SNP (Single Nucleotide Polymorphism) molecular marker for identifying genetic sex of coreius fasciatus and

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying genetic sex of coreius guttatus and application thereof, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, the SNP molecular marker comprises an SNP site, and the SNP site is located at the 501st basic group at the 5'end of the SNP molecular marker. According to the method, sex identification of coreius molitor can be completed through PCR amplification and Sanger sequencing, and compared with other molecular identification methods which are tedious in operation and long in time consumption, the method is more suitable for rapid identification of large-batch coreius molitor samples. More importantly, according to the SNP locus, the sex of the coreius guichenoti can be simply and accurately identified, the coreius guichenoti does not need to be dissected, and the health condition of a detected coreius guichenoti sample is basically not influenced.

Description

Technical Field

[0001] The invention belongs to the technical field of fish sex identification, and particularly relates to a SNP molecular marker for identifying the genetic sex of copper fish and an application thereof. Background Art

[0002] Coreius heterodon (Bleeker) belongs to the genus Coreius, which belongs to the subfamily Gobioninae, family Cyprinidae, order Cypriniformes. It is commonly known as golden loach, pointed-headed stick, oily copper, etc. It is a fish endemic to the Yangtze River and is distributed in the main stream of the Yangtze River and its tributaries. It was once an important economic fish and a dominant fish. Due to factors such as water engineering construction, overfishing and environmental degradation, its resources have been drastically reduced. Coreius has a high fat content, delicious taste and high nutritional value. It has a high development value and broad market prospects.

[0003] At present, large-scale artificial domestication and breeding of copper fish have been achieved, and large-scale artificial breeding is in its infancy. The development and application of sex-specific molecular markers and the identification of sex-determining genes can assist in identifying economic traits related to sex and provide the necessary tools for sex-controlled breeding. On the other hand, it also lays the foundation for clarifying the molecular mechanism of fish sex determination. Sex molecular markers are an important tool for developing sex control technology. At the same time, molecular markers can also be used to identify the sex ratio of fish catches without dissecting experimental fish. Summary of the invention

[0004] Based on the above-mentioned prior art, the present invention provides a SNP molecular marker for identifying the genetic sex of copper fish and its application. The present invention can realize accurate and rapid sex identification of copper fish samples without dissecting the copper fish.

[0005] The technical solution adopted to achieve the above-mentioned purpose of the present invention is:

[0006] A SNP molecular marker for identifying the genetic sex of copper fish, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, and the SNP molecular marker comprises a SNP site, and the SNP site is located at the 501st base at the 5' end of the SNP molecular marker.

[0007] Furthermore, when the 501st base is heterozygous for G / A, the copper fish sample is female, and when it is homozygous for G / G, the copper fish sample is male.

[0008] A primer for identifying the genetic sex of copper fish, comprising:

[0009] Upstream primer F: GACAGATGATGCCGCCTCCAC, SEQ ID NO.2

[0010] Downstream primer R: ACCTCGTCGTGTCGTGTTAT, SEQ ID NO.3.

[0011] A reagent or kit for identifying the genetic sex of copper fish comprises the primer.

[0012] The application of the SNP molecular marker, primer, reagent or kit in identifying the genetic sex of copper fish.

[0013] A method for identifying the genetic sex of copper fish comprises the following steps:

[0014] S1, collect copper fish sample to be tested, extract DNA from the copper fish sample to be tested, and obtain genomic DNA of the copper fish sample to be tested;

[0015] S2, using the DNA of the copper fish sample to be tested as a template, using the primers described in claim 3, to perform a PCR amplification reaction;

[0016] S3, after the PCR amplification reaction is completed, the sequence information of the PCR amplification product is analyzed to determine the genotype of the copper fish sample to be tested and identify the gender;

[0017] When the 501st base at the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the amplified product is G / A heterozygous, the gender of the copper fish sample to be tested is female; when the 501st base is G / G homozygous, the gender of the copper fish sample to be tested is male.

[0018] Furthermore, in step S2, the PCR amplification system includes 15 μL of 2*Taq MasterMix, 2 μL of upstream primer F, 2 μL of downstream primer R, 10 μL of ddH2O, and 1 μL of DNA template.

[0019] Furthermore, the reaction conditions of PCR amplification in step S2 are: pre-denaturation at 95°C for 5 min; then 35 cycles, including 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; then final extension at 72°C for 5 min; and finally, maintaining at 16°C for 1 min.

[0020] Furthermore, in step S3, the method for determining the genotype of the copper fish sample to be tested is Sanger sequencing.

[0021] Compared with the prior art, the advantages and beneficial effects of the present invention are:

[0022] 1. The present invention can complete the identification of the sex of copper fish through PCR amplification and Sanger sequencing. Compared with other molecular identification methods that are cumbersome and time-consuming, the present invention is more suitable for rapid identification of large quantities of copper fish samples. More importantly, the SNP loci of the present invention can simply and accurately identify the sex of copper fish, and there is no need to dissect the copper fish, which basically does not affect the health of the copper fish samples tested.

[0023] 2. The accuracy of identifying the sex of copper fish of the present invention is very high. Experiments show that the accuracy can reach 100%.

[0024] 3. The present invention is an important method for developing sex control technology, which helps to optimize economic traits related to sex.

[0025] 4. The present invention discovered for the first time the SNP molecular marker for identifying the sex of copper fish, filling the gap in the sex marker gene of copper fish. DETAILED DESCRIPTION

[0026] The present invention is described in detail below with reference to specific embodiments, which should not be construed as limiting the present invention.

[0027] Example 1 (Development and verification of sex-specific SNP molecular markers for copper fish)

[0028] By comparing and analyzing the 2b-RAD sequencing data of 90 male and female copper fish from three breeding groups in Hubei Province, a large number of SNP markers were found between male and female fish. The SNP molecular markers associated with the sex difference of copper fish were screened and verified. One of the SNP molecular markers showed accurate male-female specificity. The SNP site was located at the 46620661th base on chromosome 4 of copper fish.

[0029] The results are shown in Table 1, which shows that the sequences from female fish have two bases, G / A, at the SNP site shown in Table 1, while the sequences from male fish do not have SNP polymorphism at this site, and the base at this site in all sequences is G.

[0030] Table 1 Information of SNP molecular markers obtained by screening

[0031]

[0032] The following primers were designed for the SNP molecular markers in Table 1:

[0033] Upstream primer F: GACAGATGATGCCGCCTCCAC, as shown in SEQ ID NO.2;

[0034] Downstream primer R: ACCTCGTCGTGTCGTGTTAT, as shown in SEQ ID NO.3;

[0035] The PCR amplification reaction was carried out according to the designed primers. The reaction system during PCR amplification was 30 μL, including 2*TaqMasterMix 15 μL, upstream primer F (concentration 5 pmol / μL) 2 μL, downstream primer R (concentration 5 pmol / μL) 2 μL, ddH2O 10 μL, DNA template (20 ng) 1 μL. Reaction conditions: 95°C pre-denaturation for 5 min; then 35 cycles, including 94°C 30 s, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s; then 72°C final extension for 5 min; finally 16°C for 1 min.

[0036] The results showed that the sequence amplified by Sanger sequencing was compared with the sequence of the target length, and it was found that the sequence amplified by the DNA template of the female fish was shown in SEQ ID NO.1, in which the 501st base was G / A, and the sequence amplified by the DNA template of the male fish was shown in SEQ ID NO.1, in which the 501st base was G / G.

[0037] Example 2

[0038] In order to verify the accuracy of the SNP site in Example 1 in identifying the sex of copper fish, this example verifies the SNP molecular markers, and verifies whether the molecular markers detected by copper fish are accurate by PCR and Sanger sequencing.

[0039] Specifically, genomic DNA is extracted from the sample to be tested, and the specificity of the primers is verified by PCR and Sanger sequencing, and compared with the physiological sex of the copper fish sample to confirm whether the SNP molecular markers and primers in Example 1 can be used for copper fish sex identification.

[0040] 1. Sample preparation

[0041] On May 17, 2024, 60 copper fish samples, including 30 female samples and 30 male samples, were selected for verification.

[0042] 2. Extraction of genomic DNA:

[0043] The genomic DNA of the copper fish to be tested was extracted using a DNA extraction kit.

[0044] 3. PCR amplification

[0045] Using the genomic DNA of the copper fish to be tested as a template, the upstream primer F

[0046] PCR amplification reaction was carried out using the downstream primer R (GACAGATGATGCCGCCTCCAC, SEQ ID NO. 2) and the downstream primer R (ACCTCGTCGTGTCGTGTTAT, SEQ ID NO. 3).

[0047] Reaction system: The reaction system for PCR amplification was 30 μL, including 2*Taq MasterMix 15 μL, upstream primer F (concentration 5 pmol / μL) 2 μL, downstream primer R (concentration 5 pmol / μL) 2 μL, ddH2O 10 μL, and DNA template (20 ng) 1 μL.

[0048] Reaction conditions: pre-denaturation at 95°C for 5 min; then 35 cycles, including 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s; then final extension at 72°C for 5 min; and finally, hold at 16°C for 1 min.

[0049] 4. Combined with Sanger sequencing, the genotype of the copper fish sample to be tested is determined and the gender is identified.

[0050] When the 501st base is G / A heterozygous, the copper fish sample to be tested is female, and when it is G / G homozygous, the copper fish sample to be tested is male.

[0051] The identification results of 60 copper fish samples are shown in Table 1 below:

[0052] Table 1 Comparison of genotyping sex determination and anatomical and physiological sex determination results of copper fish samples

[0053]

[0054]

[0055]

[0056]

[0057] The results in Table 1 above show that the sex information based on the SNP site reaction is consistent with the sex information confirmed by physiological anatomy, that is, the sex of copper fish can be accurately identified by the primers and SNP sites of the present invention, with an accuracy rate of 100%. Compared with traditional anatomical and physiological sex identification, biological anatomy is not required.

Claims

1. A SNP molecular marker for identifying the genetic sex of copper fish, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The SNP molecular marker includes a SNP site, and the SNP site is located at the 501st base at the 5' end of the SNP molecular marker.

2. The SNP molecular marker for identifying the genetic sex of copper fish according to claim 1, characterized in that: When the 501st base is heterozygous for G / A, the copper fish sample is female, and when it is homozygous for G / G, the copper fish sample is male.

3. A primer for identifying the genetic sex of copper fish, characterized in that include: Upstream primer F: GACAGATGATGCCGCCTCCAC, SEQ ID NO.2 Downstream primer R: ACCTCGTCGTGTCGTGTTAT, SEQ ID NO.

3.

4. A reagent or kit for identifying the genetic sex of copper fish, characterized in that: Comprising the primer described in claim 3.

5. Use of the SNP molecular marker according to claim 1, the primer according to claim 3, or the reagent or kit according to claim 4 in identifying the genetic sex of copper fish.

6. A method for identifying the genetic sex of copper fish, characterized in that The steps include: S1, collect copper fish sample to be tested, extract DNA from the copper fish sample to be tested, and obtain genomic DNA of the copper fish sample to be tested; S2, using the DNA of the copper fish sample to be tested as a template, using the primers described in claim 3, to perform a PCR amplification reaction; S3, after the PCR amplification reaction is completed, the sequence information of the PCR amplification product is analyzed to determine the genotype of the copper fish sample to be tested and identify the gender; When the 501st base at the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the amplified product is G / A heterozygous, the gender of the copper fish sample to be tested is female; when the 501st base is G / G homozygous, the gender of the copper fish sample to be tested is male.

7. The method for identifying the genetic sex of copper fish according to claim 6, characterized in that: In step S2, the PCR amplification system includes 15 μL of 2*Taq MasterMix, 2 μL of upstream primer F, 2 μL of downstream primer R, 10 μL of ddH2O, and 1 μL of DNA template.

8. The method for identifying the genetic sex of copper fish according to claim 6, characterized in that: The reaction conditions of PCR amplification in step S2 are: pre-denaturation at 95°C for 5 min; then 35 cycles, including 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; then final extension at 72°C for 5 min; and finally, 16°C for 1 min.

9. The method for identifying the genetic sex of copper fish according to claim 6, characterized in that: In step S3, the method for determining the genotype of the copper fish sample to be tested is Sanger sequencing.

Images