Primer pair for identifying three types of concha ostreae belonging to ligulate bone and detection method

Abstract

The invention discloses a primer pair and a detection method for identifying three types of concha ostreae belonging to ligulate bone, and belongs to the field of biochemistry and molecular biology, the forward primer sequence of the primer pair is 5 '-TGGTGGGCGGTGTTTCCTGAT-3', and the reverse primer sequence of the primer pair is 5 '-TGGTGGGCGGTGTTTCCTGAT-3'; the sequence of a reverse primer of the primer pair is 5 '-CGTAGTGAAAATGTCCTGTAA-3', and the three kinds of concha ostreae of the ligulate bone concha ostreae are the concha ostreae of the ligulate bone, the concha ostreae of the Chinese ligulate bone and the concha ostreae of the different shell ligulate bone. The invention also provides a method for detecting by using the primer pair, and the method can realize classification and identification of ligulate-bone oysters, Chinese ligulate-bone oysters and different-shell ligulate-bone oysters, and has the characteristics of rapidness, high efficiency and accuracy.

Description

Technical Field

[0001] The invention belongs to the field of biochemistry and molecular biology, and particularly relates to a primer pair and a detection method for identifying three species of oysters of the genus Crassostrea. Background Art

[0002] Due to the changeable shell shape, the accurate classification and identification of oysters has always been based on DNA barcode sequences. The mitochondrial genome evolves rapidly, so it is widely used in species classification and identification, adaptive evolution and other studies. Among them, the mitochondrial cytochrome c oxidase I (i.e., cox1) gene is the most commonly used DNA barcode marker in the classification and identification of molluscs, and is widely used in oyster species identification. Such as a method for rapid identification of four species of giant oysters (publication number CN117025785A), a mitochondrial PCR-RFLP identification method for rock oysters and long oysters (publication number CN107828875A), a primer combination, application and identification method and kit for specific multiple PCR identification of common Chinese oysters (publication number CN117551791A), a method for rapid identification of four species of giant oysters (publication number CN117025785A), and a PCR-RFLP identification method for seven species of giant oysters in the coastal areas of South China (publication number CN101130815A). The above studies using cox1 gene fragments to identify oysters have all focused on oysters of the family Ostrichidae, while there have been few studies on oysters of the family Ostrichidae, especially the oysters of the genus Crassostreae that are distributed in China. Crassostreae hyoides, Crassostreae sinensis and Crassostreae heterohyoides are the most common oysters of the genus Crassostreae in China, with great economic value. They are commonly known as "stone oysters" in Weizhou Island, but it is difficult to accurately classify and identify the three types of stone oysters based solely on morphological characteristics, which has affected the protection, development and utilization of stone oyster germplasm resources. Practice has shown that the cox1 universal primer (Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome coxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299) cannot effectively amplify cox1 in oysters of the genus Crassostrea. Hu Lisha (Study on the classification of the family Ostridia and some other genera and phylogeny of the cat's claw oyster in China's coastal waters. Qingdao: University of the Chinese Academy of Sciences (Institute of Oceanology, Chinese Academy of Sciences)) did not use the cox1 marker when studying oysters of the family Ossostrea in China's coastal waters. Although a primer and method for identifying the mitochondrial genome sequence and DNA barcode of Crassostrea have been developed in China (Publication No. CN115786533A), this method requires two PCR reactions and cannot identify the species.In foreign countries, although Garzia & Salvi (Garzia M, Salvi D (2024) Molecular characterization and phylogenetic position of the giant deep-sea oyster Neopycnodonte zibrowii Gofas, Salas & Taviani, 2009. Zoosystems and Evolution 100: 111-118) provided a primer sequence for amplifying the cox1 of the oyster Crassostrea heterohyoides, there are special modifications in the sequence, and the cost of primer synthesis is high, which affects its widespread use. Therefore, there is a lack of primers and methods that can quickly and efficiently amplify the cox1 gene fragment of the oyster Crassostrea heterohyoides for species identification. Summary of the invention

[0003] In view of the problems existing in the prior art, the present invention discloses a primer for PCR amplification of a mitochondrial cox1 gene fragment of an oyster of the genus Crassostrea and a use method thereof, providing a rapid and accurate method for the classification and identification of oysters of the genus Crassostrea.

[0004] The first object of the present invention is to provide a primer pair for identifying three species of oysters of the genus Crassostreae, wherein the forward primer sequence of the primer pair is: 5'-TGGTGGGCGGTGTTTCCTGAT-3' (SEQ ID NO.1); the reverse primer sequence of the primer pair is: 5'-CGTAGTGAAAATGTCCTGTAA-3' (SEQ ID NO.2), and the three species of oysters of the genus Crassostreae are Crassostreae hyoides, Crassostreae sinensis and Crassostreae heterohyoides.

[0005] The second object of the present invention is to provide a method for identifying three species of oysters of the genus Crassostrea using the above primer pair, the method comprising DNA extraction, PCR amplification, sequencing and bioinformatics analysis.

[0006] Furthermore, the PCR amplification program is: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 50°C for 20 s, extension at 72°C for 30 s, 34 cycles; final extension at 72°C for 5 min.

[0007] Furthermore, the PCR amplification system is: 5 μL 2×Hieff PCRMasterMix, 0.5 μL each of forward and reverse primers, 2 μL template DNA solution, and finally add ddH2O to 10 μL.

[0008] Furthermore, the cox1 sequences of the standard sequences of three species of oysters in the genus Hyotissa, and the cox1 sequence of the Hyotissa oyster is (SEQ ID NO.3):

[0009] ATGCGTTGGGAGTTTGTGGTAGCTGGCTTTTATAACGCAATTGCTGGGTATGATATCTTTTATCCTAAGTATATTAATTTTGTGACTCATCGGGTTTTGATAACTACGAATCATTTAGTGGTGGGATCTTTGTATTTTTATGTGGGTATGTGATCGGCTATAAACGGCACTGGATGGAGTCTTAACATTCGACTTCATCTGGCTAAGCCTGGGGGGGGATTTATGGATGCGATTACTTATAATATGGCTGTGACTAATCATGCTCTTATAATGATTTTTTTCTTTGTGATGCCGGTTTTAATCGGGGGGTTTGGAAATTGGCTTGTGCCTCTTATGCTAAAGGTTCCTGATATGCAATTTCCTCGGGTTAATGCGTTTAGATTTTGGGCGTTAATTCCGGCTTTGTATTTTATTACTGTCTCTTCTTGGATTGAAAATGGTGTAGGAACTGGCTGGACTTTGTACCCGCCTCTTAGGGGGGACGAGTACCATGGAATTTGTGTTGATACTAGGGTGATGTCTTTGCATATTGCTGGGATCAGGTCTATTTTCAGGTCGATGAATTTTGTTGTTAGGGCTCACAATATGCGGATGGTTCATGGGCATAGGTTAAATCTTTTCCCATGGGGTGTGAGGGTGACTTCAATTTTATTGCTGGGAGCGTTGCCTGTTTTGGCTGGTGGATTGACAATGTTGTTAGCGGATCGTCATTTTAATACGAGATTTTTTGACATAGGAGGGGGGGGGGATGCTATTCTCTTCCAGCATCTCTTTTGGTTCTTCGGTCATCCCGAGGTTTATGTCTTAATTCTTCCGGGATTTGGAATTATTTCTCATGTAGTGACTTTTTGGTCGAATAAA;

[0010] The cox1 sequence of *Crassostrea sinoguloidea* is (SEQ ID NO.4): ACATGAGCAGGGATTATTGTGAGTGGGGTGTATAACGGCATGGAAAGTTATGAATACTTATATCCCAAGTATATCAGATTCGTGACGCACCGTGTTTTGATAACAACTAACCATTTGGTAGTGGGGTCCCTATATTTTTATGTGGGCATATGGTCGGCCATGAATGGGACGGGGTGAAGAATGAGTATTCGATTTCATTTGGCTAAGCCGGGGGGGGGATTTATAGATGCTATCACCTATAATATAGCTGTCACTAATCACGCTCTAATGATGATTTTTTTCTTTGTGATGCCTGTTTTAATTGGCGGATTCGGTAATTGGCTTGTGCCTTTAATACTAAAGGTTCCTGACATGCAATTTCCGCGGGTTAATGCATTTAGGTTTTGGGCTTTGATTCCGGCTCTTTACTTTATTACCGTTTCTTCATGAATTGAGAATGGCGTAGGGACTGGCTGAACTCTGTATCCACCTCTTAGGGGAGAAGAGCACCACGGAATTTGTGTTGATACCAGGGTGATATCTTTGCACATTGCTGGAATTAGATCTATTTTTAGATCGATGAATTTTGTTGTTAGGGCTCACAATATGCGGATAGTCCATGGCCACAGGCTTAACTTATTTCCGTGAGGGGTGAGGGTGACTTCAGTTTTGCTGCTAGGCGCCTTGCCTGTTTTGGCTGGTGGATTGACAATGCTTTTGGCAGATCGGCATTTTAACACGAGATTTTTTGATATGGGTGGGGGGGGGGATGCAGTGTTGTTTCAACACTTATTTTGGTTTTTTGGCCACCCGGAGGTCTATGTCCTAATTCTTCCTGGATTTGGTATTATTTCTCACGTAGTAACTTTTTGGTCTAATAAA;

[0011] The cox1 sequence of *Hyotissa anomala* is (SEQ ID NO.5): GCATGGGAAGATATCCCTATGTTCGTAGTTCTTTATTCTATAGAACTTTATGATTTTGTGTATCCCAAGTATTTAAATTTTATAACCCATCGTGTTTTAATAACAACGAATCATTTAGTGGTAGGGTCGTTGTATTTTTATTTGGGAATGTGGTCAGCTATAAACGGGACTGGGTGGAGGGTTAATATTCGACTCCATTTGGCTAAACCGGGTGGGGGTTTCATAGATTCGATCACTTATAATATAGCTGTGACTAATCACGCTCTTATGATAATTTTTTTTTTTGTGATGCCTGTTTTAATTGGGGGGTTTGGTAATTGACTAGTGCCTCTTATGTTGAAGGTTCCGGATATGCAGTTTCCTCGAGTTAATGCGTTTAGGTTTTGAGCGTTAATTCCTGCTCTTTATTTTATTTCTATTTCTTCGTGAATTGAAAATGGTGTGGGGACTGGTTGGACTCTTTATCCTCCTTTAAGAGGTGATGAGTACCATGGAATTTGTGTTGATACAAGGGTTATATCTTTACATATTGCTGGAATTAGGTCTATTTTTAGTTCAATAAATTTTGTAGTTAGAGCTCATAACATGCGTATGGTTCATGGGCATATACTTAATCTTTTCCCTTGAGGTGTGAGGGTAACTTCAGTTTTGTTGTTAGGGGCTCTGCCTGTTTTAGCGGGAGGATTGACTATATTGCTTGCCGATCGCCATTTTAATACAAGTTTTTTTGATATAGGAGGCGGAGGTGATGCGGTGCTTTTTCAGCATTTGTTTTGGTTTTTTGGTCATCCTGAAGTTTATGTATTAATTCTTCCGGGGTTTGGAATTATTTCTCATGTTGTAACGTTTTGGTCTAATAAA。

[0012] The beneficial effects of the present invention compared with the prior art: Compared with the cox1 primer sequence for amplifying Crassostrea heterohyoid oyster provided by Garzia & Salvi (2024) (the sequence has been specially modified), the primers for identifying Crassostrea genus oysters provided by the present invention are suitable for amplifying mitochondrial cox1 gene fragments of three oysters, namely Crassostrea hyoid oyster, Crassostrea sinensis and Crassostrea heterohyoid oyster. At the same time, the primer sequence does not contain special modifications and has a low synthesis cost, so it is applicable to more scenarios; compared with a Crassostrea hyoid oyster mitochondrial genome sequence and Crassostrea hyoid oyster DNA barcode identification primers and method (publication number CN115786533A), the method for identifying three types of Crassostrea oysters provided by the present invention can identify more oyster varieties and can be completed in one PCR reaction. At the same time, the present invention provides standard cox1 sequences of three types of Crassostrea oysters, which can achieve accurate identification through sequence alignment with higher accuracy. The present invention is applicable to the classification and identification of three common oysters of the genus Crassostreae, namely, Crassostrea hyoides, Crassostrea sinensis and Crassostrea heterohyoides. By verifying the effectiveness of amplification of mitochondrial cox1 gene sequences of other Crassostreae oysters and further supplementing and improving the standard cox1 sequence, the present invention may be able to identify more Crassostreae oysters and has the potential to become a universal cox1 sequence primer for Crassostreae oysters. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is a general schematic diagram of the present invention;

[0014] Figure 2 This is the sequence alignment result in bioinformatics analysis. DETAILED DESCRIPTION

[0015] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments.

[0016] like Figure 1-2 As shown, this embodiment provides a primer and a method for using the primers for identifying three species of oysters of the genus Crassostrea, the primers comprising a forward primer and a reverse primer, the forward primer sequence being TGGTGGGCGGTGTTTCCTGAT, the reverse primer sequence being CGTAGTGAAAATGTCCTGTAA; the method for using the primers comprises DNA extraction, PCR amplification, sequencing and bioinformatics analysis, the PCR amplification comprising a PCR amplification procedure and a PCR amplification system, the PCR amplification procedure comprising pre-denaturation, denaturation-annealing-extension and final extension, the PCR amplification system comprising primers, template DNA, ddH2O and mix enzyme, and the bioinformatics analysis comprising standard sequence selection and sequence alignment.

[0017] As a preferred embodiment, the temperature and time of each stage in the PCR amplification program are: 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 50°C annealing for 20 seconds, 72°C extension for 30 seconds, 34 cycles; 72°C final extension for 5 minutes.

[0018] As a preferred embodiment, the content of each reactant in the PCR amplification system is: 5 μL 2×Hieff PCR Master Mix, 0.5 μL each of forward and reverse primers, 2 μL template DNA solution, and finally add ddH2O to 10 μL.

[0019] As a preferred embodiment, the standard sequence is a cox1 gene fragment sequence of three species of oysters of the genus Crassostrea (Crassostrea hyoides, Crassostrea sinensis, and Crassostrea heterohyoides), and the cox1 gene fragment sequence of the Crassostrea hyoides is

[0020] ATGCGTTGGGAGTTTGTGGTAGCTGGCTTTTATAACGCAATTGCTGGGTATG

[0021] ATATCTTTATCCTAAGTATATTAATTTTGTGACTCATCGGGTTTTGATAACTA

[0022] CGAATCATTAGTGGTGGGATCTTTGTATTTTTATGTGGGTATGTGATCGGCT

[0023] ATAAACGGCACTGGATGGAGTCTTAACATTCGACTTCATCTGGCTAAGCCT

[0024] GGGGGGGGATTTATGGATGCGATTACTTATAATATGGCTGTGACTAATCATG

[0025] CTCTTATAATGATTTTTTTCTTTGTGATGCCGGTTTTAATCGGGGGGTTTGGA

[0026] AATTGGCTTGTGCCTCTTATGCTAAAGGTTCCTGATATGCAATTTCCTCGGG

[0027] TTAATGCGTTTAGATTTTGGGCGTTAATTCCGGCTTTGTATTTTATTACTGTC

[0028] TCTTCTTGGATTGAAAATGGTGTAGGAACTGGCTGGACTTTGTACCCGCCT

[0029] CTTAGGGGGGACGAGTACCATGGAATTTGTGTTGATACTAGGGTGATGTCT

[0030] TTGCATATTGCTGGGATCAGGTCTATTTTCAGGTCGATGAATTTTGTTGTTA

[0031] GGGCTCACAATATGCGGATGGTTCATGGGCATAGGTTAAATCTTTTCCCATG

[0032] GGGTGTGAGGGTGACTTCAATTTTATTGCTGGGAGCGTTGCCTGTTTTGGC

[0033] TGGTGGATTGACAATGTTGTTAGCGGATCGTCATTTTAATACGAGATTTTTT

[0034] GACATAGGAGGGGGGGGGGATGCTATTCTCTTCCAGCATCTCTTTTGGTTC

[0035] TTCGGTCATCCCGAGGTTTATGTCTTAATTCTTCCGGGATTTGGAATTATTTCTCATGTAGTGACTTTTTGGTCGAATAAA;

[0036] The sequence of the cox1 gene fragment of Ostrea lingulata is as follows:

[0037] ACATGAGCAGGGATTATTGTGAGTGGGGTGTATAACGGCATGGAAAGTTAT

[0038] GAATACTTATATCCCAAGTATATCAGATTCGTGACGCACCGTGTTTTGATAA

[0039] CAACTAACCATTTGGTAGTGGGGTCCCTATATTTTTATGTGGGCATATGGTC

[0040] GGCCATGAATGGGACGGGGTGAAGAATGAGTATTCGATTTCATTTGGCTAA

[0041] GCCGGGGGGGGGATTTATAGATGCTATCACCTATAATATAGCTGTCACTAAT

[0042] CACGCTCTAATGATGATTTTTTTCTTTGTGATGCCTGTTTTAATTGGCGGATT

[0043] CGGTAATTGGCTTGTGCCTTTAATACTAAAGGTTCCTGACATGCAATTTCCG

[0044] CGGGTTAATGCATTTAGGTTTTGGGCTTTGATTCCGGCTCTTTACTTTATTAC

[0045] CGTTTCTTCATGAATTGAGAATGGCGTAGGGACTGGCTGAACTCTGTATCC

[0046] ACCTCTTAGGGGAGAAGAGCACCACGGAATTTGTGTTGATACCAGGGTGA

[0047] TATCTTTGCACATTGCTGGAATTAGATCTATTTTTAGATCGATGAATTTTGTT

[0048] GTTAGGGCTCACAATATGCGGATAGTCCATGGCCACAGGCTTAACTTATTTC

[0049] CGTGAGGGGTGAGGGTGACTTCAGTTTTGCTGCTAGGCGCCTTGCCTGTTT

[0050] TGGCTGGTGGATTGACAATGCTTTTGGCAGATCGGCATTTTAACACGAGAT

[0051] TTTTTGATATGGGTGGGGGGGGGGATGCAGTGTTGTTTCAACACTTATTTTG

[0052] GTTTTTTGGCCACCCGGAGGTCTATGTCCTAATTCTTCCTGGATTTGGTATTATTTCTCACGTAGTAACTTTTTGGTCTAATAAA;

[0053] The cox1 gene fragment sequence of *Hyotissa anomala* is as follows:

[0054] GCATGGGAAGATATCCCTATGTTCGTAGTTCTTTATTCTATAGAACTTTATGA

[0055] TTTTGTGTATCCCAAGTATTTAAATTTTATAACCCATCGTGTTTTAATAACAA

[0056] CGAATCATTTAGTGGTAGGGTCGTTGTATTTTTATTTGGGAATGTGGTCAGC

[0057] TATAAACGGGACTGGGTGGAGGGTTAATATTCGACTCCATTTGGCTAAACC

[0058] GGGTGGGGGTTTCATAGATTCGATCACTTATAATATAGCTGTGACTAATCAC

[0059] GCTCTTATGATAATTTTTTTTTTTGTGATGCCTGTTTTAATTGGGGGGTTTGG

[0060] TAATTGACTAGTGCCTCTTATGTTGAAGGTTCCGGATATGCAGTTTCCTCGA

[0061] GTTAATGCGTTTAGGTTTTGAGCGTTAATTCCTGCTCTTTATTTTATTTCTATT

[0062] TCTTCGTGAATTGAAAATGGTGTGGGGACTGGTTGGACTCTTTATCCTCCTT

[0063] TAAGAGGTGATGAGTACCATGGAATTTGTGTTGATACAAGGGTTATATCTTT

[0064] ACATATTGCTGGAATTAGGTCTATTTTTAGTTCAATAAATTTTGTAGTTAGAG

[0065] CTCATAACATGCGTATGGTTCATGGGCATATACTTAATCTTTTCCCTTGAGGT

[0066] GTGAGGGTAACTTCAGTTTTGTTGTTAGGGGCTCTGCCTGTTTTAGCGGGA

[0067] GGATTGACTATATTGCTTGCCGATCGCCATTTTAATACAAGTTTTTTTTGATAT

[0068] AGGAGGCGGAGGTGATGCGGTGCTTTTTCAGCATTTGTTTTGGTTTTTTGG

[0069] TCATCCTGAAGTTTATGTATTAATTCTTCCGGGGTTTGGAATTATTTCTCATGTTGTAACGTTTTGGTCTAATAAA.

[0070] In this example, six oysters of the genus Crassostrea collected in Weizhou Island, Guangxi were used as identification objects, and the steps of using the primers for identifying three oysters of the genus Crassostrea were as follows:

[0071] (1) DNA extraction: About 30 mg of adductor muscle tissue was collected from each oyster, and whole-genomic DNA was extracted using the TIANamp Marine Animal DNA Extraction Kit (Beijing Tiangen Biotechnology Co., Ltd.).

[0072] (2) PCR amplification: After DNA is extracted, the cox1 gene is amplified by PCR using the DNA barcode amplification primers, the preferred PCR reaction system and the procedure of the present invention.

[0073] (3) Sequencing: The PCR product was detected by 1% agarose electrophoresis gel and then sequenced in the forward direction using the Sanger sequencing method. The sequencing primers were the same as the PCR amplification primers, and the sequences sp1-sp6 were obtained by sequencing.

[0074] (4) Bioinformatics analysis: MEGA 11 software was used to align the sequenced sequences with the standard sequences of cox1 gene fragments of Crassostrea gigas, Crassostrea sinensis, and Crassostrea heterohyoides. The ClustalW alignment parameters were: GapOpening Penalty 15.00, Gap Extension Penalty 6.66, DNAWeight Matrix IUB, Transition Weight 0.50, Use Negative Matrix OFF, Delay Divergent Cutoff (%) 30. After alignment, the inconsistent length regions of the first and last segments of the sequenced sequences were manually trimmed, and the sequence order was manually adjusted based on the base consistency. The results showed that according to the consistency of the bases in the sequence, sp3 and sp6 belonged to Crassostrea sinensis, and sp1, sp2, sp4, and sp5 belonged to Crassostrea heterohyoides.

[0075] The primers and use methods for identifying three species of oysters of the genus Crassostreae provided by the present invention can accurately identify three common oysters of the genus Crassostreae, namely, Crassostreae hyoides, Crassostreae sinensis and Crassostreae heterohyoides. Therefore, the primers for identifying three species of oysters of the genus Crassostreae provided in the present invention have the potential to become universal cox1 sequence primers for oysters of the genus Crassostreae.

[0076] The above embodiments are only for illustrating the technical concept and features of the present invention, and cannot be used to limit the protection scope of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A primer pair for identifying three species of oysters of the genus Crassostrea, characterized in that: The forward primer sequence of the primer pair is shown as SEQ ID NO.1; the reverse primer sequence of the primer pair is shown as SEQ ID NO.2, and the three species of oysters of the genus Crassostrea are Crassostrea hyoides, Crassostrea sinensis and Crassostrea heterohyoides.

2. A method for identifying three species of oysters of the genus Crassostrea using the primer pair of claim 1, characterized in that: The method includes DNA extraction, PCR amplification, sequencing and bioinformatics analysis.

3. The method according to claim 2, characterized in that The PCR amplification procedure was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 50°C for 20 s, and extension at 72°C for 30 s, for 34 cycles; and final extension at 72°C for 5 min.

4. The method according to claim 2, characterized in that: The PCR amplification system is: 5 μL 2×Hieff PCR Master Mix, 0.5 μL each of forward and reverse primers, 2 μL template DNA solution, and finally add ddH2O to 10 μL.

5. The method according to claim 2, characterized in that: The cox1 sequence of the hyoid oyster is SEQ ID NO.1; The cox1 sequence of the Chinese oyster is SEQ ID NO.2; The cox1 sequence of the Crassostrea heterohyoidea is SEQ ID NO.3.

Images