Molecular markers for identification of cultivated species of salvia miltiorrhiza and their application

Abstract

The application discloses a molecular marker for identifying salvia miltiorrhiza cultivars and application thereof, and belongs to the technical field of plant molecular identification. The molecular marker comprises SM-M1, SM-M2, SM-M3, SM-M4, SM-M5 and SM-M6. The molecular marker can be used for effectively identifying two subgroups of salvia miltiorrhiza cultivars, and is beneficial to the research on genetic variation in salvia miltiorrhiza and evolution of cultivars.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular identification technology, specifically involving molecular markers for identifying cultivated varieties of Salvia miltiorrhiza and their applications. Background Technology

[0002] Salvia miltiorrhiza is a traditional medicinal plant belonging to the genus Salvia in the Lamiaceae family, with its dried rhizome being the main medicinal part. The pharmacologically active components of Salvia miltiorrhiza mainly include hydrophilic phenolic acids and lipophilic diterpenoids; among them, tanshinone is the most important pharmacologically active component and is widely used worldwide for the prevention and protection against cardiovascular and cerebrovascular diseases. To date, although comprehensive omics studies have been conducted on many cultivated varieties, research on intraspecific genetic variation and identification of Salvia miltiorrhiza remains unreported.

[0003] Therefore, exploring the intraspecific genetic variation of Salvia miltiorrhiza and identifying different cultivated varieties of Salvia miltiorrhiza are urgent problems to be solved in this field. Summary of the Invention

[0004] This invention discloses molecular markers for identifying cultivated varieties of Salvia miltiorrhiza, which can be effectively distinguished into two subgroups when used for identification of cultivated varieties of Salvia miltiorrhiza.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] Molecular markers for identifying cultivated varieties of Salvia miltiorrhiza, including SM-M1, SM-M2, SM-M3, SM-M4, SM-M5, and SM-M6.

[0007] SM-M1 includes the 57th SNP site in the nucleotide sequence shown in SEQ ID NO: 1.

[0008] SEQ ID NO: 1 is: GAGTTTTTCTTAATTATTTTTTGAAAAGAAAAAAATAATGCCTTTTTTTTTWWWWTWTT, where the nucleotide at position 51 is T or deleted;

[0009] SM-M2 includes the 10th SNP site in the nucleotide sequence shown in SEQ ID NO: 2.

[0010] SEQ ID NO: 2 is ATTGAATTTKATTTTGAGCACGGATTTTGTCGGTAAAAAAAAAAAA;

[0011] SM-M3 includes the 8th SNP site in the nucleotide sequence shown in SEQ ID NO: 3.

[0012] SEQ ID NO: 3 is TCTATTAWTATCTATTATTATATATATAA;

[0013] SM-M4 includes the Indel sites at positions 41-46 of the nucleotide sequence shown in SEQ ID NO: 4.

[0014] SEQ ID NO: 4 is AATTAATCTAGTTCTTAATCTATTTCCCTTCAAATACCCCCCCAAAAAAA;

[0015] SM-M5 includes the 10th SNP site in the nucleotide sequence shown in SEQ ID NO: 5.

[0016] SEQ ID NO: 5 is AAATATAAARTAATTTTTTTAATATGCTAAAGGATTGGGTATAGCTAGTCATGATGGTGTAGTGAGTCTATCCACTCTTTTTTCCCCTTCCTACCCCCCC;

[0017] SM-M6 includes the 17th SNP site in the nucleotide sequence shown in SEQ ID NO: 6.

[0018] SEQ ID NO: 6 is ACATGTCCTAAAAAAAKAAAATAGATCCTATAATGAATAATAATGAATTCAATTTCGGATTTCGATTTTATAATTAAGGAACTTTTTTTTT.

[0019] Application of the above molecular markers in the identification of cultivated varieties of Salvia miltiorrhiza:

[0020] Based on molecular markers, cultivated varieties of Salvia miltiorrhiza were divided into two subgroups;

[0021] In group 1, the 57th SNP site of SM-M1 is T, the 10th SNP site of SM-M2 is T, the 8th SNP site of SM-M3 is T, the 41st to 46th sites of SM-M4 are deleted, the 10th SNP site of SM-M5 is A, and the 17th SNP site of SM-M6 is T.

[0022] In group 2, the 57th SNP site of SM-M1 is A, the 10th SNP site of SM-M2 is G, the 8th SNP site of SM-M3 is A, the 41st-46th SNP sites of SM-M4 are CCCAA, the 10th SNP site of SM-M5 is G, and the 17th SNP site of SM-M6 is G.

[0023] Primers for identifying cultivated varieties of Salvia miltiorrhiza:

[0024] Primer set 1 is:

[0025] Upstream primer: 5'-ATTCGACTAATTCACCCGCC-3', SEQ ID NO: 7;

[0026] Downstream primer: 5'-ATTGGCATGTTGGGAGTGATG-3', SEQ ID NO: 8;

[0027] Primer set 2 is:

[0028] Upstream primer: 5'-ACAAGGAAAATGGTTCGTGGT-3', SEQ ID NO: 9;

[0029] Downstream primer: 5'-TGCCCCACCGATGTATTAGA-3', SEQ ID NO: 10;

[0030] Primer set 3 is:

[0031] Upstream primer: 5'-AGATCACTCCCGGCTTTAGG-3', SEQ ID NO: 11;

[0032] Downstream primer: 5'-TAATATGGGCCCGCTTAGCT-3', SEQ ID NO: 12;

[0033] Primer set 4 is:

[0034] Upstream primer: 5'-GCTATGTCGCAGGGTTAAAAC-3', SEQ ID NO: 13;

[0035] Downstream primer: 5'-CCCCGCGAATTGAGACAATT-3', SEQ ID NO: 14;

[0036] Primer set 5 is:

[0037] Upstream primer: 5'-TCTGGCCTGATACTGCACAA-3', SEQ ID NO: 15;

[0038] Downstream primer: 5'-GACTTCTTCTCTTCAGCGCG-3', SEQ ID NO: 16;

[0039] Primer set 6 is:

[0040] Upstream primer: 5'-GGTCAAGACAAGCCGCTATG-3', SEQ ID NO: 17;

[0041] Downstream primer: 5'-AGAATTGAAACAGTCGCAAAAGA-3', SEQ ID NO: 18.

[0042] Application of the above primers in the identification of cultivated varieties of Salvia miltiorrhiza.

[0043] A kit for identifying cultivated varieties of Salvia miltiorrhiza includes the primers mentioned above.

[0044] The method for identifying cultivated varieties of Salvia miltiorrhiza includes the following steps:

[0045] (1) Take the leaf sample to be tested and extract DNA;

[0046] (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using the primers described above;

[0047] (3) Sequencing the amplification product from step (2).

[0048] Preferably, the amplification system in step (2) is as follows:

[0049] 12.5 μL of 2×Taq PCR Master Mix, 0.4 μM upstream primer, 0.4 μM downstream primer, 2 μL of template DNA, and ddH2O to a final volume of 25 μL.

[0050] Preferably, the amplification procedure in step (2) is as follows:

[0051] Denaturation at 94℃ for 2 minutes;

[0052] 94℃ for 30 seconds, 57℃ for 30 seconds, 72℃ for 60 seconds, 35 cycles;

[0053] 72℃ for 2 minutes.

[0054] Application of the above molecular markers, primers, kits, or methods in the study of genetic variation within *Salvia miltiorrhiza* species and the evolutionary study of cultivated species.

[0055] In summary, the molecular markers of this invention and the primers designed based on them can effectively identify two subgroups of cultivated Salvia miltiorrhiza, which is beneficial for the study of genetic variation within Salvia miltiorrhiza and the evolution of cultivated species. Attached Figure Description

[0056] Figure 1 The diagram shows the endoplastic genome structure and variation sites of 381 cultivated varieties of Salvia miltiorrhiza.

[0057] Figure 2 The figure shows a molecular phylogenetic tree of 381 cultivated species of Salvia miltiorrhiza based on plastid genomes; with Salvia zhangjiajieensis as the outgroup; group1, group2; group1, group2;

[0058] Figure 3The results shown are principal component analysis results based on single nucleotide variant sites among the genomes of 381 cultivated germplasms of Salvia miltiorrhiza.

[0059] Figure 4 The figure shows a comparison of highly variable IGS regions among the genomes of 381 cultivated germplasms of Salvia miltiorrhiza;

[0060] The X-axis represents the IGS region, the Y-axis represents the range of K2p distances between different species; the diamond-shaped squares represent the average K2p distance of the IGS region.

[0061] Figure 5 The image shows the gel electrophoresis results for molecular marker verification of some samples;

[0062] Among them, AD is group SM-M1, EH is group SM-M2, IL is group SM-M3, MP is group SM-M4, QT is group SM-M5, and UX is group SM-M6.

[0063] Figure 6 The image shows partial sequencing results for the SM-M1 group;

[0064] Figure 7 The image shows partial sequencing results for the SM-M2 group;

[0065] Figure 8 The image shows partial sequencing results for the SM-M3 group;

[0066] Figure 9 The image shows partial sequencing results for the SM-M4 group;

[0067] Figure 10 The image shows partial sequencing results for the SM-M5 group;

[0068] Figure 11 The image shows partial sequencing results for the SM-M6 group;

[0069] Figure 12 The image shows a comparison of molecular marker validation sequencing chromatograms for some samples. Detailed Implementation

[0070] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0071] Example

[0072] 1. Preparation of plant materials and total DNA

[0073] Thirty-eighty seedlings of *Salvia miltiorrhiza* cultivars were collected from 52 regions in Shandong Province and 1 region in Shanxi Province, China, and planted at the Shandong Academy of Agricultural Sciences (117°08'E, 36°70'N, 250000). Young leaves of each individual were collected in the spring of the following year. The samples were dried with silica and stored in a specimen collection, which was deposited at the Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences (sample numbers: Implad 2018001-Implad 2018381).

[0074] Total DNA was extracted from each sample using a plant genomic DNA extraction kit (Tiangen Biotech, Beijing, Co., Ltd.); the purity of total DNA was evaluated using 1.0% agarose gel electrophoresis; and the concentration of total DNA was measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

[0075] 2. Sequencing, assembly, and annotation of plasmid genomes

[0076] Total DNA sequencing libraries for each species were constructed according to the manual using the TruSeq DNA Sample Preparation Kit (Illumina, San Diego, CA, USA). Total DNA was cut into approximately 300-base fragments and paired-end libraries were constructed. These libraries were then sequenced on an Illumina HiSeq 3000 platform (Illumina, San Diego, CA, USA), yielding paired-end reads (2 × 150 bases). Plastid genomes were assembled de novo using Novoplasty (v3.8.3). The assembled plastid genomes and Arabidopsis plastid reference genomes were constructed using Gepard (v1.40) to adjust the orientation of single-copy regions. 381 plastid genomes were annotated using CpGAVAS 2 (v2.0), and a circular map of the plastid genomes was drawn. The annotation results were corrected using CPGview-RSG (v0.2).

[0077] Plastid genome structure diagram and population variation sites, such as Figure 1 As shown.

[0078] The plastid genomes of the 381 cultivated Salvia miltiorrhiza species all exhibited typical circular structures, ranging in size from 151,076 to 151,658 bases. Each plastid genome included a large single-copy (LSC) region (82,906–82,315 bases), a small single-copy (SSC) region (17,983–17,574 bases), and two inverted repeat (IR) regions (25,584–25,241 bases).

[0079] 3. Population structure analysis of 381 Salvia miltiorrhiza cultivars

[0080] The whole-plast genomes of 381 cultivated *Salvia miltiorrhiza* species and one outgroup of *Salvia zhangjiajieensis* (Genebank sequence number: NC_059718.1), totaling 382 plastid genome sequences, were aligned using MAFFT (v7.450). The alignment results were used to construct maximum likelihood and Bayesian trees. Maximum likelihood trees were constructed using RAxML (v8.2.4), and Bayesian trees were constructed using MrBayes (v3.2.7a). The optimal Bayesian tree model was calculated using jMdoleTest (v2.1.0). The phylogenetic trees were visualized using the online tool iTOL (https: / / itol.embl.de). Principal component analysis was performed using SNPs obtained from the alignment of the whole-plast genomes of the 381 cultivated *Salvia miltiorrhiza* species with the *Salvia miltiorrhiza* plastid reference genome (Genebank sequence number: NC_020431.1) and Plink software. The results are as follows: Figure 2 , 3 As shown, both population structure analyses based on plastid genome variation sites of 381 cultivated Salvia miltiorrhiza species divided them into two large subgroups, each of which could be further subdivided into different subgroups.

[0081] 4. Determination of high-variable zones

[0082] To identify the regions with the greatest endoplastic genome variation among 381 cultivated varieties of *Salvia miltiorrhiza*, IGS regions were extracted from the sequenced endoplastic genomes of each individual endoplastic genome based on annotation results. The results showed that there were 55 IGS regions in the endoplastic genomes of the 381 cultivated varieties of *Salvia miltiorrhiza*. Sequences were extracted and aligned using ClustalW2 (v.2.0.12) with parameters set to "-type=DNA-gapopen=10-gapext=2". Genetic distances between pairs of highly variable regions were calculated using the K2p model implemented by the distmat program in EMBOSS (v6.3.1). The results are as follows: Figure 4 As shown, the average K2p distance of 55 IGS regions in the plastid genomes of 381 cultivated varieties of Salvia miltiorrhiza ranged from 0.00 to 2.04; among them, the top 10 highly variable regions were: atpA-atpF,ndhD-psaC,petB-petD,psbT-psbN,rps4-trnT-UGU,rps8-rpl14,trnG-GCC-trnfM-CAU,trnG-UCC-trnR-UCU,trnH-GUG-psbA, andtrnL-UAG-ccsA.

[0083] 5. Identification and validation of molecular markers for subgroup differentiation in cultivated Salvia miltiorrhiza.

[0084] (1) Screening molecular markers

[0085] Six highly variable intergenic regions of the plastid genome (atpA-atpF, ndhD-pasC, rps4-trnT-UGU, rps8-rpl14, trnG-GCC-trnfM-CAU, and trnL-UAG-ccsA) were used as templates to develop molecular markers that distinguish the subgroups of 381 cultivated species of Salvia miltiorrhiza. The molecular markers screened were SM-M1, SM-M2, SM-M3, SM-M4, SM-M5, and SM-M6.

[0086] The marker SM-M1, developed from the IGS region atpA-atpF, includes the SNP site at position 57 in the nucleotide sequence shown in SEQ ID NO: 1.

[0087] SEQ ID NO: 1 is: GAGTTTTTCTTAATTATTTTTTGAAAAGAAAAAAATAATGCCTTTTTTTTTWWWWTWTT, where the nucleotide at position 51 is T or deleted;

[0088] The marker SM-M2 developed from the IGS region ndhD-pasC includes the 10th SNP site in the nucleotide sequence shown in SEQ ID NO: 2.

[0089] SEQ ID NO: 2 is ATTGAATTTKATTTTGAGCACGGATTTTGTCGGTAAAAAAAAAAAA;

[0090] The marker SM-M3, developed from the IGS region rps4-trnT-UGU, includes the 8th SNP site in the nucleotide sequence shown in SEQ ID NO: 3.

[0091] SEQ ID NO: 3 is TCTATTAWTATCTATTATTATATATATAA;

[0092] The marker SM-M4, developed from the IGS region rps8-rpl14, includes the Indel sites at positions 41-46 of the nucleotide sequence shown in SEQ ID NO: 4.

[0093] SEQ ID NO: 4 is AATTAATCTAGTTCTTAATCTATTTCCCTTCAAATACCCCCCCAAAAAAA;

[0094] The marker SM-M5, developed from the IGS region trnG-GCC-trnfM-CAU, includes the 10th SNP site in the nucleotide sequence shown in SEQ ID NO: 5.

[0095] SEQ ID NO: 5 is AAATATAAARTAATTTTTTTAATATGCTAAAGGATTGGGTATAGCTAGTCATGATGGTGTAGTGAGTCTATCCACTCTTTTTTCCCCTTCCTACCCCCCC;

[0096] The marker SM-M6, developed from the IGS region trnL-UAG-ccsA, includes the SNP site at position 17 in the nucleotide sequence shown in SEQ ID NO: 6.

[0097] SEQ ID NO: 6 is ACATGTCCTAAAAAAAKAAAATAGATCCTATAATGAATAATAATGAATTCAATTTCGGATTTCGATTTTATAATTAAGGAACTTTTTTTTT.

[0098] All six variation sites mentioned above can be used to distinguish the two subgroups of 381 cultivated species of Salvia miltiorrhiza.

[0099] (2) Primer design and PCR detection

[0100] Young leaves of Salvia miltiorrhiza were collected, and DNA was extracted using a DNA extraction kit to serve as a template for PCR amplification.

[0101] Extract the highly variable regions (atpA-atpF, ndhD-pasC, rps4-trnT-UGU, rps8-rpl14, trnG-GCC-trnfM-CAU, and trnL-UAG-ccsA) and extend the sequences by 200 bp at both ends. Design primers within the 200 bp conserved sequences at both ends of the highly variable regions, as follows:

[0102] Primer set 1 (for SM-M1) is as follows:

[0103] Upstream primer: 5'-ATTCGACTAATTCACCCGCC-3', SEQ ID NO: 7;

[0104] Downstream primer: 5'-ATTGGCATGTTGGGAGTGATG-3', SEQ ID NO: 8;

[0105] Primer set 2 (for SM-M2) is as follows:

[0106] Upstream primer: 5'-ACAAGGAAAATGGTTCGTGGT-3', SEQ ID NO: 9;

[0107] Downstream primer: 5'-TGCCCCACCGATGTATTAGA-3', SEQ ID NO: 10;

[0108] Primer set 3 (for SM-M3) is as follows:

[0109] Upstream primer: 5'-AGATCACTCCCGGCTTTAGG-3', SEQ ID NO: 11;

[0110] Downstream primer: 5'-TAATATGGGCCCGCTTAGCT-3', SEQ ID NO: 12;

[0111] Primer set 4 (for SM-M4) is as follows:

[0112] Upstream primer: 5'-GCTATGTCGCAGGGTTAAAAC-3', SEQ ID NO: 13;

[0113] Downstream primer: 5'-CCCCGCGAATTGAGACAATT-3', SEQ ID NO: 14;

[0114] Primer set 5 (for SM-M5) is:

[0115] Upstream primer: 5'-TCTGGCCTGATACTGCACAA-3', SEQ ID NO: 15;

[0116] Downstream primer: 5'-GACTTCTTCTCTTCAGCGCG-3', SEQ ID NO: 16;

[0117] Primer set 6 (for SM-M6) is:

[0118] Upstream primer: 5'-GGTCAAGACAAGCCGCTATG-3', SEQ ID NO: 17;

[0119] Downstream primer: 5'-AGAATTGAAACAGTCGCAAAAGA-3', SEQ ID NO: 18.

[0120] PCR detection was performed using the primers described above.

[0121] The amplification system is as follows:

[0122] 12.5 μL of 2×Taq PCRMaster Mix, 0.4 μM upstream primer, 0.4 μM downstream primer, 2 μL template DNA, and ddH2O to a final volume of 25 μL.

[0123] All amplifications were performed on a Pro-Flex PCR system (Applied Biosystems, Waltham, MA, USA), and the amplification program was as follows:

[0124] Denaturation at 94℃ for 2 minutes;

[0125] 94℃ for 30 seconds, 57℃ for 30 seconds, 72℃ for 60 seconds, 35 cycles;

[0126] 72℃ for 2 minutes.

[0127] PCR amplification products were detected by 1.0% agarose gel electrophoresis, and all showed corresponding bands. Some results are shown below. Figure 5 As shown.

[0128] (3) Sequencing

[0129] The PCR products were Sanger sequenced using the same primer pairs used for PCR amplification on an ABI 3730X instrument (Applied Biosystems, USA).

[0130] Partial sequencing results as follows Figure 6-12 As shown.

[0131] In Group 1 (15 samples), the 57th SNP of SM-M1 was T, the 10th SNP of SM-M2 was T, the 8th SNP of SM-M3 was T, the 41st-46th SNPs of SM-M4 were deleted, the 10th SNP of SM-M5 was A, and the 17th SNP of SM-M6 was T. In Group 2 (24 samples), the 57th SNP of SM-M1 was A, the 10th SNP of SM-M2 was G, the 8th SNP of SM-M3 was A, the 41st-46th SNPs of SM-M4 were CCCAA, the 10th SNP of SM-M5 was G, and the 17th SNP of SM-M6 was G.

[0132] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0133] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of a molecular marker for identifying Salvia miltiorrhiza cultivars in identification of Salvia miltiorrhiza cultivars, characterized in that, the molecular marker comprises SM-M1, SM-M2, SM-M3, SM-M4, SM-M5 and SM-M6, the SM-M1 comprises a SNP site at position 57 in the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 1 is GAGTTTTTCTTAATTATTTTTTGAAAAGAAAAAAATAATGCCTTTTTTTTTWWWWTWTT, wherein the nucleotide at position 51 is T or deletion; the SM-M2 comprises a SNP site at position 10 in the nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 2 is ATTGAATTTKATTTTGAGCACGGATTTTGTCGGTAAAAAAAAAAA; the SM-M3 comprises a SNP site at position 8 in the nucleotide sequence shown in SEQ ID NO: 3, SEQ ID NO: 3 is TCTATTAWTATCTATTATTATATATATAA; the SM-M4 comprises an Indel site at positions 41-45 in the nucleotide sequence shown in SEQ ID NO: 4, SEQ ID NO: 4 is AATTAATCTAGTTCTTAATCTATTTCCCTTCAAATACCCCCCCAAAAAAA; the SM-M5 comprises a SNP site at position 10 in the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 5 is AAATATAAARTAATTTTTTTAATATGCTAAAGGATTGGGTATAGCTAGTCATGATGGTGTAGTGAGTCTATCCACTCTTTTTTCCCCTTCCTACCCCCCC; the SM-M6 comprises a SNP site at position 17 in the nucleotide sequence shown in SEQ ID NO: 6, SEQ ID NO: 6 is ACATGTCCTAAAAAAAKAAAATAGATCCTATAATGAATAATAATGAATTCAATTTCGGATTTCGATTTTATAATTAAGGAACTTTTTTTT; the Salvia miltiorrhiza cultivars are divided into two subgroups according to the molecular marker; in group 1, the SNP site at position 57 of SM-M1 is T, the SNP site at position 10 of SM-M2 is T, the SNP site at position 8 of SM-M3 is T, the deletion at positions 41-45 of SM-M4, the SNP site at position 10 of SM-M5 is A, and the SNP site at position 17 of SM-M6 is T; In group 2, the 57th SNP site of SM-M1 is A, the 10th SNP site of SM-M2 is G, the 8th SNP site of SM-M3 is A, the 41-45th of SM-M4 is CCCAA, the 10th SNP site of SM-M5 is G, and the 17th SNP site of SM-M6 is G.

2. The primer for amplifying the molecular marker in claim 1 is used for identifying Salvia miltiorrhiza cultivars, characterized in that, The primer group 1 is: The upstream primer is 5'-ATTCGACTAATTCACCCGCC-3', SEQ ID NO: 7; The downstream primer is 5'-ATTGGCATGTTGGGAGTGATG-3', SEQ ID NO: 8; The primer group 2 is: The upstream primer is 5'-ACAAGGAAAATGGTTCGTGGT-3', SEQ ID NO: 9; The downstream primer is 5'-TGCCCCACCGATGTATTAGA-3', SEQ ID NO: 10; The primer group 3 is: The upstream primer is 5'-AGATCACTCCCGGCTTTAGG-3', SEQ ID NO: 11; The downstream primer is 5'-TAATATGGGCCCGCTTAGCT-3', SEQ ID NO: 12; The primer group 4 is: The upstream primer is 5'-GCTATGTCGCAGGGTTAAAAC-3', SEQ ID NO: 13; The downstream primer is 5'-CCCCGCGAATTGAGACAATT-3', SEQ ID NO: 14; The primer group 5 is: The upstream primer is 5'-TCTGGCCTGATACTGCACAA-3', SEQ ID NO: 15; The downstream primer is 5'-GACTTCTTCTCTTCAGCGCG-3', SEQ ID NO: 16; The primer group 6 is: The upstream primer is 5'-GGTCAAGACAAGCCGCTATG-3', SEQ ID NO: 17; The downstream primer is 5'-AGAATTGAAACAGTCGCAAAAGA-3', SEQ ID NO: 18; The Salvia miltiorrhiza cultivars are divided into two subgroups according to the molecular markers; In group 1, the 57th SNP site of SM-M1 is T, the 10th SNP site of SM-M2 is T, the 8th SNP site of SM-M3 is T, the 41-45th of SM-M4 is deletion, the 10th SNP site of SM-M5 is A, and the 17th SNP site of SM-M6 is T; In group 2, the 57th SNP site of SM-M1 is A, the 10th SNP site of SM-M2 is G, the 8th SNP site of SM-M3 is A, the 41-45th of SM-M4 is CCCAA, the 10th SNP site of SM-M5 is G, and the 17th SNP site of SM-M6 is G.

3. A method for identifying a cultivated species of Salvia miltiorrhiza, characterized by, The method comprises the following steps: (1) taking a leaf of a sample to be detected to extract DNA; (2) using the DNA extracted in step (1) as a template, PCR amplification is performed using the primers described in claim 2; (3) sequencing the amplification product of step (2); (4) according to the sequencing results, the cultivated species of Salvia miltiorrhiza are divided into two subgroups; In group 1, the 57th SNP site of SM-M1 is T, the 10th SNP site of SM-M2 is T, the 8th SNP site of SM-M3 is T, the 41-45th of SM-M4 is deletion, the 10th SNP site of SM-M5 is A, and the 17th SNP site of SM-M6 is T; In group 2, the 57th SNP site of SM-M1 is A, the 10th SNP site of SM-M2 is G, the 8th SNP site of SM-M3 is A, the 41-45th of SM-M4 is CCCAA, the 10th SNP site of SM-M5 is G, and the 17th SNP site of SM-M6 is G.

4. The method for identifying the cultivated species of Salvia miltiorrhiza according to claim 3, characterized in that, the amplification system in step (2) is as follows: 2×Taq PCR Master Mix 12.5 µL, upstream primer 0.4 µM, downstream primer 0.4 µM, template DNA 2 µL, and ddH2O to a final volume of 25 µL.

5. The method for identifying the cultivated species of Salvia miltiorrhiza according to claim 3, characterized in that, the amplification procedure in step (2) is as follows: 94℃ denaturation for 2 min; 94℃ 30s, 57℃ 30s, 72℃ 60s, 35 cycles; 72 ℃ 2 min.

Images