Application of fungal markers or their detection reagents in the preparation of hepatocellular carcinoma assessment products

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to the use of fungal markers or detection reagents thereof in the preparation of hepatocellular carcinoma assessment products. The fungal markers include the genus Candida and / or the genus Meyerozyma. Based on ITS2 data, the present invention established two types of fungal hepatocellular carcinoma, namely type C and type M, with the genus Candida and the genus Meyerozyma as the driving bacterial genera, respectively. The tumor diameter of type C hepatocellular carcinoma is significantly larger than that of type M. This discovery can provide a new basis for the clinical treatment plan or therapeutic drug development of hepatocellular carcinoma. At the same time, the most important bacterial species in type C, C. boidinii, can promote the progression of hepatocellular carcinoma and is likely to be a risk factor for poor prognosis of hepatocellular carcinoma. At the same time, the present invention designed a C. boidini probe with the highest coverage and good specificity, which can be used for the identification and detection of C. boidinii in clinical samples.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of fungal markers or detection reagents thereof in the preparation of hepatocellular carcinoma assessment products. Background Art

[0002] Hepatocellular carcinoma (HCC), a malignant tumor with high morbidity and mortality, is a serious threat to life and health. Currently, the main clinical treatments for HCC include targeted therapy and immunotherapy. While these approaches have made some progress in tumor treatment, their efficacy is significantly limited, benefiting only a select group of patients. This represents a significant gap between the urgent needs of the vast majority of patients in actual clinical treatment.

[0003] Tumors exhibit a high degree of biological heterogeneity, meaning that tumor cells from different individuals vary in multiple dimensions, including morphology, gene expression, metabolism, and signaling networks. This high degree of heterogeneity creates significant difficulties and uncertainties in the diagnosis and treatment of tumors. Therefore, multi-dimensional classification information is crucial for achieving precise clinical diagnosis and treatment of tumors.

[0004] In the emerging research hotspot of the tumor microenvironment, microbes have gradually emerged and are widely recognized by the scientific community as an indispensable new component of the tumor microenvironment. A growing body of research evidence indicates that microbes are inextricably linked to the development and progression of various tumor types, their invasive and metastatic abilities, and patient prognosis and survival. For example, certain intestinal microbes can indirectly or directly influence the growth and spread of tumor cells through various mechanisms, including regulating the immune system, metabolic homeostasis, and signal transduction pathways. However, little research has yet to investigate the relationship between intratumoral fungi and hepatocellular carcinoma.

[0005] Intratumoral fungi, as a special component of the tumor microenvironment microbial community, may play an extremely important role in multiple key links such as the occurrence, development, metastasis and drug resistance of hepatocellular carcinoma. Therefore, with the help of modern advanced microbial detection technologies, such as high-throughput sequencing technology, metagenomic analysis methods and fluorescence in situ hybridization technology, in-depth analysis of the species composition, abundance distribution, community structure and functional characteristics of intratumoral fungi may open up new strategies and directions for the treatment of hepatocellular carcinoma, thus hopefully filling the gaps in current treatment methods. Furthermore, it provides ideas for the development of products for the diagnosis, classification, treatment or prognosis assessment of hepatocellular carcinoma. Summary of the Invention

[0006] In response to the above-mentioned deficiencies, the present invention provides the use of fungal markers or detection reagents thereof in the preparation of hepatocellular carcinoma assessment products. The fungal markers include the genus Candida and / or the genus Meyerozyma. Based on ITS2 data, the present invention established two types of fungal hepatocellular carcinoma, namely type C and type M, with the genus Candida and the genus Meyerozyma as the driving bacterial genera, respectively. The tumor diameter of type C hepatocellular carcinoma is significantly larger than that of type M. This discovery can provide a new basis for the clinical treatment plan or therapeutic drug development of hepatocellular carcinoma. At the same time, C. boidinii, the most important species in type C, can promote the progression of hepatocellular carcinoma and is likely to be a risk factor for poor prognosis of hepatocellular carcinoma. At the same time, the present invention designed a C. boidini probe with the highest coverage and good specificity, which can be used for the identification and detection of C. boidinii in clinical samples.

[0007] The technical solution of the present invention includes:

[0008] In a first aspect, the present invention provides the use of fungal markers or reagents for detecting fungal markers in the preparation of a hepatocellular carcinoma assessment product, wherein the fungal markers include one or more of the genera Candida and Meyerozyma.

[0009] Preferably, the hepatocellular carcinoma assessment product has at least one of the following functions:

[0010] (1) Diagnosis of hepatocellular carcinoma;

[0011] (2) Hepatocellular carcinoma classification;

[0012] (3) hepatocellular carcinoma treatment evaluation;

[0013] (4) Prognostic assessment of hepatocellular carcinoma;

[0014] (5) predict the risk of recurrence of hepatocellular carcinoma;

[0015] (6) Screening of anti-hepatocellular carcinoma drugs;

[0016] (7) Customized medication regimen for hepatocellular carcinoma.

[0017] Specifically, the hepatocellular carcinoma assessment product functions by detecting the expression level of fungal markers in the sample to be tested.

[0018] Preferably, the expression level of the fungal marker is positively correlated with the severity of hepatocellular carcinoma.

[0019] Specifically, the sample to be tested includes one or more of serum, plasma, urine, cell culture supernatant, and tissue sample.

[0020] Preferably, the sample to be tested is a liver tissue sample.

[0021] Specifically, the detection method includes: one or more of traditional culture detection, microscopy detection, immunological detection method, and molecular biology detection method.

[0022] Preferably, the detection method is a molecular biology detection method, more preferably fluorescence in situ hybridization.

[0023] Preferably, the hepatocellular carcinoma assessment product includes: a reagent, a kit, a test paper or a chip.

[0024] Preferably, the fungal marker is Candida boidinii.

[0025] Specifically, the reagent for detecting fungal markers includes a probe of Candida boidinii.

[0026] Preferably, the probe has a nucleotide sequence as shown in SEQ ID NO.1.

[0027] Specifically, the probe is labeled with fluorescent groups at the 5' end and the 3' end.

[0028] Preferably, the fluorescent group includes one or more of Texas Red, FAM, VIC, TET, CAL Gold 540, JOE, HEX, TAMRA, ROX, CY3, and CY5.

[0029] More preferably, the fluorescent group is Texas Red.

[0030] Specifically, the fungal marker screening method includes:

[0031] S1. Based on the ITS2 sequence database, the Partitioning Around Medoids clustering method was used to determine the optimal number of clusters using the Calinski-Harabasz Index.

[0032] S2. Visualization by principal coordinate analysis to clarify the classification of hepatocellular carcinoma;

[0033] S3. Use ROC curve to perform sensitivity and specificity analysis to verify the fungal markers for HCC typing.

[0034] In a second aspect, the present invention provides use of a fungal marker inhibitor in the preparation of an anti-hepatocellular carcinoma drug, wherein the fungal marker comprises one or more of the genera Candida and Meyerozyma.

[0035] Specifically, the anti-hepatocellular carcinoma drug includes one or more of chemically synthesized drugs, plant extracts, microbial metabolites, and biological preparations.

[0036] Specifically, the dosage form of the anti-hepatocellular carcinoma drug includes a gastrointestinal dosage form or a parenteral dosage form.

[0037] Preferably, the dosage forms for administration via the gastrointestinal tract include but are not limited to tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.

[0038] Preferably, the non-gastrointestinal dosage form includes but is not limited to an injection dosage form, a respiratory tract dosage form, a skin dosage form, a mucosal dosage form and a cavity dosage form.

[0039] Specifically, the anti-hepatocellular carcinoma drug further comprises one or more pharmaceutically acceptable excipients.

[0040] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, solvents, diluents, disintegrants, precipitation inhibitors, surfactants, glidants, adhesives, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavoring agents, sweeteners, ion exchangers, release agents, coating agents, flavoring agents, or antioxidants.

[0041] Preferably, the therapeutic target of the anti-hepatocellular carcinoma drug is one or more of the genera Candida and Meyerozyma.

[0042] The beneficial effects of the present invention are:

[0043] (1) Based on ITS2 data, the present invention established two fungal hepatocellular carcinoma types, namely C-type and M-type, with Candida and Meyerozyma as the driving fungi, respectively. It was also found that the tumor diameter of C-type hepatocellular carcinoma was significantly larger than that of M-type. This finding may provide new evidence for clinical treatment plans or the development of therapeutic drugs for hepatocellular carcinoma.

[0044] (2) This study found that Candida boidinii, the most common strain of type C, can promote the progression of hepatocellular carcinoma in mice and is likely a risk factor for poor prognosis in hepatocellular carcinoma. Furthermore, a fluorescent in situ hybridization probe with the highest coverage and best specificity for C. boidinii was designed and applied to the identification and detection of C. boidinii in clinical samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1Clustering of fungal hepatocellular carcinoma types based on genus data from ITS2 sequencing; Figure A shows the optimal number of clusters determined by the CH index within four distance matrices; Figure B shows the clustering results of fungal hepatocellular carcinoma types visualized by principal coordinate analysis.

[0046] Figure 2 Figure 3 is the ROC curve of the main driving fungal genus for the hepatotype to distinguish the two types; A in the figure is the main driving fungal genus for the C type; B is the main driving fungal genus for the M type.

[0047] Figure 3 Comparison of the maximum diameter of tumors in patients with two types of liver types.

[0048] Figure 4 Analysis of differential fungi between the two hepatic types for LEfSe.

[0049] Figure 5 C. boidinii promotes HCC progression in mice; Figure A is a photo of the liver appearance; B is the mouse body weight; C is the mouse liver weight; and D is the ratio of liver weight to body weight.

[0050] Figure 6 Fluorescence in situ hybridization (FISH) was used to detect C. boidinii in liver cancer tissues. DETAILED DESCRIPTION

[0051] The present invention will be further described in detail below with reference to specific examples. The following examples are not intended to limit the present invention but are merely intended to illustrate the present invention. The experimental methods used in the following examples are generally based on conventional conditions unless otherwise specified. The materials and reagents used in the following examples are all commercially available unless otherwise specified.

[0052] Example 1 Fungal Markers and Cancer Tissue Typing

[0053] Based on the ITS2 sequence database, the Partitioning Around Medoids (PAM) clustering method was employed. Specifically, HCC tissue samples were divided into groups based on the Bray-Curtis distance between samples calculated at the genus level. Three other widely used distance matrices, including the Jaccard distance, the Kulczynski distance, and the Jensen-Shannon distance (JSD), were also considered to validate the robustness of the fungal hepatotyping. The optimal number of clusters was determined using the Calinski-Harabasz Index (CH-index).

[0054] Figure 1To cluster fungal hepatocellular carcinoma types based on genus data from ITS2 sequencing, the results showed that within the four distance matrices, the optimal number of clusters determined by the CH index was two. The clustering results of fungal liver types were visualized by principal coordinate analysis (PCoA), and the two types were labeled as Type M and Type C, respectively.

[0055] Figure 2 The receiver operating characteristic (ROC) curves for the main driving fungal genus for the hepatotype distinguishing the two types. The main driving genus for each hepatotype was defined as the genus with the highest relative abundance in that hepatotype. The results showed that the main driving genus for the M type was Meyerozyma, with an AUC of 0.814 for its use as a marker for M type. The main driving genus for the C type was Candida, with an AUC of 0.922 for its use as a marker for C type.

[0056] Example 2 Clinical liver cancer tissue sample verification

[0057] Cancer tissue samples from 52 patients with hepatocellular carcinoma (HCC), including 16 C-type and 36 T-type, were collected for subsequent experiments.

[0058] Comparison of the maximum diameter of the tumor in patients with type C and type M showed that Figure 3 As shown, the results showed that the maximum diameter of the tumor in type C patients was significantly larger than that in type M patients.

[0059] DNA was extracted from HCC tissue samples using a DNA extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd., Cat. No. DP302-02). ITS2 was amplified and sequenced. The primers used for amplification were: ITS1FI2 (upstream primer, SEQ ID NO. 3) and ITS2 (downstream primer, SEQ ID NO. 4).

[0060] SEQ ID NO. 3 (5' end → 3' end): GTGARTCATCGAATCTTTG.

[0061] SEQ ID NO. 4 (5' end → 3' end): TCCTCCGCTTATTGATATGC.

[0062] The amplification reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds; 32 cycles of denaturation at 95°C for 10 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 45 seconds; and finally extension at 72°C for 10 minutes.

[0063] Figure 4 The results showed that the abundance of Candida boidinii (C. boidinii) in C type was significantly higher than that in M ​​type.

[0064] Example 3 C. boidinii promotes HCC progression

[0065] 1. Construction of a mouse primary hepatocellular carcinoma (HCC) model by hydrodynamic tail vein injection of plasmids

[0066] Three plasmids, 15 μg c-myc-PT3EF1a (Addgene 92046), 15 μg PX330-p53 (Addgene 59910), and 5 μg pCMV (CAT) T7-SB100 (Addgene 34879), were fully dissolved in 2 mL of 0.9% NaCl solution. The mixed solution (2 mL) was injected into 7-week-old C57BL / 6 male mice through the tail vein within 7 s.

[0067] 2. Establishment of Fungal Liver Cancer Model by Inoculation of C. boidinii

[0068] Two weeks after plasmid injection, mice in the C. boidinii group were inoculated with approximately 10 8 C. boidiniii was inoculated once every three days with cfu of C. boidiniii. Mice in the PBS group were inoculated with an equal volume of PBS. After three consecutive weeks of C. boidiniii or PBS treatment, the mice were weighed. The mice were sacrificed, their livers were harvested, and liver weights were observed and calculated.

[0069] The results are as follows Figure 5 As shown, macroscopic observation showed that tumor progression was significant in the C. boidinii-treated group compared to the PBS group. While there was no difference in body weight between the two groups, the liver weight and liver weight to body weight ratio of the C. boidinii-treated group were both greater than those in the PBS group.

[0070] Example 4 Design of C. boidinii-specific probes

[0071] Fluorescence in situ hybridization (FISH) is a type of nucleic acid hybridization technique. Based on the principle of base complementarity, a known fluorescein-labeled single-stranded nucleic acid is used as a probe. After denaturation, annealing, and renaturation, it specifically binds to an unknown single-stranded nucleic acid in the sample to be tested, forming a detectable hybrid double-stranded nucleic acid. Microbial FISH testing targets the relatively stable rRNA in microorganisms. Probes designed based on rRNA sequences perform hybridization, identifying and quantifying the distribution and characteristic microorganisms being tested, providing information on microbial morphology, spatial distribution, and cell number.

[0072] The probe design of this embodiment adopts the database of silva138.1 (released on August 27, 2020, currently the latest version). The entire database contains 58,790 eukaryotic 18S representative sequences, which is one of the most complete databases of fungal 18S sequences. The target species name is: Candida boidinii, and there are 4 18S representative sequences belonging to the target species (hereinafter referred to as target 18S sequence library), 224 species of Pichiaceae, and 510,504 representative sequences belonging to non-target species (hereinafter referred to as non-target sequence library). According to all consensus sequences in the target 18S sequence library, non-specific regions therein are excluded, all possible FISH probe sequences are listed, and the probe with the highest coverage with the target 18S sequence library and the least matching probe with the non-target sequence library, i.e., the probe with the highest specificity, is selected. Final C.boidinii probe sequence is shown in SEQ ID NO.1. The present embodiment verifies C.boidinii probe specificity using MY1574 as a positive probe. The positive probe has the sequence shown in SEQ ID NO.2.

[0073] SEQ ID NO. 1 (5' end → 3' end): GTTCACCAAAAGGTTAGCCAGAAGGA, double-end labeled with Texas Red.

[0074] SEQ ID NO. 2 (5' end → 3' end): TCCTCGTTGAAGAGC, double-end labeled with FITC.

[0075] The process of this embodiment includes: baking - dewaxing and hydrating - digestion - dehydration - hybridization - post-hybridization washing - DAPI nuclear staining - microscopic examination and photography. Specific steps:

[0076] Paraffin blocks of liver cancer tissue were cut into 3 μm thick sections with gelatinized gel and baked at 65°C for 2 hours. At room temperature, sections were immersed in xylene solution twice for 10 minutes each; in 100% ethanol twice for 5 minutes each; in 95% ethanol and 75% ethanol for 2 minutes each; and in distilled water for 3 minutes before being shaken dry. A humidified strip was preheated to 37°C in a Termo Brite hybridizer. The digestion time (approximately 12 minutes) and the required volume (approximately 50 μL) of 200 μg / mL lytic enzyme were determined based on the thickness of each section. The sections were placed in the preheated hybridizer and program "1" was started: 37°C for 15 minutes. Sections were removed on time and immediately washed with distilled water to deactivate lytic enzymes. Sections were then washed twice with 2× SSC for 5 minutes each at room temperature. The sections were dried at room temperature and 10 μL of DAPI was added. The sections were then washed twice with 2× SSC for 5 minutes each. At room temperature, the sections were immersed in 75% ethanol, 95% ethanol, and 100% ethanol for 2 min each and then dried naturally.

[0077] Vortex thoroughly to mix 2 μL of specific probe (SEQ ID NO. 1), 1 μL of positive probe, and 37 μL of hybridization solution. Approximately 10 μL of the probe mixture was applied to the hybridization area of ​​the section. Cover with a siliconized coverslip, taking care to prevent air bubbles. Seal the coverslip with rubber tape on all four sides. Place the section in the hybridizer and start program "2": denaturation at 73°C for 8 minutes, hybridization at 37°C for 16-24 hours. Carefully remove the rubber tape, wash the tissue section in 2× SSC for 5 minutes, and remove the siliconized coverslip. Wash the tissue section in 25% formamide / 2× SSC preheated at 53°C (2x, 5 minutes each); wash in 0.1% NP-40 / 2× SSC preheated at 42°C (2x, 5 minutes each); wash once in 0.5× SSC preheated at 42°C (5 minutes); and wash once in 0.2× SSC preheated at 42°C (5 minutes). Dry the sections naturally in the dark at room temperature and stain with 20 μL of DAPI for 10 minutes. Wash twice with 1× PBS for 5 minutes each. Add 50 μL of 30% glycerol buffer and seal with a large coverslip. Observe and capture images of the hybridized tissue sections on an Olympus upright fluorescence microscope.

[0078] Figure 6 Using the C.boidinii probe to specifically label C.boidinii (red) and the MY1574 probe to label fungi (green) in human liver cancer tissue can clearly show that C.boidinii is indeed present in the liver cancer tissue, indicating that the C.boidinii probe can specifically label C.boidinii in the tissue and can be used for the identification and detection of C.boidinii in liver cancer tissue samples.

[0079] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. Use of a reagent for detecting fungal markers in the preparation of a product for evaluating hepatocellular carcinoma, characterized in that: The fungal markers include Candida and Meyerozyma genera; The function of the hepatocellular carcinoma assessment product is hepatocellular carcinoma typing; The hepatocellular carcinoma assessment product functions by detecting the expression level of fungal markers in a test sample; the test sample is a liver tissue sample.

2. The use according to claim 1, characterized in that The detection method includes: one or more of traditional culture detection and molecular biological detection methods.

3. The use according to claim 1, characterized in that The hepatocellular carcinoma assessment product includes: a kit.

4. The use according to claim 1, characterized in that The fungal marker screening method comprises: S1. Based on the ITS2 sequence database, the Partitioning Around Medoids clustering method was used to determine the optimal number of clusters using the Calinski-Harabasz Index. S2. Visualization by principal coordinate analysis to clarify the classification of hepatocellular carcinoma; S3. Use ROC curve to perform sensitivity and specificity analysis to verify the fungal markers for HCC typing.

Images