Primer probe set, kit and method for field early-stage rapid detection of southern corn rust disease

Abstract

The invention discloses a primer probe group, a kit and a method for field early-stage rapid detection of southern corn rust. Aiming at early detection of pathogenic bacteria puccinia polypoda of southern corn rust, primer design and screening, reaction system and condition optimization and specificity and sensitivity analysis are carried out, and a field detection method is established. The primer probe set developed by the invention and the established rapid detection method for the southern corn rust disease have the advantages of strong specificity, high sensitivity, simplicity in operation and the like, and can provide effective technical support for early diagnosis and early warning of diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease detection, and in particular relates to a primer probe set, a kit and a method for rapid early detection of southern corn rust in the field. Background Art

[0002] At present, the research on southern corn rust at home and abroad mainly focuses on the occurrence of the disease, the identification of pathogens, biological characteristics and genetic disease resistance. The molecular detection technology for the pathogen of southern corn rust is still mainly based on traditional methods, mainly including conventional PCR, TaqMan qPCR, etc. Although these traditional methods have certain guarantees in detection accuracy, they have the following shortcomings in practical applications:

[0003] 1. Insufficient early diagnosis capabilities: Traditional methods are difficult to achieve rapid and accurate early diagnosis of diseases, often resulting in missing the best time for prevention and control;

[0004] 2. Lack of portability: The detection process is complicated and the operation is cumbersome, which is not suitable for use in non-laboratory environments such as the field;

[0005] 3. High cost and time-consuming: The equipment requirements are high, and the detection cost is expensive and time-consuming, which limits its application in large-scale disease detection.

[0006] Based on the above problems, there is an urgent need to develop an efficient, portable, and cost-controlled rapid detection technology for southern corn rust to meet the needs of early disease diagnosis and real-time field monitoring, and provide technical support for precise prevention and control. Summary of the invention

[0007] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a primer probe set, a kit and a method for rapid early detection of southern corn rust in the field. The present invention has successfully developed a portable early rapid detection kit and method for southern corn rust. The present invention screened the specific region of the southern corn rust O-mannosyltransferase gene through bioinformatics analysis, designed and synthesized amplification primers for the region, and established a southern corn rust detection system based on multi-enzyme constant temperature nucleic acid rapid amplification technology.

[0008] The first object of the present invention is to provide a primer probe group for detecting southern corn rust, comprising an upstream primer F12, a downstream primer R11 and a probe, wherein the nucleotide sequence of the upstream primer F12 is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer R11 is shown in SEQ ID NO.6; the nucleotide sequence of the probe is shown in SEQ ID NO.10, wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran THF is introduced between the 32nd base G and the 33rd base T as an abasic site, the 33rd base T is modified with a BHQ1 quenching group, and the 3' end is blocked with a C3 Spacer.

[0009] The second object of the present invention is to provide a corn southern rust detection kit, comprising the primer probe set and a DNA constant temperature rapid amplification reagent.

[0010] The third object of the present invention is to provide a rapid early detection kit for southern corn rust in the field, comprising the southern corn rust detection kit and a DNA type lysis solution.

[0011] Preferably, the corn southern rust detection kit contains all components of the DNA constant temperature rapid amplification kit: Abuffer, B buffer, positive control template, positive control primer MIX, lyophilized powder reagent, and the primer probe group; the DNA constant temperature rapid amplification kit is a fluorescent DNA constant temperature rapid amplification kit purchased from Anpu Future Biotechnology Co., Ltd., item number: WLE8202KIT.

[0012] Preferably, all components of the corn southern rust detection kit are prepared into a dry powder reagent and a buffer microsphere according to the amount of 50 μL amplification reaction system for one detection, and are loaded into a PCR tube as a detection reagent tube; in the detection reagent tube, the upstream primer F12 is 20 pmol, the downstream primer R11 is 20 pmol, and the probe is 6 pmol; the corn southern rust detection kit contains several detection reagent tubes.

[0013] Preferably, the DNA type lysis solution is a DNA type rapid nucleic acid releaser-type II, purchased from Anpu Future Biotechnology Co., Ltd., item number: WLD8201-ES.

[0014] The fourth object of the present invention is to provide a method for rapid early detection of southern corn rust in the field, comprising the following steps:

[0015] S1. Take 2-3 small pieces of leaves with a size of 1 cm*1 cm from the lower leaves of the corn plant to be tested, about 15-20 cm away from the tip of the leaf, and put them in tube 1. Grind the sample with a grinding rod for 1 min, mix well, and place it at room temperature for 10 min for lysis to obtain a lysis product; the tube 1 is a 1.5 mL centrifuge tube containing 500 μL of DNA type lysis solution;

[0016] S2. Use a 50 μL quantitative pipette to draw 50 μL of the lysate, add it to tube 2, and mix it for dilution; use a 50 μL quantitative pipette to draw 50 μL of the diluted lysate and add it to the detection reagent tube, mix it and shake the liquid to the bottom of the tube to obtain a reaction tube; the tube 2 is a 1.5 mL centrifuge tube filled with 450 μL of sterile water;

[0017] S3. Place the reaction tube in a digital thermostatic detector, set the temperature to 40°C, start the run, and amplify for 4 minutes. The instrument emits a "beep" prompt sound. At this time, take out the reaction tube, mix it, shake the liquid to the bottom of the tube, and put it back into the digital thermostatic detector to continue amplification for 16 minutes. The program ends and the instrument displays the corresponding value of the well position;

[0018] S4. Interpret according to the value displayed on the instrument: if the value displayed on the instrument is between 00-03, the result is negative, indicating that the tested sample does not contain the nucleic acid of the southern corn rust pathogen Puccinia multispinosa; if the value displayed on the instrument is between 04-99, the result is positive, indicating that the tested sample contains the nucleic acid of the southern corn rust pathogen Puccinia multispinosa.

[0019] Preferably, the digital constant temperature detector is purchased from: Anpu Future Biotechnology Co., Ltd., item number: WL-PS-8C.

[0020] The fifth object of the present invention is to provide the use of the southern corn rust detection primer probe set, the southern corn rust detection kit, and the southern corn rust field early rapid detection kit in the detection and prevention and control of southern corn rust.

[0021] The present invention has the following advantages:

[0022] (1) The present invention can realize efficient and rapid field detection of southern corn rust, provide a scientific basis for molecular identification and early warning of the disease, and facilitate precise prevention and control.

[0023] (2) The present invention constructs a pathogen detection technology system that is simple to operate, highly sensitive, low-cost and easy to promote, providing technical support for the monitoring, prediction and prevention of southern corn rust, and has high application value.

[0024] (3) The present invention can realize nucleic acid detection in the field, and the results can be observed in 20-30 minutes, making the monitoring of southern corn rust earlier and more sensitive. The test kit of the present invention can detect southern corn rust infection 7 days before the onset of symptoms in field tests. At present, there are no early field rapid detection products for southern corn rust at home and abroad. The successful development of this test kit can help to carry out more accurate prevention and control of southern corn rust in production.

[0025] (4) The method of the present invention is simple to operate and does not require expensive professional instruments and equipment. It is easier to operate than professional experimental instruments. It is not limited by the detection scene and can be tested directly in the field. It is highly practical and easier to promote detection at the grassroots level. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a sequence conservation analysis of the target gene PMT1; A is the verification of the sequence conservation of the target gene PMT1 in more than 100 strains of Puccinia multifiliis; B is the verification of three representative strains of Puccinia multifiliis that the target fragments are all covered by short-read sequences and have no structural variation.

[0027] Figure 2 It is a primer screening analysis; wherein, A is a qPCR amplification curve using the upstream primer F11 and four different downstream primers R11, R12, R13, and R14 respectively; B is a qPCR amplification curve using the upstream primer F12 and four different downstream primers R11, R12, R13, and R14 respectively; C is a qPCR amplification curve using the upstream primer F13 and four different downstream primers R11, R12, R13, and R14 respectively; D is a qPCR amplification curve using the upstream primer F14 and four different downstream primers R11, R12, R13, and R14 respectively.

[0028] Figure 3 This is a verification of the specificity of the screened primer pairs F11-R11 and F12-R11 in amplifying the southern corn rust pathogen Puccinia multispinosa.

[0029] Figure 4 It is a sensitivity analysis of the screened primers for amplifying the southern corn rust pathogen Puccinia multispinosa; wherein: A is the primer pair F11-R11, and B is the primer pair F12-R11.

[0030] Figure 5 It is a sensitivity verification of the screened primer pairs for amplification of corn leaf samples inoculated with multiple piles of Puccinia; wherein: A is the primer pair F11-R11, and B is the primer pair F12-R11.

[0031] Figure 6This is a test of the effects of adding different amounts of three different lysis buffers; among them, A is a DNA type lysis buffer; B is a TBS lysis buffer, and C is an RNA type lysis buffer.

[0032] Figure 7 It is a test of the effects of three different lysis buffers; DNA represents DNA type lysis buffer, TBS represents TBS lysis buffer, and RNA represents RNA type lysis buffer.

[0033] Figure 8 It is a comparison of the qPCR results of corn leaf samples inoculated with multiple piles of stem rust for different days and the results of digital thermostat detection; among them, A is the qPCR result and B is the digital thermostat detection result.

[0034] Fig. 9 It is the result of continuous monitoring of field samples without disease. DETAILED DESCRIPTION

[0035] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0036] Example 1

[0037] 1. Screening of target genes and determination of specificity

[0038] Population genetics and Blast alignment were used to find the target gene and determine the specificity. O-mannosyltransferase-PMT1 is widely present in a variety of pathogens and has become a potential molecular detection target. Based on bioinformatics analysis, a highly conserved gene sequence (PMT1 gene, whose nucleotide sequence is shown in SEQ ID NO.1) was screened from more than 100 multi-pile rust strains collected nationwide. At the same time, it was ensured that the sequence was highly specific to other major corn diseases (such as common rust, small spot disease, etc.), that is, it did not exist in other disease pathogens. Combining the requirements of conservatism and specificity, primers for rapid detection were further optimized and designed.

[0039] (1) Conservatism

[0040] In order to verify that the target fragment on the PMT1 gene used for rapid detection is highly conserved in various strains of Puccinia multifiliis, we first compared the target fragment ( Figure 1 A in the figure, the region in the red box is the target fragment, the first exon is conservative, and the results show that there is no SNP or Indel variation in this sequence. The MAF of the two Indels marked by the blue short line is very low (0.02), indicating that this gene may not vary in the population. Secondly, the genome comparison and depth of coverage analysis of all strains collected from all over the country were performed ( Figure 1B) in the figure shows three representative Puccinia multifiliis strains (Henan 2353 (HN2353), Fujian 2313 (FJ2313), Guangdong 2322 (GD2322)); the results showed that the target fragments of all strains were covered by short-read sequences, indicating that there was no structural variation; this further confirmed the conservation of the target fragment sequence.

[0041] (2) High specificity

[0042] The target fragment on the PMT1 gene used for rapid detection is also highly specific in maize disease pathogens. Twelve different diseases were compared, and the results (Table 1) showed that except for southern corn rust, the genomes of pathogens of other major maize diseases did not contain this sequence, indicating that this target fragment sequence is highly specific.

[0043] Table 1 Specific alignment results of target fragment sequences on PMT1 gene

[0044] Corn Diseases Pathogens Reference genome strains Does it contain the target fragment? Small spot disease Bipolarismaydis C4 no Big spot disease Exserohilumturcicum Et28 no Curvularia leaf spot Curvularialunata CX-3 no Gray spot Cercosporazeae-maydis LN no Sheath blight Rhizoctonia solani AG1-IA_HG81 no Common rust Puccinia sorghi RO10H11247 no Stem rot Fusarium graminearum FG-12 no Stem rot Pythiumaristosporum CBS263.38 no ear rot Fusarium verticillioides 7600 no ear rot Fusarium graminearum FG-12 no Tumor smut Ustilagomaydis 521 no Head smut Sporisoriumreilianum SRZ2 no

[0045] 2. Primer Design and Optimization

[0046] (1) Primer screening

[0047] According to the target fragment sequence of the specific gene PMT1, 16 pairs of primers were designed and synthesized, and qPCR detection and verification were performed using the DNA of the southern corn rust pathogen Puccinia multispinosa as a template, and relatively excellent primers were preliminarily screened out; specifically, different upstream primers F11, F12, F13, F14 and downstream primers R11, R12, R13, R14 were used in combination for qPCR verification. Among them, the primer sequences are as follows:

[0048] F11: GACTTCAAACTCGTATCAAGATTCGCTCGATG (SEQ ID NO. 2);

[0049] F12: CAAGATTCGCTCGATGATCATCTCAATCGATC (SEQ ID NO.3);

[0050] F13: CTCAATCGATCTCAACTAGACCCCATTCGATC (SEQ ID NO.4);

[0051] F14: GTAGACCAAGGGGATCGACCACTAGGACCATC (SEQ ID NO.5);

[0052] R11: GATTGGATGGATCGATGATGGAGAGTGAACTG (SEQ ID NO.6);

[0053] R12: GTGGTGGTGATGAGTTGAGGATTGGATGGATCG (SEQ ID NO.7);

[0054] R13: GATGAGTTGATGGATCGAGAGAGCTGAGTG (SEQ ID NO. 8);

[0055] R14: CTGTTGAGGTAAGAAGTGGCGGATGAGTTGATG (SEQ ID NO.9);

[0056] Probe: GGTGATGATTGAAGTGAGTTGGAAGGGTGATGTGATCATTTGAATCTG (SEQ ID NO. 10), wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran (THF) is introduced between the 32nd base G and the 33rd base T as an abasic site (enzyme recognition site for nuclease IV), the 33rd base T is modified with a BHQ1 quenching group, and the 3' end is blocked with a C3 spacer; that is, the probe sequence can also be expressed as GGTGATGA TTGAAGTGAGTTGGAAGGGTGA[FAM-dT]G[THF][BHQ1-dT]GATCATTTGAATCTG-[3'C3spacer].

[0057] The first group of tests ( Figure 2 A) in the figure uses upstream primer F11 and four different downstream primers R11, R12, R13, and R14 for amplification. The test results show that the primer pair F11-R11 has an early peak and a higher peak. The second group of tests ( Figure 2 B) in the figure uses upstream primer F12 and four different downstream primers R11, R12, R13, and R14 for amplification. The test results show that the primer pair F12-R11 has an early peak and a higher peak. The third group of tests ( Figure 2 C) in the figure uses the upstream primer F13 and four different downstream primers R11, R12, R13, and R14 for detection. The detection results show that the primer pair F13-R11 has an earlier peak and a higher peak. The last group of detections ( Figure 2D) in the figure uses the upstream primer F14 to test with four different downstream primers R11, R12, R13, and R14. The test results show that the primer pair F14-R11 has an earlier peak and a higher peak value. Based on the qPCR results, the CT values ​​of the primer pairs F11-R11, F12-R11, F13-R11, and F14-R11 were compared. The results show that the two primer pairs F11-R11 and F12-R11 have the earliest peak and the lowest CT value compared with other primer combinations ( Figure 2 A and B in the figure, so the two relatively good primer pairs F11-R11 and F12-R11 were used as alternative primers for subsequent testing.

[0058] For the aforementioned qPCR test, the specific test reaction system is: Abuffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, DNA template 5μL, ddH2O 8.5μL, B buffer 2.5μL, total volume 50μL. Before the test reaction, the liquid components of the kit (DNA constant temperature rapid amplification kit (fluorescence type), purchased from Anpu Future Biotechnology Co., Ltd., item number: WLE8202KIT) were taken out in advance, melted at room temperature, and mixed by shaking. The reagents in the above reaction system were added to the dry powder tube in the kit in sequence, and finally the B buffer in the kit was added to the inside of the lid of the reaction tube. After the lid was closed, it was turned upside down 8-10 times for mixing. After mixing, the reaction solution was thrown (or quickly centrifuged) to the bottom of the tube, and then the reaction tube was immediately placed in the PCR instrument. The detection reaction condition program was set as follows: constant temperature at 39°C; fluorescence signal was collected every 30 seconds; reaction time was 20 minutes; and "none" was selected for both the passive reference and quencher of the PCR instrument.

[0059] (2) Primer specificity verification

[0060] The two pairs of primers F11-R11 and F12-R11 selected from the primer screening were further validated for specificity, and qPCR amplification was performed using DNA from the pathogens of corn common rust, corn leaf spot, stalk rot / ear rot, and southern corn rust pathogen Puccinia multispinosa as templates. qPCR results ( Figure 3) showed that both pairs of primers showed peaks only when the template was Puccinia multistolonifer DNA, and no peaks appeared for other pathogenic bacteria DNA, indicating that compared with the common rust, small spot, and stem rot / ear rot pathogens of corn, the selected two pairs of primers were specific to Puccinia multistolonifer. The qPCR reaction system was: Abuffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, DNA template 5μL, ddH2O 8.5μL, B buffer 2.5μL, total volume 50μL; the DNA templates were the corresponding specificity verification pathogen DNA.

[0061] (3) Primer sensitivity verification

[0062] First, use the vector to construct a synthetic plasmid containing the PMT1 gene target fragment. The specific steps are as follows:

[0063] The DNA of the southern corn rust pathogen Puccinia multihelicis was used as a template, and the upstream primer F: GACCTCGAGGGGGGGCCCAGACCAAGGGGATCGACCAC (SEQ ID NO.11) and the downstream primer R: CTCCTCGCCCTTGCTCACCATTGGATTCGAGACCACCACCGA (SEQ ID NO.12) were used for PCR amplification to obtain an amplified product. After gel electrophoresis of the amplified product, gel recovery was performed to obtain an amplified fragment and the concentration was measured. The sequence of the amplified fragment is shown in SEQ ID NO.13. The fragment was inserted into a linearized pYBA1143 (C-HA) vector for recombination to obtain a recombinant product, which was transformed into competent Escherichia coli cells, screened for resistance, cultured, and then the plasmid was extracted and the concentration was measured to obtain a synthetic plasmid containing the PMT1 gene target fragment for standby use.

[0064] The synthetic plasmid containing the target fragment of the PMT1 gene prepared above was used as a template, and the plasmid was set to 6 concentration gradients (100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, 1fg / μL). Different concentrations of plasmids were used as templates, and three replicates were made for each concentration. qPCR amplification was performed using different primers. First, primer pair F11-R11 was used to perform qPCR amplification on the above 6 different concentrations of the multi-pile rust plasmid; the test results ( Figure 4 A) in the figure shows that the minimum sensitivity of F11-R11 detection is 1 fg / μL. Then, primer pair F12-R11 was used to perform qPCR amplification on the above six different concentrations of multiple piles of Puccinia plasmids; the results ( Figure 4B) in the figure shows that the minimum sensitivity of F12-R11 is 10fg / μL. This indicates that the two primer pairs selected in the primer screening have high sensitivity to Puccinia multiflora. Although F11-R11 can detect lower concentrations, its high sensitivity may result in relatively poor CT value repeatability and peak value. F12-R11 has a slightly lower sensitivity than F11-R11, but F12-R11 has better CT value repeatability and more stable peak value than F11-R11. Therefore, it is considered that F12-R11 is better than F11-R11 in comprehensive consideration. The qPCR reaction system was: Abuffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, plasmid template 5μL, ddH2O 8.5μL, B buffer 2.5μL, total volume 50μL; two different pairs of primers were used for qPCR amplification, and finally compared based on the CT value of the gradient and the peak change.

[0065] 3. Verification of the testing system

[0066] 1. Verification of indoor testing system

[0067] 1.1 Sample sensitivity verification

[0068] Directly use the DNA of corn leaf samples inoculated with multiple piles of rust for 1-10 days as template, and repeat three times for each sample to verify the sensitivity of primer pairs F11-R11 and F12-R11. First, use primer pair F11-R11 for detection ( Figure 5 The results showed that when the template was the DNA of the corn leaf sample inoculated with multiple piles of rust on the third day, the qPCR began to show a peak and a CT value, indicating that this pair of primers can detect multiple piles of rust on the third day of infection of the corn leaves with multiple piles of rust. Then primers F12-R11 were used for detection ( Figure 5 B); The results showed that when the template was the DNA of the corn leaf sample inoculated with multiple piles of rust on the second day, qPCR began to show a peak and a CT value, indicating that the primer pair F12-R11 can detect multiple piles of rust on the second day of multiple piles of rust infection of corn leaves. The sample sensitivity verification results showed that F12-R11 had a lower CT value, better repeatability, and could detect multiple piles of rust earlier, so combined with the results of the primer sensitivity test, F12-R11 was determined as the best primer pair and used as the primer pair for the development of the kit.

[0069] The DNA preparation method of corn leaf samples is as follows: select Zhengdan 958 corn seedlings grown to the 2-3 leaf stage, 10 plants per pot, wash the seedlings (gently stroke the leaves 2-3 times with fingers) and set aside. Collect several piles of fresh summer spores of Puccinia odorifera, prepare a spore suspension with a Tween-80 aqueous solution, and add the prepared spore suspension (concentration of 2×10 5 Spores / mL) were evenly sprayed on corn leaves, and the inoculated corn seedlings were placed in a black bag in an incubator (conditions: temperature 26°C, relative humidity: 70%) for dark culture. After 24 hours, the bag was opened and cultured normally. The first sampling was carried out 24 hours after inoculation, and then samples were collected every 1 day for a total of 10 days. Sampling was taken every day and photographed, and the samples were stored in a -80°C refrigerator in time. DNA was extracted from the collected samples using the CTAB method and stored at -20°C for later use.

[0070] In order to facilitate rapid detection of corn leaf samples in the field, the lysis buffer used in sample DNA extraction was screened and optimized.

[0071] 1.2 Lysate screening

[0072] 1.2.1 Test of the amount of lysate added

[0073] In order to clarify the effect of the amount of lysis buffer added on the detection effect and obtain the best detection results, the primer pair F12-R11 was used to test the amount of three different lysis buffers added, namely DNA type lysis buffer, TBS lysis buffer and RNA type lysis buffer.

[0074] First, the amount of DNA lysis buffer added was tested ( Figure 6 A), set two gradients of 60 and 100 μL, and repeat each treatment twice. The qPCR results showed that the DNA type lysate peaked earlier and had a higher peak value when 60 μL was added. Figure 6 B), 60μL, 100μL, 120μL three gradients, each treatment was repeated twice; qPCR results showed that the peak value was higher when 60μL of TBS lysis buffer was added. Finally, the amount of RNA lysis buffer added was tested ( Figure 6 C), set three gradients of 100, 300, and 500 μL, and repeat each treatment three times; when 100 μL of RNA lysate was added, the peak was earlier and higher. The test results show that DNA lysate and TBS lysate have better effects when 60 μL is added, and 60 μL is added for subsequent tests. RNA lysate has better effects when 100 μL is added, so 100 μL is added for subsequent tests.

[0075] Specific sample preparation method and reaction conditions: Take corn leaves inoculated with multiple piles of rust on the third day (3 small pieces of leaves of about 1cm*1cm in size) and add the corresponding volume of lysis solution to a 1.5mL centrifuge tube and grind until the leaf tissue is broken, and then lyse; the lysis conditions and time of different lysis solutions are as follows: DNA type lysis solution reacts for 5min at room temperature, RNA type lysis solution reacts for 10min at 40℃, and TBS lysis solution reacts for 15min at 65℃; take 5μL supernatant as a template for amplification for qPCR amplification. Among them, the DNA type lysis solution is a rapid nucleic acid release agent (DNA type)-II type, purchased from Anpu Future Biotechnology Co., Ltd., item number: WLD8201-ES; the RNA type lysis solution is a rapid nucleic acid release agent (RNA type), purchased from Anpu Future Biotechnology Co., Ltd., item number: WLR8203. The formula of TBS lysis solution is: Tris-HCl (pH8.0) 100mL, EDTA 20mL, KCl 74.5g, add water to make up to 1L.

[0076] 1.2.2 Selection of final lysis buffer

[0077] In order to select a lysate with the best effect, convenience and practicality, primer pair F12-R11 was used to further test and compare the effects of three lysates, so as to screen out the best lysate. Test results ( Figure 7 ) showed that the peak value of DNA type lysis solution was higher than that of TBS lysis solution and RNA type lysis solution, and the CT value of DNA type lysis solution was the lowest, indicating that DNA type lysis solution was more effective. Therefore, it was finally determined to use DNA type lysis solution as the lysis solution for rapid detection of southern corn rust.

[0078] Specific operation method and reaction conditions: Take corn leaves inoculated with multiple piles of stem rust for the fifth day (3 small leaf pieces of about 1cm*1cm in size) and add corresponding volumes of lysis buffer (60μL of DNA type lysis buffer, 60μL of TBS lysis buffer, and 100μL of RNA type lysis buffer) in 1.5mL centrifuge tubes for grinding until the leaf tissue is broken, and then lyse; the lysis conditions and time of different lysis buffers are as follows: DNA type lysis buffer reacts at room temperature for 5min, RNA type lysis buffer reacts at 40℃ for 10min, and TBS lysis buffer reacts at 65℃ for 15min; take 5μL of supernatant as the amplified DNA template for qPCR amplification, and perform 2 replicates for each treatment.

[0079] 1.2.3 Comparison of qPCR results with digital thermostat detector results

[0080] qPCR equipment is expensive, requires operators to have a certain level of experimental operation skills, and can only be used for indoor testing, with limited occasions for use; digital thermostats are simple and flexible, easy to operate, and can be taken directly to the field for testing when equipped with a small mobile power supply.

[0081] In order to verify whether the results of the two amplification methods were consistent, we used the same primers to test F12-R11 and the same leaf sample, and then compared the test results.

[0082] Template preparation method: Take corn leaves inoculated with multiple piles of rust fungi for 2-5 days (3 small pieces of leaves of about 1cm*1cm in size) in a 1.5mL centrifuge tube, add 60μL DNA lysis buffer, react for 5 minutes at room temperature, and take 5μL supernatant as template for testing. First, use the DNA lysis buffer extraction method to extract the DNA of the leaf samples inoculated with multiple piles of rust fungi as a template for amplification in a qPCR instrument ( Figure 8 A), the qPCR amplification results show that when the template is the DNA of the corn leaf sample inoculated with multiple piles of Puccinia on the third day, a peak and CT value appear, indicating that multiple piles of Puccinia can be amplified on the third day.

[0083] Secondly, the DNA of corn leaf samples inoculated with multiple piles of Puccinia was extracted using the same DNA lysis solution extraction method and amplified in a digital thermostat. Turn on the power of the digital thermostat detector, put in the prepared eight-row sample, press the heating button (constant temperature 40°C), and wait for 20 minutes to get the test value. The digital thermostat detector was purchased from: Anpu Future Biotechnology Co., Ltd., item number: WL-PS-8C. Results ( Figure 8 B) in the figure is: S1: the template is the 1st day of inoculation, and the detection value is 0; S2: the template is the 2nd day of inoculation, and the detection value is 0; S3: the template is the 3rd day of inoculation, and the detection value is 6; S4: the template is the 4th day of inoculation, and the detection value is 12; S5: the template is the 5th day of inoculation, and the detection value is 13; S6: the template is the DNA of the symptomatic sample in the field, and the detection value is 33; S7: the template is the positive control of multiple piles of stem rust inoculated for 10 days, and the detection value is 36; S8: the template is the uninoculated negative control, and the detection value is 0.

[0084] The digital thermostat amplification results showed that the southern corn rust pathogen Puccinia multispinosa could be amplified on the third day of inoculation. The comparison of the test results showed that the qPCR results were consistent with the digital thermostat test results, indicating that the digital thermostat can be used for field testing.

[0085] 2. Verification of the field testing system

[0086] Since there are large differences between laboratory conditions and field conditions, field testing and verification are further carried out based on indoor testing.

[0087] The leaves tested in the early stage are laboratory inoculated leaves, the fungus source is clean and not contaminated by other bacteria, and the corn seedlings are young and the leaves are more tender. However, the field detection conditions are complicated, there are other interfering factors on the leaves, and the corn leaves tested are in the heading stage, and the leaves are more mature, so the detection time will be slightly later than the laboratory test. However, there is a 6-7 day incubation period for multiple piles of rust to invade the leaves. During the incubation period, there are no symptoms on the leaves and it is difficult to find them with the naked eye. Field testing has proved that the optimized method of this embodiment can detect the pathogen during the incubation period of the pathogen and before the leaves become ill, which can guide the prevention and control of field grass-roots diseases.

[0088] 2.1 Determine the sampling location

[0089] Take 30 corn leaves as field samples, measure the distance from the leaf tip to the diseased site and take the average value, and determine the sampling position as a small piece of corn leaf 1cm*1cm in size, 15-20cm away from the leaf tip.

[0090] 2.2 Test the grinding time and cracking time detection process

[0091] Field samples were tested using a digital thermostat. 2-3 corn leaves (a small piece of corn leaves about 15-20 cm from the tip of the leaf and 1 cm*1 cm in size) were taken and placed in a 1.5 mL centrifuge tube containing 500 μL DNA lysis solution (corn leaves in the field are usually more mature, so the volume of the lysis solution was adjusted, and 60 μL, 100 μL, 300 μL, 500 μL, 800 μL and other volumes were compared. It was found that 500 μL had the best effect, so subsequent experiments were all conducted with 500 μL DNA lysis solution). The grinding time and the static lysis time were tested respectively, and three replicates were made for each treatment. According to the test results of the grinding time and lysis time (Table 2, Table 3), it was shown that the effect of grinding for 1 min was better than that of grinding for 2 min and 3 min, and the effect of lysis for 10 min was better than that of lysis for 3 min and 5 min, that is, the best result was obtained when lysis was 10 min.

[0092] Table 2 Test results of grinding time

[0093]

[0094] Table 3 Test results of lysis time

[0095]

[0096] 2.3 Test of reaction template addition amount

[0097] The test was conducted on corn leaf samples that had been inoculated with multiple piles of stem rust for 1-8 days in the laboratory, with three replicates for each treatment. The digital constant temperature detector detected 0 values ​​for samples that had been inoculated for 1-3 days, and values ​​were detected starting from the fourth day.

[0098] According to the test results (Table 4), the test values ​​of samples inoculated with multiple piles of Puccinia repens for 4-8 days when the sample template addition amount was 5 μL were higher than the test values ​​when the addition amount was 10 μL; this shows that the effect of adding 5 μL of reaction template is better than adding 10 μL, so the template addition amount in the detection reaction system was determined to be 5 μL.

[0099] Table 4 Test results of reaction template addition amount

[0100]

[0101] 2.4 Establish specific operation methods for field monitoring

[0102] (I) Material preparation

[0103] 1.1.5mL centrifuge tube, 50μL quantitative pipette, grinding rod, field detection reagent, DNA lysis solution, sterile water, digital constant temperature detector, mobile power supply, PCR tube rack, scissors, etc. Two 1.5mL centrifuge tubes and two 50μL quantitative pipettes are required for each sample. Among them, the field detection reagent contains all the original components of the DNA constant temperature rapid amplification kit (fluorescence type) (purchased from Anpu Future Biotechnology Co., Ltd., item number: WLE8202KIT): Abuffer, B buffer, positive control template, positive control primer MIX, freeze-dried powder reagent, as well as primer F12, primer R11 and probe; each PCR tube contains all the components of the above field detection reagent for one detection amount (50μL amplification reaction system), made into a dry powder reagent and a buffer microsphere in the tube as a detection reagent tube; among them, in the 50μL amplification reaction system, the primer F12 is 20pmol, the primer R11 is 20pmol, and the probe is 6pmol. The digital constant temperature detector used was purchased from: Anpu Future Biotechnology Co., Ltd., item number: WL-PS-8C.

[0104] 2. Add 500 μL of DNA-type lysis buffer (DNA-type lysis buffer is Rapid Nucleic Acid Releaser (DNA Type)-II, purchased from Anpu Future Biotechnology Co., Ltd., catalog number: WLD8201-ES) to a 1.5 mL centrifuge tube as tube 1; add 450 μL of sterile water to a 1.5 mL centrifuge tube as tube 2.

[0105] (II) Nucleic acid extraction

[0106] 1. Take the 3rd or 4th leaf of corn from the bottom, and take 2 or 3 small pieces of leaves with a size of 1 cm*1 cm from the tip of the leaf about 15 to 20 cm and put them in tube 1.

[0107] 2. Grind the sample with a grinding rod for 1 min. After the sample is crushed, mix it and place it at room temperature for 10 min for pyrolysis to obtain the pyrolysis product.

[0108] (III) Amplification detection

[0109] 1. Use a 50 μL quantitative pipette to draw 50 μL of the lysate, add it to tube 2, cover the tube and mix manually (i.e., dilute the lysate 10 times).

[0110] 2. Open the detection reagent tube cap, use a 50μL quantitative pipette to draw 50μL of diluted lysate, and add it to the detection reagent tube.

[0111] 3. Cover the tube cap and immediately mix it upside down 8-10 times. After mixing, shake the liquid to the bottom of the tube to prepare a reaction tube.

[0112] 4. Open the upper cover of the digital constant temperature detector, place the reaction tube into the instrument, cover it tightly, press the heating button (constant temperature 40°C), and press the run button to start.

[0113] 5. After 4 minutes of amplification, the instrument will emit a "beeping" prompt sound. At this time, open the instrument cover, take out the reaction tube, mix it upside down again 8-10 times, shake the liquid to the bottom of the tube, put it back into the digital constant temperature detector in the original order, and close the cover tightly.

[0114] 6. After continuing amplification for 16 minutes, the program ends and the instrument displays the corresponding values ​​of the well positions.

[0115] (IV) Interpretation of results

[0116] A large number of early test results show that since the detection instrument detects pathogens through fluorescent groups, false positive errors may occur, and negative treatment may result in values ​​of 0-2. Based on the early test results and the test results of the amount of reaction template added, the minimum detection value is 3. In order to ensure the accuracy of the test and avoid false positives, 0-3 is defined as negative and 4-99 is defined as positive.

[0117] Therefore, the method for determining the result interpretation is as follows: If the instrument displays a value between 00-03, the result is negative, indicating that the sample does not contain the nucleic acid of the southern corn rust pathogen Puccinia multistolonifera, or the content is below the detection limit. If the instrument displays a value between 04-99, the result is positive, indicating that the sample contains the nucleic acid of the southern corn rust pathogen Puccinia multistolonifera. 2.5 Field sample testing in the experimental site in Xinxiang, Henan Province

[0118] 2.5.1 Continuous monitoring of disease-free fields

[0119] The method established in 2.4 was used to test the field samples of the experimental plots. The corn growth period of each monitoring plot was consistent, all at the heading stage. Random sampling was performed on five different experimental plots every day and photographed and recorded. Monitoring results ( Fig. 9 ) showed that since the first detection of the southern rust pathogen of corn, Puccinia multiflora, on August 28, 2024, the detection values ​​have gradually increased with the passage of time, and diseased corn leaves were observed in the field on the seventh day after the detection of Puccinia multiflora (September 4, 2024).

[0120] Fig. 9 In A, ① Experimental Site 1, ② Experimental Site 2, ③ Experimental Site 3, ④ Experimental Site 4, and ⑤ Experimental Site 5 were in the latent period on or before August 27, 2024. No spots appeared on the corn leaves in the field, and all the leaves were healthy. Fig. 9 B in the figure is the same as ① test site 1, ② test site 2, ③ test site 3, ④ test site 4, and ⑤ test site 5. August 28, 2024 was the initial infection period, and no lesions appeared on the corn leaves in the field, but the instrument began to detect values. Fig. 9 C began to have diseased leaves for the first time (September 4, 2024) in the experimental field, and spore piles were seen on the corn leaves. Fig. 9 D in the figure is the test result. On or before August 27, 2024, the corn was not sick and no disease was detected. On August 28, the corn was not sick and the result was detected for the first time. As time went by, the test result value became larger and larger. On September 4, spore piles appeared for the first time and the corn in the field officially became sick, indicating that the test kit can detect the pathogen of southern corn rust about 7 days before the symptoms appear.

[0121] 2.5.2 Survey of morbidity in monitoring areas

[0122] Three plots were set up in the field, each with a size of 7m*10m. The susceptible corn variety Zhengdan 958 was planted and three treatments were set up, namely (1) control plot: no pesticide treatment; (2) early prevention and control plot: the plot where pesticides were applied immediately after rust was detected; and (3) conventional prevention and control plot: the plot where pesticides were applied after the leaves began to show symptoms.

[0123] When the southern rust pathogen of corn was detected for the first time, the advance control area began to apply pesticides. One week later, when the diseased corn leaves were clearly seen in the field, the conventional control area began to apply pesticides (the advance control area and the conventional control area used the same pesticide and the same application rate and both were conventional application methods). After application, the incidence rate was investigated using the five-point sampling method. The results of the test site incidence survey (Table 5) showed that on September 21, September 28 and October 4, 2024, when the southern rust pathogen of corn was detected and the pesticide was applied immediately (i.e., the advance control area), the prevention and control incidence rate was 19%, 20.2%, and 22%; the plots that started to apply pesticides after the leaves began to show symptoms (i.e., the conventional control area) were 27.7%, 31.6%, and 34%; the plots that did not apply pesticides (i.e., the control area) had an incidence rate of 28.2%, 34.4%, and 41.1%. The survey results show that the detection method optimized in this example can monitor the pathogen of southern corn rust before the leaves show symptoms, and early guidance of prevention and control can reduce the incidence of southern corn rust.

[0124] Table 5 Results of the morbidity survey at different application periods

[0125] Survey time The incidence rate in the control area Prevent and control the incidence rate in the community in advance The incidence rate in the conventional prevention and control area September 21 28.2％ 19％ 27.7％ September 28 34.4％ 20.2％ 31.6％ October 4 41.1％ 22％ 34％

Claims

1. A primer probe set for detecting southern corn rust, characterized in that: The method comprises an upstream primer F12, a downstream primer R11 and a probe, wherein the nucleotide sequence of the upstream primer F12 is shown in SEQ ID NO.3, the nucleotide sequence of the downstream primer R11 is shown in SEQ ID NO.6; the nucleotide sequence of the probe is shown in SEQ ID NO.10, wherein the 31st base T is modified with a FAM fluorescent group, a tetrahydrofuran THF is introduced between the 32nd base G and the 33rd base T as an abasic site, the 33rd base T is modified with a BHQ1 quenching group, and the 3' end is sealed with a C3 Spacer.

2. A corn southern rust detection kit, characterized in that: The invention comprises the primer probe set as claimed in claim 1 and a DNA constant temperature rapid amplification reagent.

3. A rapid early detection kit for southern corn rust in the field, characterized in that: The method comprises the corn southern rust detection kit according to claim 2 and a DNA type lysis solution.

4. The kit according to claim 3, characterized in that The corn southern rust detection kit contains all components of a DNA constant temperature rapid amplification kit: Abuffer, B buffer, positive control template, positive control primer MIX, lyophilized powder reagent, and the primer probe group described in claim 1; the DNA constant temperature rapid amplification kit is a fluorescent DNA constant temperature rapid amplification kit purchased from Anpu Future Biotechnology Co., Ltd., item number: WLE8202KIT.

5. The kit according to claim 4, characterized in that All components of the corn southern rust detection kit are prepared into a dry powder reagent and a buffer microsphere according to the amount of 50μL amplification reaction system for one detection, which are loaded into a PCR tube as a detection reagent tube; in the detection reagent tube, the upstream primer F12 is 20pmol, the downstream primer R11 is 20pmol, and the probe is 6pmol; the corn southern rust detection kit contains several detection reagent tubes.

6. The kit according to claim 3, characterized in that The DNA type lysis solution is a DNA type rapid nucleic acid release agent-II type, purchased from Anpu Future Biotechnology Co., Ltd., item number: WLD8201-ES.

7. A method for rapid early detection of southern corn rust in the field, characterized in that: The following steps are involved: S1. Take 2-3 small pieces of leaves with a size of 1 cm*1 cm from the lower leaves of the corn plant to be tested, about 15-20 cm away from the tip of the leaf, and put them in tube 1. Grind the sample with a grinding rod for 1 min, mix well, and place it at room temperature for 10 min for lysis to obtain a lysis product; the tube 1 is a 1.5 mL centrifuge tube containing 500 μL of DNA type lysis solution; S2. Use a 50 μL quantitative pipette to draw 50 μL of the lysate, add it to tube 2, and mix it for dilution; use a 50 μL quantitative pipette to draw 50 μL of the diluted lysate and add it to the detection reagent tube of claim 5, mix it and shake the liquid to the bottom of the tube to obtain a reaction tube; the tube 2 is a 1.5 mL centrifuge tube filled with 450 μL of sterile water; S3. Place the reaction tube in a digital thermostatic detector, set the temperature to 40°C, start the run, and amplify for 4 minutes. The instrument will emit a "beep" prompt sound. At this time, take out the reaction tube, mix it, shake the liquid to the bottom of the tube, and put it back into the digital thermostatic detector to continue amplification for 16 minutes. The program ends and the instrument displays the corresponding value of the well position; S4. Interpret according to the value displayed on the instrument: if the value displayed on the instrument is between 00-03, the result is negative, indicating that the tested sample does not contain the nucleic acid of the southern corn rust pathogen Puccinia multispinosa; if the value displayed on the instrument is between 04-99, the result is positive, indicating that the tested sample contains the nucleic acid of the southern corn rust pathogen Puccinia multispinosa.

8. The detection method according to claim 7, characterized in that: The DNA type lysis solution is a DNA type rapid nucleic acid release agent-II type, purchased from Anpu Future Biotechnology Co., Ltd., item number: WLD8201-ES.

9. The detection method according to claim 7, characterized in that: The digital constant temperature detector was purchased from: Anpu Future Biotechnology Co., Ltd., item number: WL-PS-8C.

10. Use of the southern corn rust detection primer probe set according to claim 1, the southern corn rust detection kit according to claim 2, or the southern corn rust field early rapid detection kit according to any one of claims 3 to 6 in detecting and preventing and controlling southern corn rust.

Images