyol with wide applications in the food industry. It can be used as a sweetener for diabetics and consumers who do not want to eat sugar, and is applied in the processing of chocolate, chewing gum, fudge, and sponge cake. In addition to its application in the food industry, erythritol may also be widely used in the organic synthesis sector as a raw material for alkyd resins, polyesters, and polyethers, and for the production of nitroerythritol, a drug for cardiovascular and asthma diseases.
[0003] Currently, the industrial production of erythritol mainly relies on microbial fermentation, and yeast is one of the commonly used fermentation strains. However, the traditional yeast fermentation process for producing erythritol has problems such as relatively low yield and high production cost, which limit the large-scale production and wider application of erythritol. In yeast cells, multiple genes are involved in the regulation of the complex metabolic network of erythritol, and the expression and function of these genes directly or indirectly affect the synthesis efficiency of erythritol.
[0004] Fatty acid desaturase (Fads) can change the saturation of fatty acids in the yeast cell membrane, thereby regulating the fluidity and permeability of the cell membrane. Currently, there is no report in the prior art on the relationship between fatty acid desaturase (Fads) and erythritol yield. Summary of the Invention
[0005] The purpose of the present invention is to provide Fads the application of a gene in regulating the yield of erythritol produced by fermentation of Yarrowia lipolytica. Knocking out or knocking down Fads the gene can significantly increase the yield of yeast erythritol.
[0006] The present invention provides Fads the application of a gene in regulating the yield of erythritol produced by fermentation of Yarrowia lipolytica, wherein the Fads amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.1.
[0007] As a preferred embodiment, the Fads gene comprises the nucleotide sequence shown as SEQ ID NO.2 or the nucleotide sequence is shown as SEQ ID NO.2.
[0008] As a preferred embodiment, the application includes knocking out or knocking down FadsUse of gene expression level in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol yield.
[0009] The present invention also provides the use of a reagent for knocking out or knocking down Fads the gene expression level in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol yield.
[0010] As a preferred embodiment, the Yarrowia lipolytica includes Yarrowia lipolytica CICC1457.
[0011] The present invention also provides an sgRNA for targeted knockout of Fads the gene, and the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.4.
[0012] The present invention also provides an editing vector for targeted knockout of Fads the gene, and the editing vector includes the sgRNA described in the above scheme.
[0013] The present invention also provides a yeast engineering bacterium with high erythritol yield, and the yeast engineering bacterium includes the editing vector described in the above scheme.
[0014] The present invention also provides the use of the sgRNA described in the above scheme, or the editing vector described in the above scheme, or the yeast engineering bacterium described in the above scheme in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol yield.
[0015] The present invention also provides a method for increasing the yield of erythritol produced by Yarrowia lipolytica fermentation, including the following steps: inoculating the yeast engineering bacterium described in the above scheme into a fermentation medium for fermentation.
[0016] Beneficial effects: The present invention provides Fads the use of the gene in regulating the yield of erythritol produced by Yarrowia lipolytica fermentation, and the Fads amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO.1. By knocking out or knocking down the Fads gene of the present invention, the yield of yeast erythritol can be significantly increased. The results of the examples show that the Yarrowia lipolytica engineering bacterium 1k-CICC1457 strain constructed by knocking out the Fads gene of the present invention has no change in growth rate compared with the original strain CICC1457; moreover, the total erythritol yield of the Yarrowia lipolytica engineering bacterium 1k-CICC1457 strain is significantly increased, which is 1.67 times higher than that of the original strain. Description of the Drawings
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.
[0018] Figure 1 It is the erythritol production graph of the Yarrowia lipolytica production strain and the selected strain in Example 1;
[0019] Figure 2 It is the knockout vector pDuRCC- in Example 2 K - sgRNA-eGFP Plasmid construction diagram;
[0020] Figure 3 It is the agarose gel electrophoresis diagram of the digested plasmid vector pDuRCC-K in Example 2; Lane M is Marker; Lanes 1 and 2 are the PCR amplification product samples of digested pDuRCC-K;
[0021] Figure 4 It is the agarose gel electrophoresis diagram of the PCR amplification product in Example 2; Lane M is Marker; Lanes 1 to 4 are kan - sgRNA-eGFP PCR amplification product samples;
[0022] Figure 5 It is the agarose gel electrophoresis diagram of the PCR amplification of the Kan expression cassette in Example 2; Lane M is Marker; Lanes 1 and 2 are the PCR amplification product samples of kan;
[0023] Figure 6 It is the fluorescence intensity comparison graph of the fermentation of the control strain CICC1457 and the engineered strain 1k-CICC1457 at different times in Example 3;
[0024] Figure 7 It is the erythritol production graph of the fermentation of the control strain CICC1457 and the engineered strain 1k-CICC1457 in Example 4. Detailed implementation manners
[0025] The present invention provides a Fads gene in regulating the production of erythritol by Yarrowia lipolytica ( Yarrowia lipolytica ) and the application in the yield, the FadsThe amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1: MVKNVDQVDLSQVDTIASGRDVNYKVKYTSGVKMSQGAYDDKGRHISEQPFTWANWHQHINWLNFILVIALPLSSFAAAPFVSFNWKTAAFAVGYYMCTGLGITAGYHRMWAHRAYKAALPVRIILALFGGGAVEGSIRWWASSHRVHHRWTDSNKDPYDARKGFWFSHFGWMLLVPNPKNKGRTDISDLNNDWVVRLQHKYYVYVLVFMAIVLPTLVCGFGWGDWKGGLVYAGIMRYTFVQQVTFCVNSLAHWIGEQPFDDRRTPRDHALTALVTFGEGYHNFHHEFPSDYRNALIWYQYDPTKWLIWTLKQVGLAWDLQTFSQNAIEQGLVQQRQKKLDKWRNNLNWGIPIEQLPVIEFEEFQEQAKTRDLVLISGIVHDVSAFVEHHPGGKALIMSAVGKDGTAVFNGGVYRHSNAGHNLLATMRVSVIRGGMEVEVWKTAQNEKKDQNIVSDESGNRIHRAGLQATRVENPGMSGMAA. In the art, Yarrowia lipolytica is also known as Saccharomyces lipolytica. The Yarrowia lipolytica (Saccharomyces lipolytica) has rich metabolic pathways, good physiological characteristics, and is easy to genetically modify, can provide sufficient precursor substances for erythritol synthesis and secrete products efficiently; and has high safety and mature applications, can adapt to various conditions in industrial production, can effectively reduce costs and improve production efficiency.
[0026] As a preferred embodiment, the Fads
[0027] As a preferred embodiment, the application includes knocking out or knocking down Fads the application of the gene expression level in improving the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol production. After knocking out the Fads gene of Yarrowia lipolytica in the present invention, it does not affect the growth rate of Yarrowia lipolytica and can significantly increase the yield of erythritol production.
[0028] The present invention also provides the application of a reagent for knocking out or knocking down Fads the gene expression level in improving the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol production. As an embodiment, the Yarrowia lipolytica includes Yarrowia lipolytica ( Yarrowia lipolytica ) CICC1457.
[0029] The present invention also provides an sgRNA for targeted knockout of Fads the gene, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO.4: 5′-TGTAGTTGACATCTCGGCCG-3′.
[0030] The present invention also provides an editing vector for targeted knockout of Fads the gene, and the editing vector includes the sgRNA described in the above solution. As an embodiment, the editing vector further includes a Kan expression cassette and an eGFP expression cassette. In a specific embodiment of the present invention, the editing vector is inserted with a Kan expression cassette, an sgRNA expression cassette and an eGFP expression cassette; the Kan expression cassette is composed of three components, namely a TEF promoter, Kan the gene and a TEF terminator, which are sequentially connected. The nucleotide sequence of the Kan expression cassette is shown as SEQ ID NO.3 and can be used for screening positive transformants; the sgRNA expression cassette is composed of four components, namely a Candida promoter, a gRNA scaffold on the vector pDuRCC-K, an sgRNA (the targeted gene sequence is shown as SEQ ID NO.4), and a SUP4 terminator, which are sequentially connected. The nucleotide sequence of the sgRN expression cassette is shown as SEQ ID NO.5; the eGFP expression cassette is composed of three components, namely an hp4d promoter, a green fluorescent protein eGFP gene and an XPR2 terminator, which are sequentially connected. The nucleotide sequence of the eGFP expression cassette is shown as SEQ ID NO.6 and can be used for expressing fluorescent proteins for reverse screening to complete plasmid elimination.
[0031] The present invention also provides a genetically engineered yeast strain with high erythritol production. The genetically engineered yeast strain includes the editing vector described in the above solution. The genetically engineered yeast strain of the present invention uses the above editing vector to knockout the Fads gene in the yeast genome. The resulting genetically engineered yeast strain has an unaffected growth rate and can increase the erythritol production. As an embodiment, the yeast includes Yarrowia lipolytica. In a specific embodiment of the present invention, the yeast includes Yarrowia lipolytica CICC1457.
[0032] The present invention also provides the application of the sgRNA described in the above solution, the editing vector described in the above solution, or the genetically engineered yeast strain described in the above solution in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol production.
[0033] The present invention also provides a method for increasing the yield of erythritol produced by Yarrowia lipolytica fermentation, including the following steps: inoculating the genetically engineered yeast strain described in the above solution into a fermentation medium for fermentation. As a preferred embodiment, the fermentation temperature is 28-30°C; the fermentation time is 72-96 h; per liter, the components of the fermentation medium include 18-22 g / L of glucose, 18-22 g / L of peptone, 8-12 g / L of yeast extract powder, and the balance of water. In a specific embodiment of the present invention, per liter, the components of the fermentation medium are 20 g / L of glucose, 20 g / L of peptone, and 10 g / L of yeast extract powder.
[0034] To further illustrate the present invention, the following describes in detail the application of the Fads gene in regulating the yield of erythritol produced by Yarrowia lipolytica fermentation, but they should not be construed as limiting the protection scope of the present invention.
[0035] Example 1 Fads Gene discovery
[0036] (1)The production strain Yarrowia lipolytica 5-14 (published in the literature: Cui Q, Liu H, Guo C. et.al. Enhancing the erythritol production of Yarrowia lipolytica by high-throughput screening based on highly sensitive artificial sensor and anchor protein cwp2. J Ind Microbiol Biotechnol. 2024 Jan 9;51:kuae045.) is a strain that can efficiently produce erythritol for industrial production after a series of modifications. After breeding the production strain Y. lipolytica 5-14, the selected strain DXMC004-tb was obtained.
[0037] (2)The production strain Y. lipolytica 5-14 and the selected strain DXMC004-tb were respectively inoculated into YPD liquid medium and cultured in an oscillating incubator at 30 °C and 200 rpm for 24 h to obtain seed solutions.
[0038] (3)The seed solutions from step (2) were respectively transferred to a fermenter at an inoculation amount of 10% (v / v), and continuously cultured for 3 d by controlling the rotation speed and dissolved oxygen. The erythritol content in the fermentation broth was detected by HPLC. The detection results are as Figure 1 shown. HPLC detection showed that the production strain Y. lipolytica 5-14 produced 161 g / L of erythritol after 72 h of fermentation, and the selected strain DXMC004-tb produced 178 g / L of erythritol after 72 h of fermentation, with a 10.6% increase in yield.
[0039] Whole-genome sequencing and comparison of the production strain Y. lipolytica 5-14 and the selected strain DXMC004-tb showed that compared with the production strain Y. lipolytica 5-14, the Fads genes of the selected strain DXMC004-tb mutated.
[0040] Example 2 Fads Gene function verification
[0041] Construct the knockout vector pDuRCC-K- sgRNA-eGFP , and the plasmid vector construction diagram is as Figure 2 shown.
[0042] (1)Double digestion reaction of plasmid vector pDuRCC-K
[0043] Utilize Pst I and Nde I double-digest the plasmid vector pDuRCC-K. The total volume of the digestion system is 20 µL: 2.0 µL of plasmid vector pDuRCC-K, Pst I 1.0 µL, Nde I 1.0 µL, 2.0 µL of 10×Fast Digest buffer, and 14.0 µL of double-distilled water. The digestion conditions are as follows: react at 37 °C for 2 h.
[0044] After the digestion, use agarose gel electrophoresis to detect whether the digestion is successful. The identification result is as Figure 3 shown. The target band appears and is single, indicating that the plasmid vector digestion is successful.
[0045] (2)Construct the knockout component
[0046] The knockout component consists of a Kan expression cassette, an sgRNA expression cassette, and an eGFP expression cassette. Among them, the Kan expression cassette is used for screening positive transformants. The sgRNA expression cassette mainly guides the Cas9 protein to the target sequence by complementary base pairing with the Fads gene target sequence and cuts it to perform gene knockout; the eGFP expression cassette is mainly used to express fluorescent proteins for reverse screening to complete plasmid elimination.
[0047] ① Using the pDuRCC-K plasmid as a template, select the TEF promoter, KanKan Gene ( Kan resistance fragment), 1155 - 1159 bp is the linker, and 1160 - 1357 bp is the TEF terminator.
[0048] ② According to Fads the gene (SEQ ID NO.2) sequence, sgRNA was designed, and the sequence is as shown in SEQ ID NO.4: 5′-TGTAGTTGACATCTCGGCCG-3′. Four components of the Candida promoter, gRNA scaffold on the vector pDuRCC-K, the target gene sequence (sgRNA), and the SUP4 terminator were sequentially ligated to form an sgRNA expression cassette. The nucleotide sequence of the sgRNA expression cassette is as shown in SEQ ID NO.5: 5′-AGACATAAAAAACAAAAAAAGCACCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTGTAGTTGACATCTCGGCCGCAAATTAAAAATAGTTTACGCAAGTCTCGAACTTCCACCACAATTTAATTGTAAGAACGCTGCGAAAACATATTCTCCAATCCTATTGGGCCGAAGTTTCAGCTATGCCAAAGGCATCAAATTTTTTTTTATAAAATTTTCCACTTTTCCATACCAGTGAAATTATCACGTGATGGAGTGAGTATCTATAATATTTGATTGTTTCTTTGATGAGGCAATACTCGAGTATAGTTATTGACCAATGACTTTTAGC-3′. Among them, 1 - 20 bp is the SUP4 terminator, 21 - 24 bp is the linker, 25 - 99 bp is the gRNA scaffold, 100 - 119 bp is the target gene sequence, and 120 - 372 bp is the promoter.
[0049]
[0050] Entrust Nanjing Genscript Biotech Co., Ltd. to synthesize the knockout components, and connect the above three components sequentially to form kan - sgRNA-eGFP
[0051] (3) Connect the linearized vector and the knockout component
[0052] Ligate the linearized vector from step (1) and the knockout component from step (2) using T4 DNA ligase. The total volume of the ligation reaction is 10 μL: 1.0 μL of linearized plasmid, 1.0 μL of knockout component, 1.0 μL of T4 DNA Ligase, 1.0 μL of 10× Ligase Buffer, and 6.0 μL of double-distilled water. React at 16 °C for 5 h to obtain the recombinant plasmid pDuRCC- K - sgRNA-eGFP .
[0053] (4) Transformation of the recombinant plasmid pDuRCC- K - sgRNA-eGFP ① Add 10 μL of the recombinant plasmid pDuRCC-
[0054] to 100 μL of the ready-made Escherichia coli BL21 competent cells, mix gently, and incubate on ice for 30 min; heat shock at 42 °C for 45 s, and then quickly place it in an ice bath to cool for 2 min; K-sgRNA-eGFP ② Add the mixture from step ① to 900 μL of LB medium without antibiotics and recover at 37 °C for 1 h.
[0055] ③ Centrifuge the bacterial solution from step ② at 2500×g for 3 min, aspirate 900 μL of the supernatant, and resuspend to obtain the resuspended bacterial solution.
[0056] ④ Spread the resuspended bacterial solution from step ③ on LB solid medium containing 100 μg / mL kanamycin resistance and incubate overnight until normal colonies about 2 mm in size appear. At this time, the strain is E. coli BL21 (pDuRCC-
[0057] - K - sgRNA-eGFP ).
[0058] (5) Identification of positive clones:
[0059] ① Colony PCR identification
[0060] Pick a single colony cultured in step (4) into 1 mL of LB medium containing kanamycin antibiotic, shake culture at 37 °C and 200 rpm for 6 - 8 h, aspirate 2 μL of the bacterial solution, and perform colony PCR identification according to a 50 μL PCR reaction system.
[0061] Use the recombinant plasmid pDuRCC-K- sgRNA-eGFP as a template for PCR amplification. The sequences of the PCR amplification primers are as follows:
[0062] pDuRCC-F (SEQ ID NO.8): 5′-ATGGGTAAGGAAAAGACTCA-3′;
[0063] pDuRCC-R (SEQ ID NO.9): 5′-CGTCCATTCCGAGAGTGATGC-3′.
[0064] The total volume of the PCR amplification system is 50 µL: 2.0 µL of 100 µM upstream primer, 2.0 µL of 100 µM downstream primer, 2.0 µL of template, 25 µL of 5 U / µL phanta enzyme, and 19 µL of ddH2O. The PCR amplification conditions are as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, for 30 cycles; extension at 72°C for 5 min. The results of PCR identification are as Figure 4 shown. Those with the target band and a single band indicate that the colonies are positive clones.
[0065] ② Sequencing of bacterial samples
[0066] The identified positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to further prove the correctness of the constructed positive clones.
[0067] Example 3 Recombinant plasmid pDuRCC- K - sgRNA-eGFP transformed into Yarrowia lipolytica CICC1457
[0068] (1) Preparation of yeast competent cells
[0069] ① Take the glycerol frozen tube of the preserved Yarrowia lipolytica CICC 1457 (purchased from China Center for Industrial Culture Collection) and inoculate it into 10 mL of YPD liquid medium, and culture it overnight in an oscillating incubator at 30°C and 200 rpm to obtain the activated CICC1457 bacterial solution. The Yarrowia lipolytica CICC 1457 is the original strain without any modification.
[0070] ② Transfer the activated CICC1457 bacterial solution in step ① to 50 mL of 2×YPD liquid medium, with an initial OD 600 of 0.2, and culture it in an oscillating incubator at 30°C and 200 rpm until the OD 600 reaches 0.8 - 1.0.
[0071] ③ Pipette 10 mL of the bacterial solution in step ② into a 10 mL centrifuge tube, ice-bath the bacterial solution for 15 min and then centrifuge it. The centrifugation conditions are set as follows: centrifuge at 4°C and 5000 rpm for 5 min, discard the supernatant to obtain the bacterial cells, and the subsequent steps are all carried out on ice.
[0072] ④ Resuspend the cell pellet from step ③ in 5 mL of sterile 1 mol / L sorbitol solution, centrifuge at 5000 rpm for 5 min at 4°C, and discard the supernatant.
[0073] ⑤ Resuspend the cell pellet from step ④ in 5 mL of sterile 10% glycerol solution, centrifuge at 5000 rpm for 5 min at 4°C, and discard the supernatant.
[0074] ⑥ Resuspend the cell pellet from step ⑤ in 100 μL of sterile 1 mol / L sorbitol solution, aliquot 100 μL of the competent cells into 1.5 mL sterile centrifuge tubes for later use, and store at -80°C.
[0075] (2) Transformation of the recombinant plasmid
[0076] ① Take 10 μL of plasmid pDuRCC- with a concentration greater than 1000 ng / μL K-sgRNA-eGFP and add it to a 1.5 mL sterile centrifuge tube containing 100 μL of CICC1457 competent cells. Incubate on ice for 5 min, and at the same time, pre-cool a 2 mm electroporation cuvette on ice.
[0077] ② Aspirate and transfer the competent cell suspension mixed with the plasmid to the electroporation cuvette. Set the electroporation conditions as: 2.5 kV, 5 ms.
[0078] ③ Immediately after electroporation, add 900 μL of fresh sterile YPD liquid medium to the electroporation cuvette. Aspirate and transfer the cell suspension in the electroporation cuvette to a 1.5 mL sterile centrifuge tube, and incubate it in a shaking incubator at 30°C, 200 rpm for 1 h.
[0079] ④ Centrifuge at 3000 rpm for 3 min at room temperature, discard the supernatant, and wash 2 - 3 times with 1 mL of sterile water.
[0080] ⑤ Resuspend the cell pellet in 100 μL of sterile water, and then spread it on a YPD resistance screening plate supplemented with 1000 μg / mL geneticin (G418). Place the plate in a 30°C constant temperature incubator and incubate statically for 2 - 4 d until transformants grow out.
[0081] (3) Identification of positive clones
[0082] ① Colony PCR identification
[0083] Add 50 μL of 20 mM NaOH solution to a sterile 1.5 mL centrifuge tube. Pick a part of the single colonies (20) that have successfully grown on the plate and add them into the tube to resuspend. Boil for 10 min and centrifuge at 12000 rpm for 1 min.
[0084] Aspirate 1 μL of the supernatant as a template for PCR amplification. The primer sequence information used is as follows:
[0085] pDuRCC-F (SEQ ID NO.8): 5'-ATGGGTAAGGAAAAGACTCA-3';
[0086] Kan-R (SEQ ID NO.10): 5'-TTAGAAAAACTCATCGAGCA-3'.
[0087] The total volume of the PCR amplification system is 10 μL: 0.5 μL of 100 μM upstream primer, 0.5 μL of 100 μM downstream primer, 1.0 μL of template, KODOne TM PCR Master Mix polymerase 5.0 μL, ddH2O 3.0 μL.
[0088] The PCR amplification conditions are as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 56°C for 30 s, extension at 68°C for 10 s, 40 cycles; extension at 68°C for 5 min; storage at 16°C for 1 min.
[0089] The results of PCR identification are as Figure 5 shown. The results indicate that the target band appears and is single, showing that the colony is a positive clone.
[0090] ② Bacterial sample sequencing
[0091] The identified positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to further prove the correctness of the constructed positive clones, and the positive knockout strain 1k-CICC1457 was obtained.
[0092] Example 4 Fluorescence detection of the knockout strain 1k-CICC1457
[0093] (1) Bacterial strain activation: The positive knockout strain 1k-CICC1457 in Example 2 and the control strain CICC1457 were respectively inoculated into YPD liquid medium and cultured in an oscillating incubator at 30°C and 200 rpm for 24 h to obtain the activated strains of 1k-CICC1457 and CICC1457;
[0094] (2) Bacterial body transfer: The activated strains obtained in step (1) were transferred to 500 mL conical flasks containing 50 mL of liquid fermentation medium at an inoculation amount of 10% (v / v) and cultured in a shaker at 30°C and 200 rpm for 3 d.
[0095] (3) Fluorescence detection: Samples were taken every 12 h. After centrifuging 1 mL of the fermented broth to remove the supernatant, the bacterial cells were resuspended in 1 mL of sterile water, and the fluorescence intensities of the knockout strain 1k-CICC1457 and the control strain CICC1457 at 484 - 507 nm were detected using a microplate reader.
[0096] The stronger the fluorescence, the better the plasmid transformation. The identification results are as Figure 6 shown. The fluorescent protein continuously expresses in the knockout strain 1k-CICC1457 and is higher than that in the control strain, indicating that the growth of the knockout strain 1k-CICC1457 is good. Moreover, during the growth of the strains, the OD 600 values of the production strain and the knockout strain are measured respectively, and it is found that there is no significant difference between them, indicating that the growth rate and cell biomass of the knockout strain 1k-CICC1457 are not affected.
[0097] Example 5 Vector Elimination of Knockout Strain 1k-CICC1457 and Shake-Flask Fermentation for Production of Erythritol
[0098] (1) Vector elimination: The knockout strain 1k-CICC1457 obtained in Example 2 and the control strain CICC1457 are respectively inoculated into YPD liquid medium and cultured in an oscillating incubator at 30 °C and 200 rpm for 24 h, and passaged continuously for 3 times.
[0099] (2) Shake-flask fermentation: The seed liquid of 1k-CICC1457 after passage in step (1) is transferred to a 500 mL conical flask containing 50 mL of liquid fermentation medium at an inoculation amount of 10% (v / v) and cultured in a shaker at 30 °C and 200 rpm for 3 d to obtain a fermentation broth.
[0100] (3) Fermentation broth treatment: Centrifuge at 6000 rpm and 4 °C for 5 min. After centrifugation, dilute the supernatant 50 times with distilled water, filter it through a 0.22 µm filter membrane, immediately add it to a brown liquid-phase vial, and store it at -20 °C in the dark.
[0101] (4) Detection of the generated product by differential high performance liquid chromatography: Equip a Hi-Plex H (300×7.7 mm, Agilent Technologies) chromatographic column, and operate the chromatographic column at 65 °C. The mobile phase is pure water, the flow rate is 0.6 mL / min, and the injection volume is 10 µL. Prepare 5 different concentrations of erythritol standard solutions, namely 0.25 g / L, 0.5 g / L, 1.0 g / L, 2.0 g / L, 4.0 g / L, 8.0 g / L, to determine the peak elution time.
[0102] The identification results are as Figure 7 shown. Compared with the original strain, the total yield of erythritol of the engineered Yarrowia lipolytica strain 1k-CICC1457 constructed in the present invention is significantly increased, reaching 4.5 g / L, which is 1.67 times higher.
[0103] It can be seen that the knockout FadsGenes can significantly increase the production of erythritol; moreover, during the fermentation culture process of the engineered strain, there is no significant difference in the growth rate and biomass of the bacterial cells compared to the original strain.
[0104] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Use of the Fads gene in regulating the yield of erythritol produced by Yarrowia lipolytica fermentation, wherein the amino acid sequence of the protein encoded by the Fads gene is as shown in SEQ ID NO.1; the use is the application of knocking out the Fads gene or knocking down the expression level of the Fads gene in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol production.
2. The application according to claim 1, characterized in that The nucleotide sequence of the Fads gene is as shown in SEQ ID NO.
2.
3. Use of a reagent for knocking out the Fads gene or knocking down the expression level of the Fads gene in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol production; the nucleotide sequence of the Fads gene is as shown in SEQ ID NO.2; the reagent includes an sgRNA targeting the knockout of the Fads gene or an editing vector targeting the knockout of the Fads gene; the editing vector contains an sgRNA targeting the knockout of the Fads gene; the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.
4.
4. The application according to any one of claims 1 to 3, characterized in that, The Yarrowia lipolytica includes Yarrowia lipolytica CICC1457.
5. Use of a yeast engineering bacterium with high erythritol yield in increasing the yield of erythritol produced by Yarrowia lipolytica fermentation and / or cultivating Yarrowia lipolytica with high erythritol yield, characterized in that, The engineered yeast strain contains an editing vector targeting the knockout of the Fads gene; the editing vector contains an sgRNA targeting the knockout of the Fads gene; the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.
4.
6. A method for increasing the yield of erythritol produced by fermentation of Yarrowia lipolytica, characterized in that, It includes the following steps: inoculating the engineered yeast strain into a fermentation medium for fermentation; the engineered yeast strain contains an editing vector targeting the knockout of the Fads gene; the editing vector contains an sgRNA targeting the knockout of the Fads gene; the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.4.
Citation Information
Patent Citations
Oleic acid production in yeast
CN107208088A
Fermentation method for improving yield of microbial oil and nervonic acid, strain and application
CN118895210A