A SNP molecular marker related to salt tolerance trait of protoglabrus protogenus and application thereof

Abstract

The application discloses a SNP molecular marker related to a salt tolerance trait of Procyprinus, wherein the SNP molecular marker is located at the 183th position of a sequence shown in SEQ ID NO:1, the mutation type is G / T, primers and a kit for detecting the SNP molecular marker, and a method for breeding the Procyprinus with the salt tolerance trait by using the primers or the kit are disclosed. The application further discloses reagents for detecting the SNP molecular marker, the primers, the kit and the method in the breeding of the Procyprinus with the salt tolerance trait.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology for aquatic animals, specifically relating to an SNP molecular marker related to the salt tolerance trait of mandarin fish and its application. Background Technology

[0002] Salinity, as a key ecological factor in the aquatic environment, has a significant impact on the growth, survival, and homeostasis of fish. The salt content in a fish's body determines its adaptability to aquatic environments with varying salinity. While the salinity of both marine and freshwater fish is typically close to 7‰, the osmotic pressure of their body fluids differs considerably from that of the surrounding water at different salinities, forcing them to adjust their osmotic pressure to adapt. However, research on the salinity adaptation mechanisms of freshwater fish is relatively limited. Conducting research on fish salinity adaptation mechanisms, particularly elucidating their adaptation mechanisms in high and low salinity environments, is of great significance for breeding salt-tolerant species and achieving brackish water aquaculture of freshwater fish.

[0003] Mandarin fish with upturned beak ( Sinipercachuatsi It belongs to the order Perciformes, subfamily Sinipercinae, and genus Sinipercinus. Siniperca The mandarin fish (Ctenopharynx gracilistylus) is highly prized by consumers for its delicious and nutritious flesh, making it a valuable freshwater aquaculture species. Currently, most freshwater fish are intolerant of salinity, resulting in a significant amount of brackish water resources in my country being unsuitable for aquaculture. Existing research indicates that the mandarin fish can not only survive in low-salinity conditions but also thrives at a salinity of 6 ppt. Therefore, the breeding of salt-tolerant mandarin fish is of great significance for both mandarin fish aquaculture and the utilization of brackish water resources in my country.

[0004] Molecular markers are specific DNA fragments that reflect certain differences in the genomes of individuals or populations. Single nucleotide polymorphisms (SNPs) refer to the presence of two different bases at a specific nucleotide position in the genome. Due to their abundant distribution, high information content, and ease of acquisition, SNP information has become an important molecular marker. By performing association analysis between SNP sites and salt tolerance traits in mandarin fish, and obtaining molecular markers closely related to salt tolerance for breeding purposes, this study is of great significance for developing new salt-tolerant varieties of mandarin fish and can greatly promote the growth and healthy development of the mandarin fish aquaculture industry. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker related to the salt tolerance trait of mandarin fish, and primers or kits for detecting the SNP molecular marker.

[0006] The present application also aims to provide a method for breeding a Procyprinus prolocus with salt tolerance.

[0007] The last purpose of the present application is to provide a reagent for detecting the SNP molecular marker, the primer or the kit and the application of the method in breeding a Procyprinus prolocus with salt tolerance.

[0008] The first purpose of the present application can be realized by the following technical solution: a SNP molecular marker related to the salt tolerance of a Procyprinus prolocus, which is located at the 183th position of the sequence shown in SEQ ID NO:1, and the mutation type is G / T.

[0009] Specifically, the SNP molecular marker related to the salt tolerance of a Procyprinus prolocus is SNP 14:19975383, which is located on the 14th chromosome of the Procyprinus prolocus, and the SNP 14:19975383 is located at the 183th position of the sequence shown in SEQ ID NO:1, and the mutation type is G / T.

[0010] The present application also provides primers for detecting the SNP molecular marker, which include a forward primer SNP 14:19975383-F and a reverse primer SNP 14:19975383-R, the sequence of the forward primer SNP 14:19975383-F is shown in SEQ ID NO:2, and the sequence of the reverse primer SNP 14:19975383-R is shown in SEQ ID NO:3.

[0011] The present application obtains a SNP molecular marker related to the salt tolerance of a Procyprinus prolocus by screening, designs primers, detects the genotype of the SNP molecular marker, and screens a Procyprinus prolocus with salt tolerance advantage, so as to realize the production and breeding of the Procyprinus prolocus in fresh and salt water environment.

[0012] The present application further provides a kit for detecting the SNP marker, which includes the primers.

[0013] The kit also includes 2X Taq PCR Master Mix and other related reagents.

[0014] The second purpose of the present application can be realized by the following technical solution: a method for breeding a Procyprinus prolocus with salt tolerance, which includes the following steps:

[0015] (1) extracting fin DNA of a Procyprinus prolocus to be tested;

[0016] (2) using the primers to perform PCR amplification on the extracted DNA to obtain an amplification product;

[0017] (3) sequencing analysis is performed on the amplification product to determine the genotype of the SNP molecular marker of the to-be-tested mandarin fish individual, and then it is determined whether the to-be-tested mandarin fish individual has the salt-tolerant trait potential.

[0018] In the method for breeding the mandarin fish with the salt-tolerant trait mentioned above:

[0019] Preferably, the T allele in step (3) is the preferred gene, and the salt-tolerant ability of the GT and TT individuals containing the allele is significantly better than that of the GG genotype individuals.

[0020] That is, when the genotype of the SNP marker of the to-be-tested mandarin fish is detected as TT or GT individual, it can be determined that the mandarin fish has the excellent salt-tolerant trait potential.

[0021] The above last purpose of the present application can be realized by the following technical solution: the application of the reagent for detecting the SNP molecular marker in breeding the mandarin fish with the salt-tolerant trait.

[0022] The present application also provides the application of the above-mentioned primer or kit in breeding the mandarin fish with the salt-tolerant trait.

[0023] The present application further provides the application of the above-mentioned method in breeding the mandarin fish with the salt-tolerant trait.

[0024] That is, the present application provides the application of the primer or kit for detecting the SNP molecular marker related to the salt-tolerant trait of the mandarin fish in breeding the mandarin fish with the salt-tolerant trait, the SNP molecular marker is located at the 183th position of the sequence shown as SEQ ID NO:1, and the mutation type is G / T, wherein the T allele is the preferred gene, and the salt-tolerant ability of the GT and TT individuals containing the allele is significantly better than that of the GG genotype individuals; the primer comprises the forward primer SNP 14:19975383-F and the reverse primer SNP 14:19975383-R, and the sequences of the forward primer SNP 14:19975383-F and the reverse primer SNP 14:19975383-R are shown as SEQ ID NO:2 and SEQ ID NO:3 respectively; and the kit comprises the primer.

[0025] The present application has the following advantages:

[0026] (1) The present application analyzes the salt-tolerant trait of the mandarin fish mixed family population through whole genome association analysis, screens a candidate SNP site associated with the salt-tolerant trait, that is, SNP 14:19975383, and further verifies and determines that the SNP site is associated with the salt-tolerant trait through the Sanger sequencing technology.

[0027] (2) The SNP marker in the application can be accurately determined by primers, and has the characteristics of simple operation and reliable results;

[0028] (3) The SNP molecular marker, primer and kit provided by the application have important application value in the breeding process of the new salt-tolerant variety of the golden mandarin fish, and the SNP molecular marker is not affected by factors such as individual age and gender, and can be used for early screening of the golden mandarin fish, thereby significantly shortening the development cycle of the new salt-tolerant variety. BRIEF DESCRIPTION OF DRAWINGS

[0029] The application will be further described below with reference to the accompanying drawings and examples.

[0030] Figure 1 The SNP Manhattan plot obtained in Example 1 is shown in the figure, and the black arrow is the SNP molecular marker in the application;

[0031] Figure 2 The P-value generalized linear model QQ plot of the genomic SNP of the salt-tolerant trait of the golden mandarin fish in Example 1 is shown in the figure, the horizontal coordinate Expected -log 10 (p) is the expected -log 10 (p), and the vertical coordinate Observed -log 10 (p) is the observed -log 10 (p);

[0032] Figure 3 The verification result of Sanger sequencing of the SNP 14:19975383 marker in Example 3 is shown in the figure, note: Tolerance indicates the extreme salt-tolerant population, Intolerance indicates the extreme salt-intolerant population, the vertical coordinate Individual Number refers to the number of individuals, and the horizontal coordinate Sanger sequencing refers to Sanger sequencing. DETAILED DESCRIPTION

[0033] In order to more clearly illustrate the purpose, technical scheme and advantages of the application, the application will be described in detail below with reference to the accompanying drawings and examples. It should be noted that the specific examples described are only used to explain the content of the application, and do not limit the scope of the application. Unless otherwise defined, all technical and scientific terms in this document are consistent with the meanings understood by those skilled in the art.

[0034] Unless otherwise specified, the reagents or materials used in the examples are obtained from commercial channels. Unless otherwise specified, the experimental instruments used are conventional laboratory instruments.

[0035] Example 1 Screening of SNP molecular marker, primer and kit related to salt-tolerant trait of golden mandarin fish

[0036] In this embodiment, about 1000 individuals of M. amblycephala were randomly used for acute salinity stress, and the survival time of M. amblycephala under high-salt acute stress was recorded.

[0037] The survival time is defined as the total time (s) from the start of the experiment to the loss of consciousness of M. amblycephala under acute high-salt stress.

[0038] By adding seawater to the cement pool (15 × 15 × 2 m 3 ), the salinity of the cultured water was gradually increased, and the salinity was monitored in real time by a salinity meter. When the salinity of the cultured water reached 25‰, the addition of seawater was stopped, and the swimming state of M. amblycephala was observed. When M. amblycephala lost consciousness and was in a coma, it was immediately fished out, the coma time was recorded, and the tail fin was cut and placed in a 1.5 mL centrifuge tube.

[0039] After sampling, the M. amblycephala was transferred to a freshwater pool, and the time was counted from the first M. amblycephala in a coma. The coma time of M. amblycephala was used as the salt tolerance trait of M. amblycephala. The first individual to be stressed and comatose was the salt-sensitive group, and the last individual to be stressed and comatose was the salt-tolerant group.

[0040] Finally, 277 individuals were selected as experimental materials for whole-genome association analysis of the salt tolerance trait of M. amblycephala, including 138 individuals in the extreme tolerance group and 139 individuals in the extreme intolerance group.

[0041] The experimental procedure for whole-genome association analysis of the salt tolerance trait of M. amblycephala is as follows:

[0042] DNA was extracted from the tissues of the mandarin fish using the HiPure Tissue DNA Mini Kit. The DNA was then used to construct a library for ddRAD-seq and sequencing. The sequence data was aligned to the mandarin fish reference genome (NCBI Assembly: GCA_011952085.1) using the Bowtie (v2.0) software, with an alignment rate of 93.00%. BCFtools was used to filter low-quality sequencing sites and generate a vcf format file, and a total of 4,241,496 SNPs were identified. To ensure the reliability of subsequent whole genome association analysis results, the vcf format file was filtered and quality controlled using PLINK, and finally a total of 59,285 SNPs were obtained. Based on the quality-controlled vcf file, whole genome association analysis (GWAS) was performed on the test individuals using TASSEL 5.0. The kinship of the test experimental population was calculated by TASSEL 5.0, and principal component analysis (PCA) was performed on the test experimental population. The genomic inflation factor (λ) of the experimental population was calculated to estimate the population stratification of the test individuals. Next, a generalized linear model (GLM) was used to analyze the phenotype data, PCA, and genotype data. The Bonferroni method was used to select the significance threshold. Finally, data visualization was completed using R Studio, and the R package "CMplot" was used to draw the Manhattan plot and the QQ plot.

[0043] Based on the above whole genome association analysis GWAS, a highly significant SNP was obtained. Further screening obtained the SNP located at position 19975383 on chromosome 14, denoted as SNP 14:19975383.

[0044] The Manhattan plot is a visualization chart that takes chromosome position as the horizontal axis and statistical significance as the vertical axis. It intuitively displays the gene regions related to the target phenotype in GWAS analysis. By observing Figure 1 the peak value on the Manhattan plot, the distribution of the significant SNP (single nucleotide polymorphism, indicated by a black arrow) located at position 19975383 on chromosome 14 in the present application can be quickly identified. These significant SNPs may reflect genetic variations associated with specific diseases or phenotypes.

[0045] SNP 14:19975383 is located at position 183 of the sequence shown as SEQ ID NO: 1, and its mutation type is G / T.

[0046] The SNP molecular marker related to the salt tolerance trait of the mandarin fish is located in the sequence as follows:

[0047] GCAAACCTCGGTTAGTAATGTAAAGCATTTAAAAGTACACTCTTTACTGTAGACATATCCTGCTTGCCCCCATTATAGGTAGGTAGTAGTAGGTAGTTGGTGATGTGTTTAGTCACTGATTGGAAAGCACACAGGAAGCAACAAATCACATCTTCACACTAAAACTTGCTCACTGCTGTTCC G / T AAACAGCAGTGAGCAAGTTTTAGTGTGAAGTTGTGTCAAGTTGTCCCCTGCTGTCCCCCAGATAGCTGGGCTTAACCATTAAAGGTTAAACTAAAGTAGGTATGTTATTTGATTATAATTTCAGTAGAAATACCTAATTTTGACCATTGCATGTCACTAACAATATTTAATTGAAGGGTTCCTTTAAAAAAAATGTGTCTGTCGGGGCCCACCCCTTTGTATTTAGTTTTTTTAAAAACTGGACCTGCTCTGAATCAAACAACCGAT (as shown in SEQ ID NO: 1), and the SNP molecular marker is shown by italic underlining.

[0048] Figure 2 The QQ plot of the P value of the genome SNP of the Procyprinus palpebrosus salt tolerance trait is shown in Figure 1. The genome inflation factor (λ) value is 1.019, indicating that there are few false positive signals in the results of the present study, and the results are reliable. The detailed explanation is as follows: In the present embodiment, the general linear model (GLM) model is used to perform whole genome association analysis on the Procyprinus palpebrosus salt tolerance trait and genotype data. The genome inflation factor is a statistical index commonly used in whole genome association studies, which is used to evaluate whether there is an excessive inflation of false positive association signals in the GWAS results compared with the expected value. The calculation of the genome inflation factor usually uses the λ value to represent. The λ value is the ratio between the median of the actual observed P value distribution and the expected median. If the λ value is equal to 1, it indicates that there is no excessive inflation of false positive signals in the GWAS results. If the λ value is greater than 1, it indicates that there is an excessive inflation of false positive signals. In general, the larger the λ value, the greater the impact of false positive signals in the GWAS results. In the present study, the Kinship+Q5 model is combined to calculate the optimal λ value of the whole genome association analysis results of the Procyprinus palpebrosus salt tolerance trait, and the result shows that the genome inflation factor (λ) value of the Procyprinus palpebrosus salt tolerance trait is 1.019. The result shows that there are few false positive signals in the results of the present study, and the results are reliable and have important research value.

[0049] The application also uses software Primer 5 to design primers for detecting SNP molecular markers related to the salt tolerance trait of the Procyprinus, including forward primer SNP 14:19975383-F and reverse primer SNP 14:19975383-R, the sequences of the forward primer SNP 14:19975383-F and the reverse primer SNP 14:19975383-R are shown in SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0050] Specifically,

[0051] The sequence of the forward primer SNP 14:19975383-F is:

[0052] 5'-CTCGGTTAGTAATGTAAAG-3' (shown in SEQ ID NO: 2);

[0053] The sequence of the reverse primer SNP 14:19975383-R is:

[0054] 5'-GTTTGATTCAGAGCAGGT-3' (shown in SEQ ID NO: 3).

[0055] The primer can specifically amplify the target fragment.

[0056] The application also provides a kit for detecting SNP molecular markers related to the salt tolerance trait of the Procyprinus, which includes the primers and 2X Taq PCR Master Mix and other related reagents.

[0057] Example 2

[0058] The method for breeding the Procyprinus with the salt tolerance trait provided in the embodiment includes the following steps:

[0059] (1) Extracting fin DNA of the Procyprinus to be tested;

[0060] (2) Using the primers for detecting SNP molecular markers related to the salt tolerance trait of the Procyprinus in Example 1 to perform PCR amplification on the extracted DNA to obtain an amplification product;

[0061] (3) Sequencing and analyzing the amplification product to determine the genotype of the SNP molecular marker of the Procyprinus to be tested, and then analyzing and determining whether the Procyprinus to be tested has the potential of the salt tolerance trait.

[0062] In the PCR amplification in step (2):

[0063] The reaction system of PCR amplification comprises 10 μL of 2X Taq PCR MasterMix, 3 μL of genomic DNA, 1 μL of forward primer, 1 μL of reverse primer and 5 μL of PCR-grade water in a total volume of 20 μL.

[0064] The PCR amplification procedure is as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 20 s, a total of 35 cycles, final extension at 72°C for 10 min, and preservation at 4°C.

[0065] The "T" allele in step (3) is a preferred gene, and the salt tolerance of GT and TT individuals containing the allele is significantly better than that of GG genotype individuals.

[0066] That is, the PCR amplification product in step (3) is sequenced to obtain a sequencing result, and based on the sequencing result, it is determined whether the SNP marker genotype of the to-be-tested Mandarin fish is a TT or GT individual; that is, the SNP 14:19975383 molecular marker is detected to screen individuals with TT or GT genotypes.

[0067] Further, the method for breeding Mandarin fish with salt tolerance provided in the embodiment comprises the following steps:

[0068] (1) cutting fin rays of a tail fin of a to-be-tested Mandarin fish;

[0069] (2) storing the fin rays in anhydrous ethanol;

[0070] (3) extracting genomic DNA of the to-be-tested Mandarin fish;

[0071] (4) performing PCR amplification on the genomic DNA of the to-be-tested Mandarin fish by using the primers or kit in the embodiment 1 to obtain a PCR amplification product;

[0072] (5) sequencing the PCR amplification product to obtain a sequencing result;

[0073] (6) determining, based on the sequencing result, whether the SNP marker genotype of the to-be-tested Mandarin fish is a TT or GT genotype individual.

[0074] Example 3: Verification of SNP molecular marker

[0075] Test materials: 1000 Mandarin fish were randomly selected, and 96 extreme phenotype individuals (48 salt-tolerant individuals and 48 salt-intolerant individuals) were selected from the 1000 Mandarin fish, and the DNA of the 96 Mandarin fish was extracted by using a conventional method to verify the effectiveness of the SNP marker.

[0076] Sequences 250 bp upstream and downstream of the SNP molecular marker in Example 1 were obtained using Samtools.

[0077] The primers in Example 1 were designed by using software Primer 5.

[0078] PCR was performed in a 20 μL reaction volume, in which the PCR reaction solution included 10 μL 2X PCR Master Mix and 3 uL 10 ng / μL genomic DNA, 5 μL PCR grade water, 1 μL forward and reverse primers.

[0079] PCR amplification reaction was performed using the following thermal cycling program: one cycle at 95 °C for 3 min, 35 cycles at 95 °C for 30 s, at 60 °C for 30 s and at 72 °C for 30 s, and then final extension at 72 °C for 10 min.

[0080] The PCR products were detected by 1.7% agarose gel electrophoresis.

[0081] Then the PCR products were sequenced using ABI3730XL sequencer. By using software Snapgene, the sequencing files were used to detect the genotypes of the 96 individuals for the SNP.

[0082] In order to validate the SNPs identified by GWAS in Example 1, SNP 14:19975383 was selected for validation using Sanger sequencing. In addition, 96 extreme phenotype individuals (salt-tolerant population: 48; salt-intolerant population: 48) were selected for genotyping in the fish used in the experiment.

[0083] The results are shown in Figure 3 As shown, two alleles (G / T) and three genotypes (GG / GT / TT) were observed at this SNP site, and the results showed that the "T" allele was the dominant allele, and the "G" allele was the recessive allele, and the TT genotype and GT genotype individuals had better salt tolerance performance. The SNP genotyping data of Sanger sequencing showed that the obtained SNP marker SNP 14:19975383 was significantly associated with salt tolerance (P<0.0001; Chi-square test). In SNP 14:19975383, individuals with TT or GT genotype had better salt tolerance performance, and individuals containing T base at base 19975383 of chromosome 14 of Procyprinus prolocus were likely to have better salt tolerance traits, and individuals of Procyprinus prolocus containing TT or GT genotype were more resistant to salinity, and individuals of Procyprinus prolocus containing TT genotype were best resistant to salinity.

[0084] Therefore, the correlation analysis of the genotype and the salt tolerance trait shows that the salt tolerance of the individuals with TT and GT genotypes is significantly better than that of the individuals with GG genotype. The SNP molecular marker in the application is significantly correlated with the salt tolerance trait. The individuals with TT or GT genotypes can be screened out by the application, so that the mandarin fish with the salt tolerance trait can be screened out.

[0085] The above examples are only used for illustrating the present application, and the protection scope of the present application is not limited to the above examples. The person skilled in the art can realize the purpose of the present application according to the above disclosed content of the present application, and any improvement and deformation based on the concept of the present application also falls into the protection scope of the present application, and the specific protection scope is recorded in the claims.

Claims

1. A method for breeding a Procyprinus procyprinus with salt tolerance, characterized in that, It comprises the following steps: (1) extracting fin DNA of the individual of the to-be-tested Procyprinus; (2) using the primer pair for detecting the SNP molecular marker related to the salt-tolerant trait of the Procyprinus to perform PCR amplification on the extracted DNA to obtain an amplification product; (3) performing sequencing analysis on the amplification product to determine the genotype of the SNP molecular marker of the to-be-tested Procyprinus individual, and then analyzing and determining whether the to-be-tested Procyprinus individual has the potential of the salt-tolerant trait; The SNP molecular marker in step (3) is located at the 183th position of the sequence shown as SEQ ID NO: 1, and the mutation type thereof is G / T; The T allele gene in step (3) is a preferred gene, and the salt-tolerant ability of the GT and TT individuals containing the allele gene is significantly better than that of the GG genotype individuals.

2. The method for breeding mandarin fish with salt tolerance according to claim 1, characterized in that, The primer in step (2) comprises a forward primer SNP 14:19975383-F and a reverse primer SNP 14:19975383-R, the sequence of the forward primer SNP 14:19975383-F is shown as SEQ ID NO: 2, and the sequence of the reverse primer SNP 14:19975383-R is shown as SEQ ID NO:

3.

3. The use of the reagent for detecting the SNP molecular marker related to the salt-tolerant trait of the Procyprinus, in the selection of the Procyprinus with the salt-tolerant trait, characterized in that, The SNP molecular marker is located at the 183th position of the sequence shown as SEQ ID NO: 1, and the mutation type thereof is G / T, wherein the T allele gene is a preferred gene, and the salt-tolerant ability of the GT and TT individuals containing the allele gene is significantly better than that of the GG genotype individuals.

4. The use of a primer for detecting a SNP molecular marker related to the salt tolerance trait of the Procyprinus, or a kit comprising the primer in the breeding of the Procyprinus with the salt tolerance trait, characterized in that, The SNP molecular marker is located at the 183th position of the sequence shown as SEQ ID NO: 1, and the mutation type thereof is G / T, wherein the T allele gene is a preferred gene, and the salt-tolerant ability of the GT and TT individuals containing the allele gene is significantly better than that of the GG genotype individuals.

5. Use according to claim 4, characterized in that, The primer comprises a forward primer SNP 14:19975383-F and a reverse primer SNP 14:19975383-R, the sequence of the forward primer SNP 14:19975383-F is shown as SEQ ID NO: 2, and the sequence of the reverse primer SNP 14:19975383-R is shown as SEQ ID NO:

3.

6. The method of claim 1 or 2 is applied to the selection of the Procyprinus with the salt-tolerant trait.

Images