QTL (Quantitative Trait Loci) location influencing wheat yield and candidate gene TaNPF8 and application thereof

Abstract

The invention discloses a QTL (Quantitative Trait Loci) location influencing wheat yield as well as a candidate gene TaNPF8 and application of the candidate gene TaNPF8. And a candidate gene, namely TaNPF8-6A and TaNPF8-6D, respectively exists on the QSn / Tgw-6A and the QGns / Sn / Tgw-6D positioned by the QTL, and the candidate genes are respectively TaNPF8-6A and TaNPF8-6D. The candidate genes TaNPF8-6A and TaNPF8-6D and the homologous gene TaNPF8-6B thereof are subjected to gene editing, and experiments prove that the TaNPF8-6A, TaNPF8-6B and TaNPF8-6D genes are constitutive expression and relatively conservative genes, and can influence the spikelet number, the grain number per ear and the grain weight of wheat, so that genetic improvement and molecular breeding of wheat yield traits are facilitated, and the yield of wheat is improved. And wheat variety screening can be accelerated, so that high-yield and super-high-yield wheat varieties can be obtained.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat molecular genetic breeding, and specifically relates to QTL positioning affecting wheat yield and candidate genes TaNPF8-6A, TaNPF8-6B, TaNPF8-6D and applications thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to increase some understanding of the overall background of the invention, and should not be necessarily regarded as an admission or any form of suggestion that the information constitutes the prior art already known to ordinary technicians in this field.

[0003] Wheat (Triticum aestivum L., 2n=6X=42, AABBDD) is a widely planted grass in the world and the most important food crop in the world. With the increase of global population, climate change and the reduction of arable land, higher and higher requirements are placed on wheat yield. Ensuring high and stable yields and green and sustainable development of wheat is a major problem that needs to be solved urgently in my country and even in the world. QTL positioning of wheat yield traits has always been a hot topic in wheat genetic research, but there are still few cloned genes. Therefore, identifying the QTLs and genes of the three elements of yield and yield composition, combining molecular-assisted breeding methods, and using QTLs and genes in a targeted manner to cultivate new high-yield and super-high-yield wheat varieties has far-reaching significance for achieving the sustainable development of my country's grain industry.

[0004] The two commonly used gene cloning methods in wheat are positional cloning and homologous cloning. At present, multiple genetic loci that control wheat yield and other traits have been identified. The wheat genome is large (17Gb) and complex, which poses great difficulties and challenges to the positional cloning and functional analysis of wheat genes. In terms of yield traits, relatively few genes have been isolated through positional cloning, including a series of plant height genes and genes related to the three elements of yield. This is far less than the number of yield-related trait genes isolated from model plants rice (https: / / funricegenes.github.io / ) and Arabidopsis thaliana (https: / / www.arabidopsis.org / ). The continuous updating and improvement of the wheat reference genome provides an important basis for the positional cloning of wheat yield genes.

[0005] The CRISPR / Cas9 system has become a widely used plant genome editing tool due to its simplicity, high efficiency and flexibility. High and stable yields are the primary goals of crop genetic breeding, and high-quality crop varieties are primarily characterized by high efficiency and increased yields. In recent years, the CRISPR / Cas9 system has been widely used in wheat, which provides new ideas for plant genetic improvement. Summary of the invention

[0006] In view of the prior art, the present invention provides a QTL positioning affecting wheat yield and its candidate genes TaNPF8-6A, TaNPF8-6B, TaNPF8-6D and applications. The QTL positioning QSn / Tgw-6A, QGns / Sn / Tgw-6D and its candidate genes TaNPF8-6A, TaNPF8-6D and homologous gene TaNPF8-6B are conducive to the breeding of high-yield wheat varieties.

[0007] The technical solution adopted by the present invention is as follows:

[0008] In the first aspect of the present invention, a QTL location affecting wheat yield is provided, which is specifically QSn / Tgw-6A and QGns / Sn / Tgw-6D, which are located on chromosomes 6A and 6D, respectively, with genetic distances of 5632.3cM~5638.4cM and 3298.3cM~3307.0cM, respectively.

[0009] In one or some embodiments of the present invention, the QTL positioning has the effect of increasing the number of ears, the number of grains per ear, and the grain weight. The enhancing allele comes from the maternal variety "Tainong 18", and the reducing allele comes from the paternal variety "Linmai No. 6".

[0010] In the second aspect of the present invention, a candidate gene TaNPF8-6A, TaNPF8-6B and TaNPF8-6D affecting wheat yield is provided, wherein the TaNPF8-6A and TaNPF8-6D are present in the QTL positioning QSn / Tgw-6A and QGns / Sn / Tgw-6D, and TaNPF8-6B is a homologous gene of TaNPF8-6A and TaNPF8-6D; the nucleotide sequences of the TaNPF8-6A, TaNPF8-6B and TaNPF8-6D are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively.

[0011] In one or some embodiments of the present invention, the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D have InDel mutations; the InDel mutations include 5 types: one is that TaNPF8-6B has a +1bp mutation; two is that TaNPF8-6D has a +3bp mutation; three is that TaNPF8-6B and TaNPF8-6D have +1bp and +1bp mutations, respectively; four is that TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D have -1bp, -26bp, and +1bp mutations, respectively; five is that TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D have +1bp, -26bp, and +1bp mutations, respectively, and the above are all related to the number of wheat spikelets, the number of grains per spike, and the thousand-grain weight. When the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D have the above five InDel mutations, wheat yield will be affected; compared with the wild-type wheat variety Fielder, the wheat mutants obtained by CRISPR / Cas9 gene editing of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D have significantly reduced spikelet number, number of grains per spike, and 1,000-grain weight.

[0012] Specifically: First, a G base was inserted after the 859th base in TaNPF8-6B, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon), and the translation was terminated prematurely.

[0013] Second, three bases CAA were inserted into the TaNPF8-6D gene after the 645bp, causing changes in the DNA sequence and leading to amino acid mutations.

[0014] Third, a G base was inserted after the 859th base in TaNPF8-6B, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon). A T base was inserted after the 859th base in TaNPF8-6D, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon).

[0015] Fourth, the 5th base A of the TaNPF8-6A gene was deleted (gDNA sequence, ATG is +1bp, the same below), causing an amino acid frameshift mutation, encoding 65 amino acids (excluding the stop codon); TaNPF8-6B had a deletion of 26 bases between 838-863 (GGAGACCTGACGGAGCTGGAGAAGAA), causing an amino acid frameshift mutation, encoding 267 amino acids (excluding the stop codon); TaNPF8-6D had a T base insertion after the 859th base, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon).

[0016] Fifth, a G base was inserted after the 18th base in the TaNPF8-6A gene, causing an amino acid frameshift mutation and encoding 18 amino acids (excluding the stop codon); 26 bases were deleted between 838-863 in TaNPF8-6B (GGAGACCTGACGGAGCTGGAGAAGAA), causing an amino acid frameshift mutation and encoding 267 amino acids (excluding the stop codon); a T base was inserted after the 859th base in TaNPF8-6D, causing an amino acid frameshift mutation and encoding 276 amino acids (excluding the stop codon).

[0017] In one or some embodiments of the present invention, compared with the wild-type wheat variety Fielder, the wheat mutants obtained by CRISPR / Cas9 gene editing of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D in the QTL positioning have significantly reduced spikelet number, grain number per spike, and thousand-grain weight.

[0018] In one or some embodiments of the present invention, the amplification primers of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D are respectively:

[0019] TaNPF8-6A-F: GATATGGACAGACTCACCTTTC (SEQ ID No. 7),

[0020] TaNPF8-6A-R: CTACTGTCCTACAATTGACTATG (SEQ ID No. 8),

[0021] TaNPF8-6B-F: CCCTTGATTTGGAATGAGCG (SEQ ID No. 9),

[0022] TaNPF8-6B-R: TCATCATACAGAGGCCCAAG (SEQ ID No. 10),

[0023] TaNPF8-6D-F: ACACTGCTGCTAATGAGTGA (SEQ ID No. 11),

[0024] TaNPF8-6D-R:TCCCATCAGTTAACCAAGCT (SEQ ID No. 12).

[0025] In the third aspect of the present invention, a coding protein is provided, which is the coding protein of the candidate genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D, and its amino acid sequence is shown as SEQ ID No.4, SEQ ID No.5 and SEQID No.6 respectively.

[0026] In the wild-type wheat variety Fielder, the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D were expressed in different tissues at different growth stages.

[0027] In a fourth aspect of the present invention, the QTL positioning, the candidate genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D, or the encoded proteins are used in at least one of the following aspects:

[0028] 1) Increase wheat yield;

[0029] 2) Breeding high-yielding wheat varieties or strains;

[0030] 3) Identify or screen high-yielding wheat varieties or lines.

[0031] In one or some embodiments of the present invention, in application 1) or 2), CRISPR / Cas9 gene editing is performed on the candidate genes TaNPF8-6A, TaNPF8-6B and / or TaNPF8-6D in the QTL positioning to obtain transgenic plants with deletion mutation genotypes, thereby obtaining high-yield wheat varieties or lines. Wherein, the mutation sites of the transgenic plants with mutant genotypes are candidate genes TaNPF8-6A, TaNPF8-6B, TaNPF8-6D having the above-mentioned 5 InDel variations.

[0032] In the present invention, the technology for obtaining a transgenic plant with a deletion mutation genotype is a conventional technology in the art. Further, the present invention provides a method for obtaining a transgenic plant with a deletion mutation genotype, using CRISPR / Cas9 gene editing technology, by performing CRISPR / Cas9 gene editing site-directed mutagenesis on wheat candidate genes TaNPF8-6A, TaNPF8-6B and / or TaNPF8-6D, by constructing a targeting vector containing three sgRNAs for the three genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D, and introducing the above-mentioned targeting vector plasmid into Agrobacterium EHA105, and by Agrobacterium-mediated genetic transformation of the wheat variety Fielder to obtain a transgenic plant with a deletion mutation genotype.

[0033] Furthermore, during the CRISPR / Cas9 gene editing process, the specific sgRNAs of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D were respectively

[0034] GGAAACAGCAGCAGCAGACG, ACCAATTCGACAGTGGAGAC, CCTGATGGAGCTGGAGAAGA.

[0035] In one or some embodiments of the present invention, in application 3), the method for identifying or screening high-yield wheat varieties or lines includes: extracting DNA from the wheat plants to be tested; amplifying the extracted DNA using amplification primers of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D; comparing the amplification results with those of the wild-type wheat variety Fielder. If the above-mentioned InDel variation appears in the amplified sequence, the number of ears, number of grains per ear and / or grain weight of the wheat to be tested are different from those of the wild-type wheat variety Fielder.

[0036] In a fifth aspect of the present invention, a method for increasing wheat yield is provided, the method comprising the following steps: using CRISPR / Cas9 gene editing technology to perform site-directed mutagenesis on wheat candidate genes TaNPF8-6A, TaNPF8-6B and / or TaNPF8-6D, constructing a targeting vector containing three sgRNAs for the three genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D, and introducing the above-mentioned targeting vector plasmid into Agrobacterium EHA105, and performing Agrobacterium-mediated genetic transformation of the wheat variety Fielder to obtain transgenic plants with deletion mutation genotypes, thereby obtaining high-yield wheat varieties or lines.

[0037] Compared with the related art known to the inventor, one of the technical solutions of the present invention has the following beneficial effects:

[0038] 1. The present invention locates two stable main effects QSn / Tgw-6A and QGns / Sn / Tgw-6D of wheat spike number, spike grain number and grain weight on chromosomes 6A and 6D in common wheat according to the results of QTL analysis; and screens two candidate genes TaNPF8-6A and TaNPF8-6D in their peak intervals, respectively. The TaNPF8-6A and TaNPF8-6D genes encode peptide transporters. Expression level analysis shows that TaNPF8-6A and TaNPF8-6D are constitutively expressed and relatively conservative genes.

[0039] 2. The present invention uses CRISPR / Cas9 technology to edit the A, B, and D subgroups of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes. Five homozygous mutant genotypes, AAbbDD (WT / +1bp / WT), AABBdd (WT / WT / +3bp), AAbbdd (WT / +1bp / +1bp), aabbdd-1 (-1bp / -26bp / +1bp), and aabbdd-2 (+1bp / -26bp / +1bp), are obtained in the T4 generation. These five mutant genotypes will cause frameshift mutations and cause the stop codon to appear early, resulting in inactivation of protein function. The experiment showed that compared with the wild-type variety Fielder, the five homozygous mutants showed a significant reduction in the number of spikelets, the number of grains per spike, and the thousand-grain weight, proving that the TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes control the number of spikelets, the number of grains per spike, and the thousand-grain weight of wheat. Therefore, the TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes are beneficial to the genetic improvement and molecular breeding of wheat spikelet number, grain number per spike, and thousand-grain weight, and can accelerate the screening of high-yield wheat varieties, or be used to regulate the grain number per spike of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute improper limitations on the present invention.

[0041] Figure 1 These are the QTL mapping results for the major QTLs for wheat yield traits, QSn / Tgw-6A and QGns / Sn / Tgw-6D.

[0042] Figure 2 These are the gene-edited mutant types of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes.

[0043] Figure 3 This is a significance analysis of the differences in the phenotypes of spikelet number, grain number per spike, and 1000-grain weight of different gene-edited mutants.

[0044] Figure 4 These are the phenotypic expressions of the TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes.

[0045] Figure 5 qRT-PCR analysis of TaNPF8 gene in different tissues at different developmental stages.

[0046] Figure 6 Subcellular localization of TaNPF8-6D gene protein. DETAILED DESCRIPTION

[0047] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0048] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations and / or combinations thereof.

[0049] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0050] In the following examples, unless otherwise specified, the experimental methods used are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0051] The wheat varieties used in the present invention: the gene cloning materials are the winter wheat varieties (lines) "Tainong 18" and "Linmai No. 6" and their recombinant inbred line populations (TL-RIL); the gene editing material is Fielder, and the above materials can all be obtained from Shandong Agricultural University.

[0052] Example 1: Determination of candidate genes for three wheat yield factors

[0053] WinQTLCart 2.5 software was used to conduct QTL analysis on the three yield traits of the TL-RIL population (Tainong 18 / Linmai 6).

[0054] The QTL analysis of the TL-RIL population (Table 1) revealed that a stable yield was obtained.

[0055] QTLs QSn / Tgw-6A and QGns / Sn / Tgw-6D are located on chromosomes 6A and 6D, with genetic distances of 5631.7-5639.3 cM and 3304.1-3308.4 cM, respectively, and peak positions of 5634.2 cM and 3306.1 cM, respectively. Figure 1). The genes covered by the peak are candidate genes. In the physical segments corresponding to QSn / Tgw-6A and QGns / Sn / Tgw-6D, there is an annotated gene TraesCS6A02G142600 (5634.2cM) and TraesCS6D02G132100 (3306.1cM) in Chinese Spring, so the two genes were selected as candidate genes. Both genes were annotated as peptide transporters, which are homologous genes of subgroups A and D, and belong to the NPF family (NRT1 / PTR, N itrate Transpoter1 / P eptideTransporter F Therefore, the two genes were named TaNPF8-6A and TaNPF8-6D, and TraesCS6B02G171000 in subgroup B was named TaNPF8-6B.

[0056] Table 1: Results of QTL analysis of yield in TL-RIL population (QGns / Sn / Tgw-6A, QGns / Sn / Tgw-6D)

[0057]

[0058] Note: SN: number of spikes, TGW: thousand-grain weight; GNS: number of grains per spike

[0059] Example 2: Amplification and sequence analysis of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes

[0060] Using the gene editing recipient wheat variety Fielder as the material, the sequences of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D were obtained by PCR specific amplification. The sequences of the primer pairs are as follows:

[0061] TaNPF8-6A-F: GATATGGACAGACTCACCTTTC (SEQ ID No. 7),

[0062] TaNPF8-6A-R: CTACTGTCCTACAATTGACTATG (SEQ ID No. 8),

[0063] TaNPF8-6B-F: CCCTTGATTTGGAATGAGCG (SEQ ID No. 9),

[0064] TaNPF8-6B-R: TCATCATACAGAGGCCCAAG (SEQ ID No. 10),

[0065] TaNPF8-6D-F: ACACTGCTGCTAATGAGTGA (SEQ ID No. 11),

[0066] TaNPF8-6D-R:TCCCATCAGTTAACCAAGCT (SEQ ID No. 12).

[0067] The PCR specific amplification system and reaction procedure are as follows:

[0068] PCR amplification system:

[0069]

[0070] The nucleotide sequences of the TaNPF8-6A, TaNPF8-6B and TaNPF8-6D genes obtained by amplification are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, and the amino acid sequences encoded by them are shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6. Specifically, they are as follows:

[0071] TaNPF8-6A gene: The full-length gDNA sequence is 2743bp, including 5 exons (sequence lengths are 60, 103, 218, 530, and 829bp, respectively) and 4 introns (sequence lengths are 131, 87, 77, and 260bp, respectively) and 5′-UTR (106bp) and 3′-UTR (342bp); the full-length cDNA sequence is 2640bp, which encodes 879 amino acids.

[0072] TaNPF8-6B gene: The full-length gDNA sequence is 2594bp, including 5 exons (sequence lengths are 60, 103, 218, 530, and 829bp, respectively) and 4 introns (sequence lengths are 131, 89, 74, and 260bp, respectively) and 5′-UTR (94bp) and 3′-UTR (206bp); the full-length cDNA sequence is 2640bp, which encodes 879 amino acids.

[0073] TaNPF8-6D gene: The full-length gDNA sequence is 2293bp, including 5 exons (sequence lengths are 60, 103, 218, 530, and 829bp, respectively) and 4 introns (sequence lengths are 131, 87, 77, and 259bp, respectively) and 3′-UTR (125bp); the full-length cDNA sequence is 2640bp, which encodes 879 amino acids.

[0074] Experimental Example 3: Analysis of TaNPF8-6A, TaNPF8-6B, TaNPF8-6D gene expression patterns and subcellular localization of TaNPF8-6D protein

[0075] Real-time fluorescence PCR was used to analyze the tissue expression patterns of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D. TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes were expressed in different tissues at different stages of Fielder. The genes were constitutively expressed ( Figure 5 ). TaNPF8-6D protein is localized in the cell membrane in tobacco leaf cells ( Figure 6 ).

[0076] Example 4: Verification of the functions of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes using the CRISPR / Cas9 system

[0077] The CRISPR / Cas9 system was used to edit the genes of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D. The steps are as follows:

[0078] (1) Design of sgRNA

[0079] According to the candidate gene Chinese Spring sequence, a suitable target sequence was found, and sgRNA was designed using the CRISPR direct website (http: / / crispr.dbcls.jp / ). The TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes were edited, and the specific sgRNA of the gene was designed. The specific sequences are as follows:

[0080] TaNPF8-6A-sgRNA: GGAAACAGCAGCAGCAGACG (SEQ ID No. 13),

[0081] TaNPF8-6B-sgRNA: ACCAATTCGACAGTGGAGA (SEQ ID No. 14),

[0082] TaNPF8-6D-sgRNA: CCTGATGGAGCTGGAGAAGA (SEQ ID No. 15).

[0083] (2) Construction of CRISPR editing vector

[0084] The CRISPR / Cas9 editing vector method used in this example was provided by the Crop Research Institute of the Shandong Academy of Agricultural Sciences. The E. coli culture containing the large vector pBUE411 and the intermediate vector U6.1 / U6.3 was revived and the plasmid was extracted from the culture according to the instructions of the SteadyPure plasmid extraction kit. The available primers were designed according to the sequences of sgRNA, intermediate vector and large vector for amplification, restriction digestion, ligation and transformation.

[0085] The specific steps are as follows:

[0086] Splicing of three sgRNAs (construction of transformation vector): 6A-sgRNA was divided into two parts, 6A-sgRNA-1 (GGAAACAGCAG) and 6A-sgRNA-2 (GCAGCAGCAGACG), and primers 14-ZZZ-F1 / R1 were designed to splice 6B-sgRNA with 6A-sgRNA-1, and primers 14-ZZZ-F2 / R2 were designed to splice 6D-sgRNA with 6B-sgRNA-2. Primers 14-ZZZ-F1 / R1 were used to PCR amplify the intermediate vector 3571, and primers 14-ZZZ-F2 / R2 were used to PCR amplify the intermediate vector 3561 to obtain two PCR product fragments. [Vectors 3561 and 124-6 were provided by Shandong Academy of Agricultural Sciences]

[0087] 14-ZZZ-F1:

[0088] GaagcGGTCTCCGGCG ACCAATTCGACAGTGGAGAC gtttcagagctatgctggaaacagc(SEQ IDNo.16),

[0089] 14-ZZZ-R1:GGGTTGGTCTCA CTGCTGTTTCC gagtctgtgtgcagcgcgtg (SEQ ID No. 17),

[0090] 14-ZZZ-F2:gaagcGGTCTCC GCAGCAGCAGACG gtttcagagctatgctggaaacagc(SEQ IDNo.18),

[0091] 14-ZZZ-R2:

[0092] GGGTTGGTCTCAaaac TCTTCTCCAGCTCCATCAGG caagtctgatgcagcaagcgag (SEQ ID No. 19).

[0093] Agrobacterium transformation: The two PCR fragments and the final vector 124-6 were digested with BsaI endonuclease and then connected to construct a targeting vector containing three sgRNAs targeting the three genes TaNPF8-6A / 6B / 6D. The above targeting vector plasmid was introduced into Agrobacterium EHA105, and the positive clone bacterial liquid was entrusted to the Transgenic Center of Li Genying's team of Shandong Academy of Agricultural Sciences to complete the transformation of Fielder.

[0094] (3) Gene Editing

[0095] The Crop Research Institute of Shandong Academy of Agricultural Sciences completed the wheat (Fielder) Agrobacterium transformation editing work on our behalf, and obtained gene-edited plants.

[0096] (4) Gene mutation detection of transgenic plants:

[0097] In November 2020, 17 T0 mutants of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D genes were obtained from the transgenic platform of the Crop Research Institute of the Shandong Academy of Agricultural Sciences; T1 mutants were planted in April 2021 and harvested in single ears; T2 mutants were planted in October 2021, and a total of 8 positive seedlings were obtained, which were harvested in single ears; T3 mutants were planted in February 2022, and single ears were harvested in June 2022, and a total of 20 positive seedlings were obtained. In September 2022, T4 mutants were planted, and edited plants were sampled at the jointing stage of wheat, and gDNA was extracted. Fielder's gDNA was used as a blank control to detect the type of gene editing.

[0098] According to the requirements of the Hi-TOM kit, a bridging sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward primer, and a bridging sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse primer. The detection primers were designed as follows:

[0099] HiTomTaNPF8-6A-F: ggagtgagtacggtgtgcTCTGCTCCATCGACCAT (SEQ IDNo. ​​20),

[0100] HiTomTaNPF8-6A-R: gagttggatgctggatggAGATCCATCGACGGTGTAG (SEQ ID No. 21),

[0101] HiTomTaNPF8-6B-F: ggagtgagtacggtgtgcGCCTTCTTGGCGGACT (SEQ IDNo. ​​22),

[0102] HiTomTaNPF8-6B-R: gagttggatgctggatggAAGGGAGCCGAGATTGAGC (SEQ ID No. 23),

[0103] HiTomTaNPF8-6D-F: ggagtgagtacggtgtgcACAGCTAACCGAGCAGATA (SEQ ID No. 24),

[0104] HiTomTaNPF8-6D-R: gagttggatgctggatggGTGCTTGACAGAAGGGAG (SEQ ID No. 25).

[0105] The first round of PCR amplification of the target fragment was performed using the detection primers and the second round of PCR was performed using the Hi-TOM kit. The samples were mixed and recovered by tapping, and sent for sequencing. The sequence obtained by sequencing was compared with the reference sequence of the target gene to know the mutation site and type of the gene-edited plant.

[0106] (5) Identification of T4 transgenic plants:

[0107] During the grain filling period, the number of spikelets and number of grains per spike of gene-edited plants and Fielder were investigated, and the thousand-grain weight, grain length, and grain width were measured with a SC-G seed meter after harvest. Data were analyzed using Microsoft Excel 2016 and SPSS26.0, and independent sample t-test was used for significant difference analysis.

[0108] A total of five homozygous T4 generation homozygous mutant genotypes were obtained: AAbbDD, AABBdd, AAbbdd, aabbdd-1, aabbdd-2 ( Figure 2 ):

[0109] AAbbDD (WT / +1bp / WT): Single coding, a G base was inserted after the 859th base in TaNPF8-6B, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon), and premature translation termination.

[0110] AABBdd (WT / WT / +3bp): Single coding, three bases CAA are inserted after the 645bp of TaNPF8-6D gene, causing DNA sequence changes and possibly leading to amino acid mutations.

[0111] AAbbdd (WT / +1bp / +1bp): double coding, TaNPF8-6B has a G base inserted after the 859th base, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon). TaNPF8-6D has a T base inserted after the 859th base, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon).

[0112] aabbdd-1(-1bp / -26bp / +1bp): Triple encoding: the fifth base A of the TaNPF8-6A gene is deleted (gDNA sequence, ATG is +1bp, the same below), causing an amino acid frameshift mutation, encoding 65 amino acids (excluding the stop codon); 26 bases between 838-863 of TaNPF8-6B are deleted (GGAGACCTGACGGAGCTGGAGAAGAA), causing an amino acid frameshift mutation, encoding 267 amino acids (excluding the stop codon); a T base is inserted after the 859th base of TaNPF8-6D, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon).

[0113] aabbdd-2 (+1bp / -26bp / +1bp): Triple encoding: a G base is inserted after the 18th base in the TaNPF8-6A gene, causing an amino acid frameshift mutation, encoding 18 amino acids (excluding the stop codon); 26 bases are deleted between 838-863 in TaNPF8-6B (GGAGACCTGACGGAGCTGGAGAAGAA), causing an amino acid frameshift mutation, encoding 267 amino acids (excluding the stop codon); a T base is inserted after the 859th base in TaNPF8-6D, causing an amino acid frameshift mutation, encoding 276 amino acids (excluding the stop codon).

[0114] The above five mutants all lead to premature termination of translation, which may cause the loss of function of TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D.

[0115] As shown in Table 2, the average spikelet numbers of the five mutants AAbbDD, AABBdd, AAbbdd, aabbdd-1, aabbdd-2 and the wild type Fielder (WT) harvested in the T4 generation were 24.5, 22.8, 24.0, 24.5, 25.0, and 26.5, respectively; the average number of grains per ear was 40.8, 40.4, 39.3, 44.7, 44.3, and 49.0, respectively; and the average thousand-grain weight was 45.5 g, 45.6 g, 45.3 g, 42.5 g, 37.8 g, and 46.8 g, respectively. Compared with the wild type Fielder (WT), the spikelet number and grain number per ear of the three mutants AAbbDD, AABBdd, and AAbbdd were significantly reduced, but the thousand-grain weight was reduced but the difference was not significant. The spikelet number and grain number per ear of the two mutants aabbdd-1 and aabbdd-2 were significantly reduced, and the thousand-grain weight of aabbdd-1 and aabbdd-2 was significantly reduced. The above results show that TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D are genes controlling the spikelet number, grain number per ear, and thousand-grain weight ( Figure 3 and Figure 4 ).

[0116] Table 2: Phenotypic data of wild-type Fielder (WT) and TaNPF8-6A, TaNPF8-6B, TaNPF8-6D mutants

[0117]

[0118]

[0119] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A QTL location affecting wheat yield, characterized in that: Specifically, they are QSn / Tgw-6A and QGns / Sn / Tgw-6D, which are located on chromosomes 6A and 6D, respectively, with genetic distances of 5632.3cM~5638.4cM and 3298.3cM~3307.0cM.

2. The QTL location affecting wheat yield as claimed in claim 1, characterized in that: The QTL positioning has the effect of increasing the number of ears, the number of grains per ear, and the grain weight. The effect-enhancing allele comes from the maternal variety "Tainong 18", and the effect-reducing allele comes from the paternal variety "Linmai 6".

3. A candidate gene TaNPF8-6A, TaNPF8-6B and TaNPF8-6D affecting wheat yield, characterized in that Ta NPF8-6A and TaNPF8-6D are present in the QTL mapping QSn / Tgw-6A and QGns / Sn / Tgw-6D described in claim 1, and TaNPF8-6B is a homologous gene of TaNPF8-6A or TaNPF8-6D; the nucleotide sequences of TaNPF8-6A, TaNPF8-6B and TaNPF8-6D are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively.

4. A coding protein, characterized in that It is the encoded protein of the candidate genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D described in claim 2, and its amino acid sequence is shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 respectively.

5. Use of the QTL mapping according to claim 1 or 2, the candidate genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D according to claim 3, or the encoded protein according to claim 4 in at least one of the following aspects: 1) Increase wheat yield; 2) Breeding high-yielding wheat varieties or strains; 3) Identify or screen high-yielding wheat varieties or lines.

6. The use according to claim 5, characterized in that: The candidate genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D have InDel mutations; the InDel mutations include 5 types: one is a +1bp mutation in TaNPF8-6B; two is a +3bp mutation in TaNPF8-6D; three is a +1bp and +1bp mutation in TaNPF8-6B and TaNPF8-6D, respectively; four is a -1bp, -26bp and +1bp mutation in TaNPF8-6A, TaNPF8-6B and TaNPF8-6D, respectively; five is a +1bp, -26bp and +1bp mutation in TaNPF8-6A, TaNPF8-6B and TaNPF8-6D, respectively, all of which are related to the number of wheat spikelets, the number of grains per spike and the thousand-grain weight; By performing CRISPR / Cas9 gene editing on the candidate genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D in the QTL positioning, transgenic plants with deletion mutation genotypes are obtained, thereby obtaining high-yield wheat varieties or lines; wherein the mutant genes of the mutant genotype transgenic plants are candidate genes TaNPF8-6A, TaNPF8-6B, TaNPF8-6D having the InDel variation described in claim 6.

7. The use according to claim 5, characterized in that: Compared with the wild type of wheat, the spikelet number, the number of grains per spike and / or the thousand-grain weight of the wheat mutants edited by CRISPR / Cas9 of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D are significantly reduced.

8. The use according to claim 7, characterized in that During the CRISPR / Cas9 gene editing process, the specific sgRNAs of the candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D were GGAAACAGCAGCAGCAGACG, ACCAATTCGACAGTGGAGAC, and CCTGATGGAGCTGGAGAAGA, respectively.

9. The use according to claim 7, characterized in that: The method for identifying or screening high-yield wheat varieties or strains comprises: extracting DNA from wheat plants to be tested; amplifying the extracted DNA using amplification primers of candidate genes TaNPF8-6A, TaNPF8-6B, and TaNPF8-6D; comparing the amplification results with those of the wild-type wheat variety Fielder. If the InDel variation described in claim 6 appears in the amplified sequence, the number of spikes, the number of grains per spike, and / or the grain weight of the wheat to be tested are different from those of the wild-type wheat variety Fielder.

10. A method for increasing wheat yield, characterized in that: The method comprises the following steps: using CRISPR / Cas9 gene editing technology to perform site-directed mutation on wheat candidate genes TaNPF8-6A, TaNPF8-6B and / or TaNPF8-6D, constructing a targeting vector containing three sgRNAs targeting the three genes TaNPF8-6A, TaNPF8-6B and TaNPF8-6D, and introducing the above-mentioned targeting vector plasmid into Agrobacterium EHA105, and genetically transforming the wheat variety Fielder mediated by Agrobacterium to obtain transgenic plants with deletion mutation genotypes, thereby obtaining high-yield wheat varieties or lines.

Images