A specific marker closely related to the regeneration efficiency of the pulp-dentin complex and its application

By screening the subpopulations of pulp stem cells using the NKD1 gene as a specific marker and using Wnt3a to induce the dentition differentiation path of these subpopulations, the problems of fluctuations in the regeneration efficacy and structural abnormalities of the pulp-dentin complex in the prior art are solved, and efficient regeneration of dentin tissue is achieved.

CN119824110BActive Publication Date: 2025-06-24CAPITAL UNIVERSITY OF MEDICAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510316739.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-06-24
Estimated Expiration
2045-03-18

AI Technical Summary

Technical Problem

The prior art has fluctuations in efficacy and structural abnormalities in the regeneration of the pulp-dentin complex, mainly due to the failure to identify stem cell subpopulations with high regeneration potential.

Method used

The NKD1 gene was used as a specific marker to identify and screen the subpopulations of pulp stem cells that can efficiently form repair dentin, and induced dentine differentiation paths to activate these subpopulations through Wnt3a.

Benefits of technology

Effective screening of the subpopulation of pulp stem cells with high regeneration efficiency is achieved, the regeneration efficiency of the pulp-dentin complex is improved, and dentin tissue with a typical tubular structure is formed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824110B_ABST
    Figure CN119824110B_ABST
Patent Text Reader

Abstract

The present invention provides a specific marker closely related to the regeneration efficiency of the pulp-dentin complex and its application. The specific marker includes the NKD1 gene and / or the expression product of the NKD1 gene. The present invention uses single-cell transcriptome sequencing combined with bioinformatics analysis methods to analyze the differentiation process of mesenchymal stem cells treated with Wnt3a, and finds that the NKD1 gene is specifically up-regulated in the subpopulation with odontogenic function, and this subpopulation is named the NKD1+ subpopulation. Further experiments prove that the NKD1+ subpopulation has obvious odontogenic differentiation ability. That is to say, the NKD1 gene can be used as a specific marker for the subpopulation with high regeneration efficiency in DPSCs and has important application value in detecting the regeneration efficiency of the pulp-dentin complex.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of stem cell therapy. Specifically, the present invention relates to a specific marker closely related to the regeneration efficiency of the pulp-dentin complex and its application. Background Art

[0002] The pulp-dentin complex maintains the vitality of teeth through reparative dentin formation, stress response, and homeostasis regulation. The loss of function of this complex (such as irreversible pulpitis) often leads to tooth fracture after root canal treatment, thus requiring tooth extraction. Therefore, the functional regeneration of the pulp-dentin complex is a key strategy for long-term tooth preservation. As the core functional cells of this complex, odontoblasts directly determine the efficiency of reparative dentin generation, and the elucidation of the mechanism of the odontogenic differentiation process has become an important focus in dental regenerative medicine.

[0003] In the past decade, various mesenchymal stem cells have been reported to be able to differentiate into odontoblasts, including dental pulp stem cells (DPSCs), stem cells from human exfoliated deciduous teeth (SHED), and stem cells from the apical papilla (SCAPs) for the regeneration of the pulp-dentin complex. However, new evidence shows that the transplanted stem cells mainly generate disordered bone-like tissues lacking a polarized odontoblast layer and tubular dentin structures. These findings emphasize the insufficiency of stem cell transplantation alone and highlight the necessity of targeted signal activation to promote the differentiation and functional regeneration of DPSCs.

[0004] CN105228557A proposes to activate DPSCs using Wnt3a protein to promote dentin regeneration. By injecting an alginate hydrogel material containing 10 ng / ml Wnt3a into the pulp cavity, pulp and dentin regeneration can be stimulated after 4 weeks. However, it does not distinguish stem cell subsets, resulting in fluctuating regeneration efficiency, and the regenerated tissue lacks a typical tubular structure. CN115161272A proposes to use 50 ng / ml of Wnt10a to enhance the alkaline phosphatase and alizarin red staining of DPSCs. However, no Western Blotting experiment was conducted to detect the changes in the expression of odontogenic differentiation-related proteins or other sequencing methods were used to verify the activation of odontogenic differentiation-related signals, so the initiation of the odontogenic differentiation fate of stem cells cannot be clarified.

[0005] The Wnt / β-catenin pathway plays a crucial regulatory role in the initiation, morphogenesis, and dentin formation of odontogenesis. Our previous studies have shown that local delivery of Wnt3a into the root canals of piglets can activate the canonical Wnt signal, promote the homing of endogenous SCAP, and functional regeneration of the pulp-dentin complex, characterized by the reconstruction of a polarized odontoblast layer, tubular dentin, and neurovascular network. Although these findings have established the indispensability of the canonical Wnt signal in pulp regeneration, the mechanisms by which different stem cell subsets recognize, transduce the Wnt signal, and execute reparative dentinogenesis remain unresolved. Increasing evidence suggests that only a small subset of stem cells drives tissue regeneration. For example, a recent study identified Krt14 with dual epithelial-mesenchymal characteristics + Ctsk + Osteoprogenitor cell population, as a determinant for induced osteogenesis in maxillary sinus floor elevation.

[0006] Therefore, there is an urgent need in the art to address issues such as fluctuating efficacy and structural abnormalities caused by the failure to identify subsets with high regenerative potential. Summary of the Invention

[0007] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide a specific marker closely related to the regeneration of the pulp-dentin complex and its application. The specific marker is a specific gene in mesenchymal stem cells, which can identify and screen out the subpopulation of dental pulp stem cells that can efficiently form reparative dentin, and solve the fluctuating efficacy caused by cell heterogeneity in the prior art.

[0008] To achieve this purpose, the present invention adopts the following technical solutions:

[0009] In a first aspect, the present invention provides a specific marker closely related to the regeneration efficiency of the pulp-dentin complex. The specific marker includes the NKD1 gene and / or the expression product of the NKD1 gene in mesenchymal stem cells, wherein the mesenchymal stem cells are the core cells promoting the regeneration of the pulp-dentin complex.

[0010] The NKD1 gene is a specific gene expressed during the regeneration of mesenchymal stem cells.

[0011] The present invention combines bioinformatics methods to analyze the highly odontogenic differentiating subpopulation of mesenchymal stem cells after odontogenic induction. Taking dental pulp stem cells (DPSCs) as an example, through differential expression analysis and the like, it was found that in DPSCs induced by the Wnt3a group, an uncharacterized Nkd1 was identified +A subpopulation of stem cells that exhibits secretory odontoblast-like functions. Based on this, it can be further inferred that in other dental mesenchymal stem cells that can differentiate into odontoblasts, such as stem cells from human exfoliated deciduous teeth or stem cells from the apical papilla, NKD1 + After high expression in the subpopulation of stem cells, it also has good regenerative ability.

[0012] Therefore, the NKD1 gene can be used as a specific marker for the subpopulation of mesenchymal stem cells with the function of differentiating into odontoblasts.

[0013] In a second aspect, the present invention provides the use of the NKD1 gene as a specific marker in detecting the regeneration efficiency of the pulp-dentin complex, and this use does not involve the diagnosis and treatment of diseases.

[0014] In the present invention, the NKD1 gene is a specific gene in mesenchymal stem cells, and the mesenchymal stem cells can be used for preparing or regenerating the pulp-dentin complex.

[0015] As a preferred technical solution of the present invention, the mesenchymal stem cells include any one or at least two combinations of dental pulp stem cells, stem cells from human exfoliated deciduous teeth, or stem cells from the apical papilla.

[0016] As a preferred technical solution of the present invention, the use includes preparing a kit for detecting the regeneration efficiency of the pulp-dentin complex.

[0017] As a preferred technical solution of the present invention, the kit includes a detection reagent for the NKD1 gene.

[0018] As a preferred technical solution of the present invention, the specific markers used in this use also include any one or at least two combinations of the LEPR gene and / or the expression product of the LEPR gene, the DSPP gene, the DMP1 gene, the Ki67 gene, or the MSX1 transcription factor.

[0019] In the present invention, in addition to finding that the NKD1 gene can be used as a specific marker, multiplex immunofluorescence of human dental pulp tissue also shows that LEPR is also an NKD1 + Specific marker for the subpopulation. The characteristic gene display of single-cell transcriptome samples also shows that the distribution of LEPR is similar to that of NKD1. Therefore, the present invention also includes co-labeling NKD1 and LEPR for screening mesenchymal stem cells with high regenerative ability.

[0020] In a third aspect, the present invention also provides a method for preparing a pulp-dentin complex with high regeneration efficiency, and the method includes screening a cell subpopulation that specifically expresses the NKD1 gene.

[0021] As a preferred technical solution of the present invention, the method includes: after treating dental mesenchymal stem cells with a dentinogenic inducer, detecting them using an NKD1 gene detection reagent, screening out cell subsets that specifically express the NKD1 gene, and then efficiently regenerating the pulp-dentin complex.

[0022] In the present invention, the "high efficiency" means that after screening out the cell subsets that specifically express the NKD1 gene, odontoblasts can be efficiently formed. The formation of odontoblasts plays a core role in the regeneration process of the pulp-dentin complex. Therefore, detecting the NKD1 gene can help prepare a pulp-dentin complex with high regeneration efficiency.

[0023] As a preferred technical solution of the present invention, the method further includes cell subsets that simultaneously specifically express the LEPR gene.

[0024] Preferably, the dentinogenic inducer includes Wnt3a or a small molecule activator of the Wnt signal.

[0025] Preferably, the small molecule activator of the Wnt signal includes CHIR99021, LiCl, R-spondin, BIO or AZD2858.

[0026] In the present invention, DPSCs were induced by Wnt3a, Wnt5a and Wnt10a groups respectively, and the comparison results confirmed the strong dentinogenic induction ability of Wnt3a.

[0027] Preferably, the dentinogenic inducer is Wnt3a.

[0028] Fourthly, the present invention also includes a pulp-dentin complex prepared by using the method as described in the third aspect.

[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0030] The present invention for the first time discovers that the NKD1 gene can be used as a specific marker for highly regenerative subsets of mesenchymal stem cells, and the proportion of target cells can reach more than 50%. That is to say, the NKD1 gene can play a screening role in the process of preparing the pulp-dentin complex, screening out mesenchymal stem cells with high regeneration efficiency, and then regenerating a pulp-dentin complex with better function, so as to achieve the purpose of long-term tooth preservation.

[0031] At the same time, Nkd1 induced by Wnt3a + Odontoblasts, as the key driving factors for functional pulp-dentin regeneration, provide mechanistic insights and therapeutic targets for clinical translation. Brief Description of the Drawings

[0032] Figure 1Results graphs of DPSCs in each group after ALP staining and ARS staining.

[0033] Figure 2 Comparison graphs of the expression levels of DSPP and DMP-1 in each group in the Western blot experiment.

[0034] Figure 3 Steps graph of sample processing and bioinformatics analysis.

[0035] Figure 4 Overall Umap graph of single-cell transcriptome data of the control, Wnt3a, Wnt5a, and Wnt10a groups.

[0036] Figure 5 GO enrichment analysis results graph of differentially expressed genes in the Wnt3a, Wnt5a, and Wnt10a groups.

[0037] Figure 6 Umap graph of cell transcriptome data clustering of the control, Wnt3a, Wnt5a, and Wnt10a groups.

[0038] Figure 7 GO enrichment analysis results graph of upregulated genes in subpopulation 3.

[0039] Figure 8 Feature graph of the differentially expressed gene NKD1 in subpopulation 3.

[0040] Figure 9 For NKD1 + Heatmap of the transcription factor regulatory network of the NKD1 subpopulation and the control group.

[0041] Figure 10 Results graph of NKD1 subpopulation distribution from immunofluorescence analysis of fully developed human molar sections. +

[0042] Figure 11 Results graph of NKD1 subpopulation distribution from immunofluorescence of the Wnt3a group and the control group in Example 4. +

[0043] Figure 12 Results graph of NKD1 subpopulation comparison between the Wnt3a group and the control group by flow cytometry. +

[0044] Figure 13 Results graph of NKD1 subpopulation distribution from immunofluorescence analysis of developing human molar sections. +

[0045] Figure 14 Results graph of NKD1 and DSPP mRNA signal analysis from in situ hybridization experiments on fully developed human molar sections. Detailed implementation manners

[0046] The technical solutions of the present invention will be further described below in conjunction with the accompanying drawings and through specific implementation manners. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of the protection of the rights of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0047] In the following examples, unless otherwise specified, the reagents and consumables used are purchased from conventional reagent manufacturers in the art; unless otherwise specified, the experimental methods and technical means used are conventional methods and means in the art.

[0048] Example 1 Cell culture

[0049] Human dental pulp stem cells (hDPSCs) were isolated from the wisdom teeth of healthy donors aged 18 to 25 years, in accordance with the protocol approved by the Ethics Committee of Capital Medical University. The cells were cultured in α-MEM (Gibco) at 37 °C and 5% CO2, supplemented with 10% fetal bovine serum (FBS, Gibco), 100 U / mL penicillin, and 100 mg / mL streptomycin (Gibco). To induce odontogenesis, the cells were cultured in an odontogenic differentiation medium (ODM: complete growth medium supplemented with 50 mg / L ascorbic acid, 10 mmol / L β-glycerophosphate, and 100 nmol / L dexamethasone).

[0050] The experimental groups used ODM supplemented with 50 ng / mL recombinant human Wnt3a (R&D Systems, 5036-WN-010), Wnt5a (Abcam, ab204627), or Wnt10a (Abcam, ab289784).

[0051] The blank control group used only the odontogenic induction medium.

[0052] Staining experiments, Western blotting experiments, and bioinformatics analysis were performed on the cells of the experimental group and the control group.

[0053] Example 2 Staining experiment and Western blotting experiment

[0054] This example includes performing staining experiments and Western blotting experiments on the induced DPSCs using alkaline phosphatase (ALP) and alizarin red S (ARS).

[0055] (1) Staining

[0056] To evaluate odontoblastic differentiation, ALP activity and calcium deposition were analyzed separately. An alkaline phosphatase assay kit (Beyotime) and alizarin red S solution (Cyagen) were used to perform ALP staining and ARS staining on DPSCs treated for 7 days and 21 days.

[0057] As Figure 1 shown, the ALP activity and calcium nodule formation in the Wnt3a group were significantly enhanced. Compared with the control group, the ALP staining in the Wnt5a and Wnt10a groups increased slightly, while there was no significant difference in ARS staining.

[0058] (2) Western blot

[0059] Total cellular proteins were extracted using RIPA lysis buffer with protease inhibitor (Beyotime) and 1 mM PMSF. Protein samples (10 μg) were separated on a 4 - 20% SurePAGE™ precast gel (GenScript) and transferred to a PVDF membrane (Millipore). The membrane was blocked with QuickBlock™ Western blocking buffer for 15 minutes at room temperature and then incubated with specific primary antibodies against DSPP (sc - 73632, 1:200, Santa Cruz) and DMP - 1 (sc - 73633, 1:200, Santa Cruz) at 4°C.

[0060] Subsequently, the membrane was incubated with HRP - conjugated secondary antibodies (goat anti - rabbit IgG, HA1001, 1:50,000, HUABIO; goat anti - mouse IgG, HA1006, 1:20,000, HUABIO) for 1 hour and visualized using an ECL chemiluminescence kit (Beyotime).

[0061] As Figure 2 shown, the expression levels of odontoblast differentiation - related proteins (such as DSPP and DMP1) in the Wnt3a - treated group were significantly increased.

[0062] Example 3 Bioinformatics analysis

[0063] In this example, bioinformatics methods were combined to analyze the differentially expressed genes related to odontogenic differentiation after DPSC induction. As Figure 3 shown, the steps of this example include: Step S1, sample preparation and single - cell RNA sequencing; Step S2, data processing; Step S3, bioinformatics analysis, specifically including: Step S31, dimensionality reduction and clustering; Step S32, differential expression analysis; Step S33, data visualization; Step S34, regulatory network analysis.

[0064] The specific steps are as follows:

[0065] S1. Sample preparation and single - cell RNA sequencing (scRNA - seq)

[0066] At approximately 40 - 50% confluence, DPSCs were treated with ODM supplemented with Wnt ligands for 7 days (media was renewed every 48 h). Single-cell suspensions were prepared by enzymatic digestion, and cell viability exceeded 85% (confirmed using a Countstar automatic cell counter). scRNA-seq libraries were constructed using the 10x Genomics Chromium system and sequenced.

[0067] S2. Data processing

[0068] The raw FASTQ files were aligned to the GRCh38 human reference genome (10xGenomics, refdata-gex-GRCh38-2020-A) using Cell Ranger v6.1.2. A gene expression matrix was generated using DNBC4tools, followed by quality control filtering (genes detected: 1,000 - 9,000; UMI counts: 600 - 80,000; proportion of mitochondrial genes ≤ 10%; proportion of hemoglobin genes ≤ 25%).

[0069] The final number of cells in each group was: control group (11,363), Wnt3a group (10,938), Wnt5a group (8,875), Wnt10a group (9,149).

[0070] S3. Bioinformatics analysis

[0071] S31. Dimensionality reduction and clustering: Data integration, PCA-based dimensionality reduction, and graph-based clustering (resolution = 0.6) were performed using Seurat v3.2, with optimization using the shared nearest neighbor (SNN) module. Cell clusters were visualized using UMAP.

[0072] Overall analysis of the single-cell transcriptome data results showed that, as Figure 4 shown, there were significant changes in the UMAP distribution of the Wnt3a group.

[0073] S32. Differential expression analysis: The FindMarkers function in Seurat was used to identify differentially expressed genes (DEGs) between clusters. (Wilcoxon rank sum test; threshold: expressed in ≥ 25% of cells, |log2FC| > 0.25). Gene Ontology (GO) enrichment analysis was performed using clusterProfiler (adjusted p < 0.05).

[0074] S33. Data visualization: The gene expression patterns were visualized using FeaturePlot (UMAP embedding).

[0075] As Figure 5As shown, the GO enrichment analysis of differentially expressed genes between the Wnt3a group and other samples showed that the upregulated genes were associated with key biological processes such as the Wnt signaling pathway, extracellular matrix organization, mesenchymal cell differentiation, and tooth formation. In contrast, the GO enrichment analysis of the Wnt5a and Wnt10a groups did not identify biological processes related to odontogenic differentiation.

[0076] In this example, 10 major cell clusters were identified from four samples. Statistical analysis showed that a unique subpopulation 3 was significantly induced by wnt3a, accounting for 44% ( Figure 6 ). The GO enrichment analysis of upregulated genes in subpopulation 3 highlighted processes such as extracellular matrix organization and tooth formation, indicating that this subpopulation has odontogenic function ( Figure 7 ).

[0077] To describe the unique characteristics of this subpopulation, a feature map of differentially expressed genes was drawn in this example, and it was found that NKD1 was specifically upregulated in subpopulation 3, thus naming this subpopulation NKD1 + subpopulation ( Figure 8 ).

[0078] S34, Regulatory network analysis: Use SCENIC v1.3.1 to analyze the transcriptional factor regulatory network of the NKD1 + cell population during odontogenesis.

[0079] The SCENIC analysis results showed that MSX1 was the most active transcriptional factor in the NKD1 + subpopulation ( Figure 9 ), indicating that it plays a key role in odontogenic function. This finding was further confirmed by the results of immunohistochemical analysis of human molar sections, showing specific expression of MSX1 in the NKD1 + subpopulation ( Figure 10 ).

[0080] Example 4 Fluorescent immunostaining

[0081] In this example, fluorescent immunostaining was used to further verify the distribution of the NKD1 + subgroup in human teeth.

[0082] 1. Tissue preparation

[0083] All animal experimental procedures were approved by the Animal Ethics Committee of Capital Medical University. Samples were fixed with 4% paraformaldehyde (PFA) at 4°C for 24 hours. Decalcification was carried out in 10% ethylenediaminetetraacetic acid (EDTA, pH 7.4), and human tooth samples were processed for 60 days. After dehydration with ethanol gradient, the tissues were embedded in paraffin and sectioned longitudinally (thickness 5 μm).

[0084] 2. Immunofluorescence

[0085] The deparaffinized sections were subjected to antigen retrieval and treated with 3% H2O2 in methanol for 15 minutes to inhibit endogenous peroxidase activity. Then, the sections were blocked with goat serum for 1 hour at room temperature.

[0086] The primary antibodies were incubated overnight at 4°C, including DSPP (sc-73632, 1:50, Santa Cruz), NKD1 (orb577992, 1:50, Biorbyt), and Ki67 (ab15580, 1:200, Abcam).

[0087] The secondary antibodies, including FITC-labeled antibodies (HA1004, HA1126, 1:500, HUABIO), iFluor™ 594-labeled antibodies (HA1122, HA1003, 1:500, HUABIO), and iFluor™ 647-labeled antibodies (HA1123, HA1127, 1:500, HUABIO), were incubated for 1 hour.

[0088] The sections were mounted using Fluoroshield™ mounting medium containing DAPI (Sigma) and subjected to fluorescence signal colocalization analysis using a Nikon microscope equipped with NIS-Element imaging software.

[0089] 3. In Situ Hybridization

[0090] Fresh third molars were fixed overnight at 4°C in a dedicated animal in situ hybridization fixative. The samples were decalcified, dehydrated, and embedded in paraffin.

[0091] Sections with a thickness of 5 μm were prepared for in situ hybridization. The sections were treated with proteinase K (20 μg / ml) at 40°C to enhance probe penetration. Pre-hybridization was carried out at 40°C for 1 hour to ensure optimal probe binding. Subsequently, hybridization with the primary probe was performed overnight at 40°C.

[0092] To amplify the signal, the sections were subjected to branched probe hybridization at 40°C for 45 minutes and signal probe hybridization at a dilution of 1:200 for 3 hours. Stringent washing was performed at 40°C using a SSC buffer gradient (2×SSC to 0.1×SSC) to minimize non-specific binding. Counterstaining with DAPI was carried out for 8 minutes, followed by mounting with an anti-fade medium to preserve fluorescence.

[0093] The probe modification group used for DSPP is Cyanine3, and the specific sequence (SEQ ID NO.1) is: CATGCACCAGGACACCACTTTCTTTGCATCGGAATTATCCAGGCCAGCATCTTTGGCTCTTCCCAACAGCATGTGTCTTCTCCTCGGCTACTGCTGTTATTGTCGTGGTTACTGTCACTGCCTTCACTGT

[0094] The probe modification group used for NKD1 is Alexa Fluor 488, and the specific sequence (SEQ ID NO.2) is: GTGACCTTGCCGTTGTTGTCAAAGTCCTTTACCCGCAGCATCTTGCTGGATGTTTCTCCTCTCGATGTTCTCATCTACGCGTTGCTGGAGCTCTGAGACCTTGG.

[0095] The multiplex immunofluorescence results of the cell samples showed (as Figure 11 ) that this subset was significantly enriched in the Wnt3a group, and the cells highly expressing NKD1 + also highly expressed DSPP and DMP1 simultaneously. Only a small number of NKD1 + cells were detected in the control group, and the expression levels of DSPP and DMP1 were relatively low.

[0096] In addition, flow cytometry analysis was also used in the present invention to confirm the existence and proportion of this subset, showing that 51.13% ± 2.45% of the cells in the Wnt3a group were NKD1 + and DSPP + , which was significantly higher than 7.92% ± 1.54% in the control group (P < 0.001). A similar trend was also observed in the flow cytometry co-labeling experiment of NKD1 and DMP1 ( Figure 12 ).

[0097] Furthermore, the multiplex immunofluorescence atlas of human molar sections showed that in fully developed teeth, the NKD1 + subset had a conserved spatial distribution across anatomical regions (apex / cervix / root) in the odontoblast layer. And these cells showed co-expression of dentin markers: DSPP and Ki67 ( Figure 13 ), defining their secretory active state. In situ hybridization further confirmed the spatial consistency of NKD1 and DSPP mRNA signals along the odontoblast layer ( Figure 14 ).

[0098] The applicant declares that the above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. The use of NKD1 gene as a specific marker in detecting the regeneration efficiency of dental pulp-dentin complex, characterized in that: The NKD1 gene is a specific gene expressed during the regeneration of mesenchymal stem cells, the mesenchymal stem cells are dental pulp stem cells, the dental pulp stem cells are used to prepare the dental pulp-dentin complex, the application is the application of treating dental pulp stem cells with the odontogenic inducing agent Wnt3a, and the application is for non-diagnostic purposes.

2. The use according to claim 1, characterized in that: The application includes preparing a kit for detecting the regeneration efficiency of dental pulp-dentin complex.

3. The use according to claim 2, characterized in that: The kit comprises a detection reagent for the NKD1 gene.

4. The use according to claim 1, characterized in that: The specific markers used in the application also include any one of DSPP gene, DMP1 gene, Ki67 gene or MSX1 transcription factor or a combination of at least two thereof.

5. A method for preparing a dental pulp-dentin complex with high regeneration efficiency, characterized in that: The method comprises: After treating the dental pulp stem cells used in the regeneration of the dental pulp-dentin complex with the odontogenic induction agent Wnt3a, the NKD1 gene detection reagent was used to detect them and screen out the cell subpopulation that specifically expresses the NKD1 gene, thereby regenerating the dental pulp-dentin complex.

Citation Information

Patent Citations

  • Compositions and methods for dental tissue regeneration

    CN105228557A

  • Method for promoting odontogenic differentiation of mesenchymal stem cells by using Wnt10a and application of method

    CN115161272A