Optimal index sequences for multiplex massively parallel sequencing

Abstract

The invention relates to optimal index sequences for multiplex massively parallel sequencing. The disclosed embodiments relate to indexed oligonucleotides configured to identify a source of a nucleic acid sample, as well as methods, apparatus, systems, and computer program products for identifying and preparing indexed oligonucleotides. In some embodiments, the indexed oligonucleotide comprises a set of indexed sequences, the Hamming distance between any two indexed sequences in the set of indexed sequences satisfying one or more criteria. Systems, devices, and computer program products for determining a sequence of interest using indexed oligonucleotides are also provided.

Description

[0001] This application is a divisional application of an application with a filing date of May 1, 2018, application number 201880042029.2, and invention name “Optimal Index Sequences for Multiple Massively Parallel Sequencing”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 492,851, filed on May 1, 2017, entitled OPTIMAL INDEX SEQUENCES FOR MULTIPLEX MASSIVELY PARALLEL SEQUENCING, under 35 U.S.C. §119(e); this application also claims the benefit of U.S. Provisional Patent Application No. 62 / 524,390, filed on June 23, 2017, entitled OPTIMAL INDEX SEQUENCES FOR MULTIPLEX MASSIVELY PARALLEL SEQUENCING, under 35 U.S.C. §119(e); all of the above prior applications are incorporated herein by reference in their entirety for all purposes.

[0004] Incorporation by Reference into the Sequence Listing

[0005] This application includes a sequence listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. This ASCII copy, created on May 1, 2018, is named ILMNP022_ST25.txt and is 29,563 bytes in size.

[0006] background

[0007] The present disclosure relates, among other aspects, to sequencing polynucleotides from multiple libraries; and more particularly, to increasing the probability that sequencing correctly identifies the library from which the polynucleotide originated.

[0008] Improvements in next-generation sequencing (NGS) technology have greatly increased sequencing speed and data output, leading to massive sample throughput for current sequencing platforms. About 10 years ago, the Illumina Genome Analyzer was able to generate up to 1 gigabyte of sequence data per run. Today, the Illumina NovaSeq TM The system in the series is capable of generating up to 2 terabytes of data in two days, which represents a greater than 2000x increase in capacity.

[0009] One aspect of achieving this increased capability is multiplexing, which adds a unique sequence called an index to each DNA fragment during library preparation. This allows a large number of libraries to be pooled and sequenced simultaneously during a single sequencing run. The flux gain from multiplexing is accompanied by an additional layer of complexity, because before the final data analysis, the sequencing reads from the pooled libraries need to be identified and sorted computationally in a process called demultiplexing. The misassignment of indexes between multiplexed libraries is a known problem that has affected NGS technology since the time of developing sample multiplexing (Kircher et al., 2012, Nucleic Acids Res., Vol. 40, No. 1).

[0010] Overview

[0011] The disclosed embodiments relate to index oligonucleotides configured to identify the origin of a sample in massively parallel multiplex sequencing. Methods, devices, systems, and computer program products for identifying and preparing index oligonucleotides are also provided.

[0012] One aspect of the present disclosure provides an oligonucleotide set comprising a plurality of subsets of oligonucleotides. The oligonucleotide set is configured to identify the source of a nucleic acid sample in multiple massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules. The oligonucleotide set comprises an index sequence set comprising at least 6 different index sequences, each of the plurality of subsets of oligonucleotides comprising a plurality of index sequences in the index sequence set. The Hamming distance between any two index sequences in the index sequence set is not less than a first criterion value, wherein the first criterion value is at least 2. The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at the corresponding sequence positions of each pair of color-balanced index sequences include the following two: (i) adenine (A) bases or cytosine (C) bases, and (ii) guanine (G) bases, thymine (T) bases or uracil (U) bases. In some embodiments, the index sequence set comprises a plurality of pairs of color-balanced index sequences. In some embodiments, the set of index sequences consists of or consists essentially of multiple pairs of color-balanced index sequences.

[0013] In some embodiments, each of a plurality of subsets of oligonucleotides comprises one or more pairs of color-balanced index sequences. In some embodiments, a set of oligonucleotides comprises (a) double-stranded or Y-shaped sequencing adapters, each strand of each double-stranded or Y-shaped sequencing adapter comprising an index sequence of a set of index sequences or its reverse complement; or (b) single-stranded oligonucleotide pairs, each pair provided together in a reagent, each oligonucleotide in a pair comprising an index sequence of a set of index sequences or its reverse complement.

[0014] In some embodiments, (a) each Y-shaped or double-stranded sequencing adapter comprises a first strand and a second strand, wherein the first strand comprises a first index sequence selected from a first subset of the set of index sequences and the second strand comprises a second index sequence selected from a second subset of the set of index sequences (or the reverse complement of the second subset); or (b) each pair of oligonucleotides comprises a first oligonucleotide and a second oligonucleotide, wherein the first oligonucleotide comprises a first index sequence selected from a first subset of the set of index sequences and the second oligonucleotide comprises a second index sequence selected from a second subset of the set of index sequences (or the reverse complement of the second subset). In some embodiments, the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

[0015] In some embodiments, the first subset comprises the subset listed in Table 1 and the second subset comprises the subset listed in Table 2.

[0016] In some embodiments, the first index sequence and the second index sequence are, respectively: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 or its reverse complement; the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 or its reverse complement; the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 or its reverse complement; the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 or its reverse complement; the nth 10-mer in SEQ ID NO:18 and the nth 10-mer in SEQ ID NO:19 or its reverse complement.

[0017] In some embodiments, the first subset and the second subset are the same.In some embodiments, the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

[0018] In some embodiments, the subset of index sequences is selected from one of the subsets of index sequences in Table 3.

[0019] In some embodiments, the set of index sequences comprises the 10-mer of SEQ ID NO:9.

[0020] In some embodiments, each of the multiple subsets of oligonucleotides comprises an index sequence corresponding to a 10-mer in one of the following sequences: SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19.

[0021] In some embodiments, each of the plurality of subsets of oligonucleotides comprises an index sequence corresponding to the reverse complement of a 10-mer of one of the following sequences: SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:19.

[0022] In some embodiments, the set of index sequences includes multiple non-overlapping subsets of index sequences, and the Hamming distance between any two index sequences in any subset is not less than a second standard value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5.

[0023] In some embodiments, an oligonucleotide in a set of oligonucleotides comprises a primer having an index sequence on its 3' end and an index sequence on its 5' end.

[0024] In some embodiments, a set of index sequences are contained in Y-shaped sequencing adapters, each of which contains an index sequence on only one strand.

[0025] In some embodiments, the set of oligonucleotides comprises polymerase chain reaction (PCR) primers or their reverse complements.

[0026] In some embodiments, the first standard value is 3. In some embodiments, the first standard value is 4.

[0027] In some embodiments, the edit distance between any two index sequences in the set of index sequences is no less than a third standard value. In some embodiments, the edit distance is a modified Levenshtein distance in which end gaps are not assigned a penalty. In some embodiments, the third standard value is 3. In some embodiments, the third standard value is 2. In some embodiments, each index sequence in the set of index sequences has 8 bases; the first standard value is 3; and the third standard value is 2. In some embodiments, the set of index sequences comprises the sequences listed under Example 2.

[0028] In some embodiments, each index sequence in the set of index sequences has 10 bases; the first standard value is 4; and the third standard value is 3.

[0029] In some embodiments, the set of index sequences does not include any subsequence of the sequence of an adapter or primer in a sequencing platform, or the reverse complement of such a subsequence.

[0030] In some embodiments, the sequences of adapters or primers in a sequencing platform include SEQ ID NO: 1 (AGATGTGTATAAGAGACAG), SEQ ID NO: 3 (TCGTCGGCAGCGTC), SEQ ID NO: 5 (CCGAGCCCACGAGAC), SEQ ID NO: 7 (CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO: 8 (AATGATACGGCGACCACCGAGATCTACAC).

[0031] In some embodiments, each index sequence in a set of oligonucleotides has 32 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 16 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 10 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 10 bases. In some embodiments, each index sequence in a set of oligonucleotides has 8 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 8 bases. In some embodiments, each index sequence in a set of oligonucleotides has 7 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 6 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 5 bases or less. In some embodiments, each index sequence in a set of oligonucleotides has 4 bases or less.

[0032] In some embodiments, the index sequence set does not include index sequences that are empirically determined to have poor performance in indexing the source of nucleic acid samples in multiple massively parallel sequencing. In some embodiments, the index sequences that are not included include sequences in Table 4.

[0033] In some embodiments, the set of index sequences includes at least 12 different index sequences.

[0034] In some embodiments, a set of index sequences comprises at least 20, at least 24, at least 28, at least 48, at least 96 or at least 384 different index sequences.

[0035] In some embodiments, a set of index sequences does not include any homopolymers having four or more consecutive identical bases.

[0036] In some embodiments, the set of index sequences does not include an index sequence that matches or is reverse complementary to one or more sequencing primer sequences. In some embodiments, the sequencing primer sequence is included in the sequence of the oligonucleotide.

[0037] In some embodiments, the set of index sequences does not include an index sequence that matches or is reverse complementary to one or more flow cell amplification primer sequences. In some embodiments, the flow cell amplification primer sequence is included in the sequence of the oligonucleotide.

[0038] In some embodiments, a set of index sequences comprises index sequences having the same number of bases.

[0039] In some embodiments, each index sequence in a set of index sequences has a combined number of between 2 and 6 guanine bases and cytosine bases.

[0040] In some embodiments, each index sequence in a set of index sequences has a guanine / cytosine (GC) content between 25% and 75%.

[0041] In some embodiments, the set of oligonucleotides comprises DNA oligonucleotides or RNA oligonucleotides.

[0042] In some embodiments, the oligonucleotide set is provided in a container comprising a plurality of separate compartments. In some embodiments, the container comprises a multiwell plate. In some embodiments, each compartment comprises a plurality of oligonucleotides comprising an index sequence of an index sequence set, the one index sequence being different from the index sequences contained in the other compartments. In some embodiments, each compartment comprises (a) a first plurality of oligonucleotides comprising a first index sequence in the index sequence set and (b) a second plurality of oligonucleotides comprising a second index sequence in the index sequence set, the ordered combination of (a) and (b) in a compartment being different from the ordered combination of (a) and (b) in any other compartment.

[0043] In some embodiments, the first index sequence in each compartment is different from the first index sequence in any other compartment, and the second index sequence in each compartment is different from the second index sequence in any other compartment. In some embodiments, the first index sequence and the second index sequence in the compartment are: the nth 10-mer in SEQ ID NO: 10 and the nth 10-mer in SEQ ID NO: 11 (or its reverse complement); the nth 10-mer in SEQ ID NO: 12 and the nth 10-mer in SEQ ID NO: 13 (or its reverse complement); the nth 10-mer in SEQ ID NO: 14 and the nth 10-mer in SEQ ID NO: 15 (or its reverse complement); the nth 10-mer in SEQ ID NO: 16 and the nth 10-mer in SEQ ID NO: 17 (or its reverse complement); the nth 10-mer in SEQ ID NO: 18 and the nth 10-mer in SEQ ID NO: 19 (or its reverse complement).

[0044] In some embodiments, the first plurality of oligonucleotides comprises a P5 flow cell amplification primer binding site and the second plurality of oligonucleotides comprises a P7' flow cell amplification primer binding site.

[0045] In some embodiments, the first plurality of oligonucleotides comprises an i5 index sequence and the second plurality of oligonucleotides comprises an i7 index sequence.

[0046] In some embodiments, each index sequence contained in the first plurality of oligonucleotides is selected from a first subset of the set of index sequences, and each index sequence contained in the second plurality of oligonucleotides is selected from a second subset of the set of index sequences, and the first subset does not overlap with the second subset.

[0047] In some embodiments, a plurality of individual compartments are arranged in an array of one or more rows of compartments and one or more columns of compartments. In some embodiments, each 1 / n row and / or each 1 / m column of compartments comprises an oligonucleotide comprising at least one pair of color-balanced index sequences, wherein n and m are each selected from an integer in the range of 1 to 24.

[0048] In some embodiments, the plurality of individual compartments are arranged in an array of 8 rows and 12 columns or in an array of 16 rows and 24 columns. In some embodiments, each 1 / 4 row of compartments comprises oligonucleotides comprising at least one pair of color-balanced index sequences, and wherein each 1 / 4 column of compartments comprises oligonucleotides comprising at least one pair of color-balanced index sequences. In some embodiments, multiple separate compartments are arranged in an array of AH rows and 1-12 columns, and wherein for the nth compartment on list A1, A2, A3, ..., A12, B1, B2, ..., B12, ..., H1, H2, ..., H12, the first index sequence and the second index sequence are respectively: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 (or its reverse complement); the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 (or its reverse complement); the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 (or its reverse complement); or the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 (or its reverse complement).

[0049] In some embodiments, the plurality of separate compartments comprises Figure 4B The first plurality of index sequence oligonucleotides are arranged in the layout shown in the figure, and the plurality of separate compartments also contain oligonucleotides containing Figure 4C The second plurality of index sequence oligonucleotides are arranged in the layout format shown.

[0050] Another aspect of the present disclosure relates to a method for preparing a plurality of oligonucleotides for multiplex massively parallel sequencing, the method comprising:

[0051] (a) selecting a set of index sequences from a collection of different index sequences, where

[0052] The index sequence set contains at least 6 different sequences;

[0053] The Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2; and

[0054] The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base; and

[0055] (b) Synthesizing a plurality of oligonucleotides comprising the set of index sequences.

[0056] In some embodiments, a plurality of oligonucleotides comprise double-stranded or Y-shaped sequencing adapters, each strand of each sequencing adapter comprising an index sequence from a set of index sequences. In some embodiments, each Y-shaped sequencing adapter comprises a first strand and a second strand, the first strand comprising an index sequence selected from a first subset of the set of index sequences, the second strand comprising an index sequence selected from a second subset of the set of index sequences, the first subset not overlapping the second subset. In some embodiments, the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site. In some embodiments, one or more first subsets comprise the index sequences listed in Table 1, and one or more second subsets comprise the index sequences listed in Table 2.

[0057] In some embodiments, each double-stranded or Y-shaped sequencing adapter comprises a first strand comprising an index sequence selected from a subset of a plurality of subsets in a set of index sequences and a second strand comprising an index sequence selected from the subset.

[0058] In some implementations, the index sequence set includes the index sequences in Table 3.

[0059] In some embodiments, an oligonucleotide in the plurality of oligonucleotides comprises an index sequence on its 3' end and an index sequence on its 5' end.

[0060] In some embodiments, a set of index sequences are contained in double-stranded or Y-shaped sequencing adapters, each sequencing adapter containing an index sequence on only one strand.

[0061] In some embodiments, the plurality of oligonucleotides comprises a polymerase chain reaction (PCR) primer or its reverse complement.

[0062] In some embodiments, the set of index sequences does not include any subsequence of the sequence of an adapter or primer in a sequencing platform, or the reverse complement of such a subsequence.

[0063] In some embodiments, the sequences of adapters or primers in a sequencing platform include SEQ ID NO: 1 (AGATGTGTATAAGAGACAG), SEQ ID NO: 3 (TCGTCGGCAGCGTC), SEQ ID NO: 5 (CCGAGCCCACGAGAC), SEQ ID NO: 7 (CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO: 8 (AATGATACGGCGACCACCGAGATCTACAC).

[0064] In some embodiments, step (a) includes: (i) selecting a candidate set of index sequences from a collection of index sequences; (ii) separating the selected candidate set into a plurality of groups of color-balanced index sequence pairs; and (iii) using a bipartite graph matching algorithm to divide each group into two subsets of color-balanced pairs, wherein each color-balanced pair is a node in the bipartite graph. In some embodiments, two nodes are connected if the Hamming distance between the index sequences of the two nodes is less than a second criterion value, wherein the second criterion value is greater than the first criterion value. In some embodiments, the first criterion value is 4 and the second criterion value is 5.

[0065] In some embodiments, step (i) comprises: (1) adding to the candidate set color-balanced index sequence pairs randomly selected from a collection of index sequences, wherein the collection comprises all possible n-mers; (2) sorting the remaining index sequences in the collection of index sequences based on a minimum Hamming distance to a member in the candidate set; (3) removing any remaining index sequences whose minimum Hamming distance to a member in the candidate set is less than a first criterion value or whose minimum edit distance to a member in the candidate set is less than a third criterion value; and repeating steps (1)-(3) to maximize the size of the candidate set. In some embodiments, the first criterion value is 4 and the third criterion value is 3. In some embodiments, the n-mer comprises an 8-mer, a 9-mer, or a 10-mer.

[0066] In some embodiments, the first standard value is 3, the third standard value is 2, and the n-mer includes an 8-mer.

[0067] In some embodiments, step (ii) includes: (1) randomly selecting a seed for each of the plurality of groups; and (2) greedily expanding each of the plurality of groups.

[0068] In some embodiments, the method further comprises, prior to step (i), removing a subset of index sequences from the collection of index sequences. In some embodiments, the subset of index sequences comprises index sequences having four or more consecutive identical bases. In some embodiments, the removed subset of index sequences comprises index sequences having a combined number of guanine bases and cytosine bases less than 2 or greater than 6.

[0069] In some embodiments, the subset of index sequences removed comprises index sequences having a G / C content of less than 25% or greater than 75%. In some embodiments, the subset of index sequences removed comprises index sequences having a sequence that matches or is reverse complementary to one or more sequencing primer sequences. In some embodiments, the sequencing primer sequence is contained in the sequence of the index oligonucleotide. In some embodiments, the subset of index sequences removed comprises index sequences having a sequence that matches or is reverse complementary to one or more flow cell amplification primer sequences. In some embodiments, the flow cell amplification primer sequence is contained in the sequence of the index oligonucleotide. In some embodiments, the subset of index sequences removed comprises index sequences that are empirically determined to have poor performance in indexing the source of nucleic acid samples in multiple massively parallel sequencing. In some embodiments, the subset of index sequences removed comprises the sequences in Table 4.

[0070] Another aspect of the present disclosure relates to a computer program product comprising a non-transitory machine-readable medium storing program code, which, when executed by one or more processors of a computer system, causes the computer system to implement a method for selecting a set of index sequences to be incorporated into a set of oligonucleotides configured for multiplexed massively parallel sequencing, the program code comprising: (a) code for adding to the candidate set of index sequences pairs of color-balanced index sequences randomly selected from a pool of different index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an adenine base; or cytosine base, and (ii) guanine base, thymine base or uracil base; (b) code for sorting the remaining index sequences in the collection of index sequences based on a minimum Hamming distance to a member in the candidate set; (c) code for removing any remaining index sequences whose minimum Hamming distance to a member in the candidate set is less than a first criterion value or whose minimum edit distance to a member in the candidate set is less than a second criterion value; (d) code for repeating (a)-(c) to maximize the size of the candidate set; and (e) code for selecting a set of index sequences from the candidate set to be incorporated into an oligonucleotide set, the oligonucleotide set being configured for multiplex massively parallel sequencing.

[0071] In some embodiments, the program code further includes: code for separating the candidate set into a plurality of groups; and code for partitioning each group into two subgroups using a bipartite graph matching algorithm, wherein each index sequence is a node.

[0072] In some embodiments, the program code further comprises code for controlling a nucleic acid synthesizer to synthesize a set of oligonucleotides configured for multiplexed massively parallel sequencing.

[0073] Also provided are systems, apparatus, and computer program products for identifying and preparing index oligonucleotides, and determining the sequence of DNA fragments using the disclosed index sequences.

[0074] The present invention also provides the following contents:

[0075] 1. An oligonucleotide set, the oligonucleotide set comprising a plurality of subsets of oligonucleotides, wherein:

[0076] The oligonucleotide set is configured to identify the source of nucleic acid samples in multiplex massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules;

[0077] The set of oligonucleotides comprises a set of index sequences, the set of index sequences comprises at least 6 different index sequences, and each of the plurality of subsets of oligonucleotides comprises a plurality of index sequences of the set of index sequences;

[0078] The Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2; and

[0079] The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) adenine (A) bases or cytosine (C) bases, and (ii) guanine (G) bases, thymine (T) bases or uracil (U) bases.

[0080] 2. The set of oligonucleotides as described in item 1, wherein each of the multiple subsets of oligonucleotides comprises one or more pairs of color-balanced index sequences.

[0081] 3. An oligonucleotide set as described in any of the preceding items, wherein the oligonucleotide set comprises (a) double-stranded or Y-shaped sequencing adapters, each strand of each double-stranded or Y-shaped sequencing adapter comprising an index sequence of the index sequence set or its reverse complement; or (b) single-stranded oligonucleotide pairs, each pair being provided together in a reagent, each oligonucleotide in a pair comprising an index sequence of the index sequence set or its reverse complement.

[0082] 4. A set of oligonucleotides as described in item 3, wherein (a) each Y-shaped or double-stranded sequencing adapter comprises a first strand and a second strand, the first strand comprising a first index sequence selected from a first subset of the index sequence set, and the second strand comprising a second index sequence selected from a second subset of the index sequence set (or the reverse complement of the second subset); or (b) each pair of oligonucleotides comprises a first oligonucleotide and a second oligonucleotide, the first oligonucleotide comprising a first index sequence selected from a first subset of the index sequence set, and the second oligonucleotide comprising a second index sequence selected from a second subset of the index sequence set (or the reverse complement of the second subset).

[0083] 5. The oligonucleotide set as described in item 4, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

[0084] 6. A set of oligonucleotides as described in item 4, wherein the first subset comprises the subset listed in Table 1, and the second subset comprises the subset listed in Table 2.

[0085] 7. The oligonucleotide set as described in item 4, wherein the first index sequence and the second index sequence are respectively: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 or its reverse complement; the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 or its reverse complement; the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 or its reverse complement; the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 or its reverse complement; the nth 10-mer in SEQ ID NO:18 and the nth 10-mer in SEQ ID NO:19 or its reverse complement.

[0086] 8. The set of oligonucleotides as described in item 4, wherein the first subset and the second subset are the same.

[0087] 9. The oligonucleotide set of item 8, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

[0088] 10. The set of oligonucleotides of item 8, wherein the subset is selected from one of the subsets of the index sequences in Table 3.

[0089] 11. The oligonucleotide set as described in any of the preceding items, wherein the index sequence set comprises the 10-mer in SEQ ID NO:9.

[0090] 12. A set of oligonucleotides as described in any of the preceding items, wherein each of the multiple subsets of oligonucleotides comprises an index sequence corresponding to a 10-mer in one of the following sequences: SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19.

[0091] 13. The set of oligonucleotides of any of the preceding items, wherein each of the plurality of subsets of oligonucleotides comprises an index sequence corresponding to the reverse complement of a 10-mer in one of the following sequences: SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 19.

[0092] 14. The oligonucleotide set as described in any of the preceding items, wherein the index sequence set comprises a plurality of non-overlapping subsets of index sequences, and the Hamming distance between any two index sequences in any subset is not less than a second standard value.

[0093] 15. The oligonucleotide set as described in item 14, wherein the second standard value is greater than the first standard value.

[0094] 16. The oligonucleotide set as described in item 15, wherein the first standard value is 4 and the second standard value is 5.

[0095] 17. The oligonucleotide set according to any one of the preceding items, wherein the oligonucleotides in the oligonucleotide set comprise a primer having an index sequence on its 3' end and an index sequence on its 5' end.

[0096] 18. The oligonucleotide set as described in any of the preceding items, wherein the set of index sequences is contained in Y-shaped sequencing adapters, each Y-shaped sequencing adapter containing an index sequence on only one strand.

[0097] 19. The set of oligonucleotides according to any one of the preceding items, wherein the set of oligonucleotides comprises polymerase chain reaction (PCR) primers or their reverse complements.

[0098] 20. The oligonucleotide set as described in any of the preceding items, wherein the first standard value is 3.

[0099] 21. The oligonucleotide set as described in any of the preceding items, wherein the first standard value is 4.

[0100] 22. The oligonucleotide set as described in any of the preceding items, wherein the edit distance between any two index sequences in the index sequence set is not less than a third standard value.

[0101] 23. A set of oligonucleotides as described in item 22, wherein the edit distance is a modified Levenshtein distance, wherein terminal gaps are not assigned a penalty.

[0102] 24. The oligonucleotide set as described in item 22, wherein the third standard value is 3.

[0103] 25. The oligonucleotide set as described in item 22, wherein the third standard value is 2.

[0104] 26. The oligonucleotide set according to item 22, wherein:

[0105] Each index sequence in the index sequence set has 8 bases;

[0106] The first standard value is 3; and

[0107] The third standard value is 2.

[0108] 27. The set of oligonucleotides of item 26, wherein the set of index sequences comprises the sequences listed under Example 2.

[0109] 28. The oligonucleotide set according to item 22, wherein:

[0110] Each index sequence in the index sequence set has 10 bases;

[0111] The first standard value is 4; and

[0112] The third standard value is 3.

[0113] 29. The oligonucleotide set as described in any of the preceding items, wherein the index sequence set does not include any subsequence of the sequence of an adapter or primer in a sequencing platform, or the reverse complement of the subsequence.

[0114] 30. The oligonucleotide set as described in any of the preceding items, wherein the sequences of the adapters or primers in the sequencing platform include SEQ ID NO: 1 (AGATGTGTATAAGAGACAG), SEQ ID NO: 3 (TCGTCGGCAGCGTC), SEQ ID NO: 5 (CCGAGCCCACGAGAC), SEQ ID NO: 7 (CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO: 8 (AATGATACGGCGACCACCGAGATCTACAC).

[0115] 31. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 32 bases or less.

[0116] 32. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 16 bases or less.

[0117] 33. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 10 bases or less.

[0118] 34. The oligonucleotide set according to any one of the preceding items, wherein each index sequence in the oligonucleotide set has 10 bases.

[0119] 35. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 8 bases or less.

[0120] 36. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 8 bases.

[0121] 37. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 7 bases or less.

[0122] 38. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 6 bases or less.

[0123] 39. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 5 bases or less.

[0124] 40. The oligonucleotide set as described in any of the preceding items, wherein each index sequence in the oligonucleotide set has 4 bases or less.

[0125] 41. The set of oligonucleotides of any of the preceding items, wherein the set of index sequences does not include index sequences empirically determined to have poor performance in indexing the origin of nucleic acid samples in multiplexed massively parallel sequencing.

[0126] 42. A set of oligonucleotides as described in item 41, wherein the index sequences that are not included comprise the sequences in Table 4.

[0127] 43. The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 12 different index sequences.

[0128] 44. The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 20 different index sequences.

[0129] 45. The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 24 different index sequences.

[0130] 46. ​​The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 28 different index sequences.

[0131] 47. The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 48 different index sequences.

[0132] 48. The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 96 different index sequences.

[0133] 49. The set of oligonucleotides according to any of the preceding items, wherein the set of index sequences comprises at least 384 different index sequences.

[0134] 50. The set of oligonucleotides as described in any of the preceding items, wherein the set of index sequences does not include any homopolymers having four or more consecutive identical bases.

[0135] 51. The set of oligonucleotides of any of the preceding items, wherein the set of index sequences does not include an index sequence that matches or is reverse complementary to one or more sequencing primer sequences.

[0136] 52. The set of oligonucleotides according to item 51, wherein the sequencing primer sequence is contained in the sequence of the oligonucleotides.

[0137] 53. The set of oligonucleotides of any of the preceding items, wherein the set of index sequences does not include an index sequence that matches or is reverse complementary to one or more flow cell amplification primer sequences.

[0138] 54. The set of oligonucleotides of item 53, wherein the flow cell amplification primer sequence is contained in the sequence of the oligonucleotides.

[0139] 55. The set of oligonucleotides as described in any of the preceding items, wherein the set of index sequences comprises index sequences having the same number of bases.

[0140] 56. The set of oligonucleotides as described in any of the preceding items, wherein each index sequence in the set of index sequences has a combined number of between 2 and 6 guanine bases and cytosine bases.

[0141] 57. The set of oligonucleotides according to any of the preceding items, wherein each index sequence in the set of index sequences has a guanine / cytosine (GC) content between 25% and 75%.

[0142] 58. The set of oligonucleotides according to any one of the preceding items, wherein the set of oligonucleotides comprises DNA oligonucleotides or RNA oligonucleotides.

[0143] 59. The oligonucleotide set according to any of the preceding items, wherein the oligonucleotide set is provided in a container comprising a plurality of separate compartments.

[0144] 60. The oligonucleotide set of item 59, wherein the container comprises a multi-well plate.

[0145] 61. The oligonucleotide set of item 59, wherein each compartment comprises a plurality of oligonucleotides, wherein the plurality of oligonucleotides comprises an index sequence in the index sequence set, the index sequence being different from the index sequences contained in other compartments.

[0146] 62. A set of oligonucleotides as described in Item 59, wherein each compartment comprises (a) a first plurality of oligonucleotides comprising a first index sequence in the index sequence set and (b) a second plurality of oligonucleotides comprising a second index sequence in the index sequence set, and the ordered combination of (a) and (b) in the compartment is different from the ordered combination of (a) and (b) in any other compartment.

[0147] 63. A set of oligonucleotides as described in item 62, wherein the first index sequence in each compartment is different from the first index sequence in any other compartment, and wherein the second index sequence in each compartment is different from the second index sequence in any other compartment.

[0148] 64. A set of oligonucleotides as described in item 62, wherein the first index sequence and the second index sequence in the compartment are respectively: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 (or its reverse complement); the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 (or its reverse complement); the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 (or its reverse complement); the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 (or its reverse complement); the nth 10-mer in SEQ ID NO:18 and the nth 10-mer in SEQ ID NO:19 (or its reverse complement).

[0149] 65. The set of oligonucleotides of item 62, wherein the first plurality of oligonucleotides comprises a P5 flow cell amplification primer binding site and the second plurality of oligonucleotides comprises a P7' flow cell amplification primer binding site.

[0150] 66. A set of oligonucleotides as described in item 62, wherein the first plurality of oligonucleotides comprises an i5 index sequence and the second plurality of oligonucleotides comprises an i7 index sequence.

[0151] 67. A set of oligonucleotides as described in item 62, wherein each index sequence contained in the first plurality of oligonucleotides is selected from a first subset of the index sequence set, and each index sequence contained in the second plurality of oligonucleotides is selected from a second subset of the index sequence set, and the first subset does not overlap with the second subset.

[0152] 68. The set of oligonucleotides as described in item 67, wherein the Hamming distance between any two index sequences in the first subset or the Hamming distance between any two index sequences in the second subset is not less than a second standard value.

[0153] 69. The set of oligonucleotides of item 67, wherein the second standard value is greater than the first standard value.

[0154] 70. A set of oligonucleotides as described in item 69, wherein the first standard value is 4 and the second standard value is 5.

[0155] 71. The set of oligonucleotides of item 70, wherein the first subset is a subset selected from Table 1 and the second subset is a subset selected from Table 2.

[0156] 72. The set of oligonucleotides of item 62, wherein the index sequences contained in the first plurality of oligonucleotides and the second plurality of oligonucleotides are selected from a subset of the set of index sequences.

[0157] 73. A set of oligonucleotides as described in item 72, wherein the Hamming distance between any two index sequences in the subset is not less than a second standard value.

[0158] 74. The set of oligonucleotides of item 73, wherein the second standard value is greater than the first standard value.

[0159] 75. A set of oligonucleotides as described in item 74, wherein the first standard value is 4 and the second standard value is 5.

[0160] 76. The set of oligonucleotides of item 75, wherein the subset is selected from the subset in Table 3.

[0161] 77. The oligonucleotide set of item 62, wherein the plurality of individual compartments are arranged in an array of one or more rows of compartments and one or more columns of compartments.

[0162] 78. A set of oligonucleotides as described in item 77, wherein the compartment of each 1 / n row and / or each 1 / m column contains an oligonucleotide containing at least one pair of color-balanced index sequences, wherein n and m are each selected from an integer in the range of 1 to 24.

[0163] 79. The oligonucleotide set of item 77, wherein the plurality of individual compartments are arranged in an array of 8 rows and 12 columns or in an array of 16 rows and 24 columns.

[0164] 80. The set of oligonucleotides of item 79, wherein the compartments of each 1 / 4 row contain oligonucleotides containing at least one pair of color-balanced index sequences, and wherein the compartments of each 1 / 4 column contain oligonucleotides containing at least one pair of color-balanced index sequences.

[0165] 81. A set of oligonucleotides as described in item 80, wherein the multiple individual compartments are arranged in an array form with AH rows and 1-12 columns, and wherein for the nth compartment on list A1, A2, A3, ..., A12, B1, B2, ..., B12, ..., H1, H2, ..., H12, the first index sequence and the second index sequence are respectively: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 (or its reverse complement); the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 (or its reverse complement); the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 (or its reverse complement); or the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 (or its reverse complement).

[0166] 82. The oligonucleotide set of item 62, wherein the plurality of separate compartments comprises Figure 4B The first plurality of oligonucleotides of the index sequence are arranged in the layout shown in the figure, and the plurality of separate compartments also contain oligonucleotides containing Figure 4C The second plurality of index sequence oligonucleotides are arranged in the layout format shown.

[0167] 83. A set of oligonucleotides, the set consisting essentially of a plurality of subsets of oligonucleotides, wherein:

[0168] The oligonucleotide set is configured to identify the source of nucleic acid samples in multiplex massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules;

[0169] Each of the plurality of subsets of oligonucleotides comprises a unique index sequence, the index sequences in the plurality of subsets consisting of a set of index sequences;

[0170] The Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2; and

[0171] The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) adenine bases or cytosine bases, and (ii) guanine bases, thymine bases or uracil bases.

[0172] 84. A method for preparing a plurality of oligonucleotides for multiplex massively parallel sequencing, the method comprising:

[0173] (a) selecting a set of index sequences from a collection of different index sequences, where

[0174] The index sequence set includes at least 6 different sequences;

[0175] The Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2; and

[0176] The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base; and

[0177] (b) synthesizing the plurality of oligonucleotides comprising the set of index sequences.

[0178] 85. A method as described in any of items 84-85, wherein the multiple oligonucleotides comprise double-stranded or Y-shaped sequencing adapters, and each strand of each sequencing adapter comprises an index sequence of the set of index sequences.

[0179] 86. A method as described in item 85, wherein each Y-shaped sequencing adapter comprises a first chain and a second chain, the first chain comprises an index sequence selected from a first subset of the index sequence set, the second chain comprises an index sequence selected from a second subset of the index sequence set, and the first subset does not overlap with the second subset.

[0180] 87. A method as described in item 86, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

[0181] 88. A method as described in item 86, wherein one or more of the first subsets contain index sequences listed in Table 1, and one or more of the second subsets contain index sequences listed in Table 2.

[0182] 89. A method as described in item 85, wherein each double-stranded or Y-shaped sequencing adapter comprises a first chain and a second chain, wherein the first chain comprises an index sequence of a subset selected from a plurality of subsets in the index sequence set, and the second chain comprises an index sequence selected from the subset.

[0183] 90. A method as described in item 89, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

[0184] 91. A method as described in item 89, wherein the index sequence set includes the index sequences in Table 3.

[0185] 92. A method as described in any of items 84-91, wherein an oligonucleotide in the plurality of oligonucleotides comprises an index sequence on its 3' end and an index sequence on its 5' end.

[0186] 93. A method as described in any of items 84-92, wherein the set of index sequences is contained in double-stranded or Y-shaped sequencing adapters, each sequencing adapter containing an index sequence in only one strand.

[0187] 94. A method as described in any of items 84-93, wherein the plurality of oligonucleotides comprises polymerase chain reaction (PCR) primers or their reverse complements.

[0188] 95. A method as described in any of items 84-94, wherein the set of index sequences does not include any subsequence of the sequence of an adapter or primer in a sequencing platform, or the reverse complement of the subsequence.

[0189] 96. A method as described in any of items 84-95, wherein the sequence of the adapter or primer in the sequencing platform includes SEQ ID NO:1 (AGATGTGTATAAGAGACAG), SEQ ID NO:3 (TCGTCGGCAGCGTC), SEQ ID NO:5 (CCGAGCCCACGAGAC), SEQ ID NO:7 (CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO:8 (AATGATACGGCGACCACCGAGATCTACAC).

[0190] 97. The method of any one of items 84-96, wherein step (a) comprises:

[0191] (i) selecting a candidate set of index sequences from the collection of index sequences;

[0192] (ii) separating the selected candidate set into a plurality of groups of color-balanced index sequence pairs; and

[0193] (iii) Using a bipartite graph matching algorithm, each group is divided into two subgroups of color-balanced pairs, where each color-balanced pair is a node in the bipartite graph.

[0194] 98. A method as described in item 97, wherein if the Hamming distance between the index sequences of two nodes is less than a second standard value, the two nodes are connected, wherein the second standard value is greater than the first standard value.

[0195] 99. A method as described in item 98, wherein the first standard value is 4 and the second standard value is 5.

[0196] 100. The method of claim 97, wherein step (i) comprises:

[0197] (1) adding to the candidate set color-balanced index sequence pairs randomly selected from the collection of index sequences, wherein the collection includes all possible n-mers;

[0198] (2) sorting the remaining index sequences in the collection of index sequences based on the minimum Hamming distance to the members in the candidate set;

[0199] (3) removing any remaining index sequences whose minimum Hamming distance to a member of the candidate set is less than a first criterion value or whose minimum edit distance to a member of the candidate set is less than a third criterion value; and

[0200] Repeat steps (1)-(3) to maximize the size of the candidate set.

[0201] 101. A method as described in item 100, wherein the first standard value is 4 and the third standard value is 3.

[0202] 102. The method of item 100, wherein the n-mer comprises an 8-mer, a 9-mer or a 10-mer.

[0203] 103. A method as described in item 100, wherein the first standard value is 3, the third standard value is 2, and the n-mer includes 8-mer.

[0204] 104. The method of claim 97, wherein step (ii) comprises:

[0205] (1) randomly selecting a seed for each of the plurality of groups; and

[0206] (2) Greedily expand each of the multiple groups.

[0207] 105. The method of item 97, further comprising, before step (i), removing a subset of index sequences from the collection of index sequences.

[0208] 106. A method as described in item 105, wherein the subset of index sequences removed includes index sequences having four or more consecutive identical bases.

[0209] 107. A method as described in item 105, wherein the subset of index sequences removed includes index sequences having a combined number of guanine bases and cytosine bases less than 2 or greater than 6.

[0210] 108. A method as described in item 105, wherein the subset of index sequences removed includes index sequences having a G / C content less than 25% or greater than 75%.

[0211] 109. A method as described in item 105, wherein the subset of removed index sequences includes index sequences having sequences that match or are reverse complementary to one or more sequencing primer sequences.

[0212] 110. A method as described in item 109, wherein the sequencing primer sequence is contained in the sequence of the index oligonucleotide.

[0213] 111. The method of item 105, wherein the subset of index sequences removed includes index sequences having sequences that match or are reverse complementary to one or more flow cell amplification primer sequences.

[0214] 112. A method as described in item 111, wherein the flow cell amplification primer sequence is contained in the sequence of the index oligonucleotide.

[0215] 113. A method as described in item 105, wherein the subset of removed index sequences includes index sequences that have been empirically determined to have poor performance in indexing the source of nucleic acid samples in multiplexed massively parallel sequencing.

[0216] 114. A method as described in item 113, wherein the subset of index sequences removed includes sequences in Table 4.

[0217] 115. A computer program product comprising a non-transitory machine-readable medium storing program code, which, when executed by one or more processors of a computer system, causes the computer system to implement a method for selecting a set of index sequences to be incorporated into a set of oligonucleotides configured for multiplex massively parallel sequencing, the program code comprising:

[0218] (a) a code for adding to a candidate set of index sequences pairs of color-balanced index sequences randomly selected from a pool of different index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base;

[0219] (b) code for sorting the remaining index sequences in the collection of index sequences based on minimum Hamming distance to members of the candidate set;

[0220] (c) code for removing any remaining index sequences whose minimum Hamming distance to a member of the candidate set is less than a first criterion value or whose minimum edit distance to a member of the candidate set is less than a second criterion value;

[0221] (d) code for repeating (a)-(c) to maximize the size of the candidate set; and

[0222] (e) code for selecting the set of index sequences from the candidate set to be incorporated into the set of oligonucleotides configured for multiplex massively parallel sequencing.

[0223] 116. The computer program product of item 115, wherein the program code further comprises:

[0224] code for separating the candidate set into a plurality of groups; and

[0225] Code for partitioning each group into two subgroups using a bipartite graph matching algorithm, where each index sequence is a node.

[0226] 117. A computer program product as described in any of items 115-116, wherein the program code also includes a code for controlling a nucleic acid synthesizer to synthesize the oligonucleotide set, wherein the oligonucleotide set is configured for multiple massively parallel sequencing.

[0227] Although the examples herein relate to humans, and the language is primarily directed to human issues, the concepts described herein are applicable to nucleic acids from any virus, plant, animal, or other organism, as well as populations thereof (metagenomics, viral populations, etc.). These and other features of the present disclosure will become more fully apparent from the following description with reference to the drawings and appended claims, or may be learned by the practice of the present disclosure as set forth hereinafter.

[0228] Incorporated by Reference

[0229] All patents, patent applications and other publications (including all sequences disclosed in these references) mentioned herein are expressly incorporated herein by reference to the extent that each individual publication, patent or patent application is specifically and individually indicated to be incorporated by reference. All cited documents are incorporated herein by reference in their entirety in the relevant parts thereof for the purposes indicated by the context in which they are cited herein. However, reference to any document should not be construed as admitting that it is prior art regarding the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0231] Figures 1A-1C Figure illustrates an example workflow for sequencing nucleic acid fragments using indexing oligonucleotides.

[0232] Figure 1D The diagram illustrates a process for sequencing target nucleic acids derived from multiple samples according to some embodiments.

[0233] Figure 1E and Figure 1F Shown is a process of performing transposome-mediated fragmentation and applying index primers to nucleic acids with double-stranded short universal adaptors attached to both ends.

[0234] Figure 1G Shown is the sequence of a target nucleic acid with double-stranded short universal adaptors attached to both ends according to some embodiments.

[0235] Figure 1H Shown are sequences contained in a Y-shaped universal adaptor according to some embodiments, and sequences of a target nucleic acid having a Y-shaped short universal adaptor attached to both ends according to some embodiments.

[0236] Fig. 1I Shown are sequences in the i7 index primer according to some embodiments.

[0237] Figure 1J Shown are sequences in the i5 index primer according to some embodiments.

[0238] Figure 1K A process for adding an index sequence to a nucleic acid having short Y-shaped universal adaptors on both ends is shown according to some embodiments.

[0239] Figures 2A-2D Various embodiments of index oligonucleotides are shown.

[0240] Figure 3 Schematic diagram illustrates an index sequence design that provides a mechanism for detecting errors occurring in the index sequence during the sequencing process.

[0241] Figures 4A-4C Schematic diagrams illustrate exemplary layouts of multiwell plates and indexing oligonucleotides in which indexing oligonucleotides may be provided.

[0242] Figure 5 A process for preparing indexing oligonucleotides such as indexed adaptors is shown.

[0243] Figure 6One embodiment of a dispersed system for generating a call or diagnosis from a test sample is shown.

[0244] Figure 7 The diagram illustrates a computer system that can be used as a computing device according to some embodiments.

[0245] Detailed Description

[0246] Numerical ranges include numerical values ​​that limit the range. It is expected that each maximum numerical limit given throughout this specification includes each lower numerical limit, as such lower numerical limits are clearly written out in this article. Each minimum numerical limit given throughout this specification will include each higher numerical limit, as such higher numerical limits are clearly written out in this article. Each numerical range given throughout this specification will include each narrower numerical range that falls within such a wider numerical range, as such a narrower numerical range is clearly written out in this article.

[0247] The headings provided herein are not intended to limit the disclosure.

[0248] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art. Various scientific dictionaries including the terms contained herein are well known and available to those skilled in the art. Although any methods and materials similar or equivalent to those described herein can be used to practice or test the embodiments disclosed herein, some methods and materials are described.

[0249] The terms defined immediately below are more fully described by reference to the specification as a whole.It is to be understood that this disclosure is not limited to the particular methodology, protocols, and reagents described, as these may vary depending upon the context in which they are used by one skilled in the art.

[0250] definition

[0251] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0252] As used herein, the term "include" encompasses the meanings of "comprises," "consist of," or "consist essentially of," where the context is appropriate and unless otherwise indicated.

[0253] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation and amino acid sequences are written left to right in amino to carboxy orientation, respectively.

[0254] Edit distance is a metric that quantifies how different two strings (e.g., words) are from each other by counting the minimum number of operations required to transform one string into the other. In bioinformatics, it can be used to quantify the similarity of DNA sequences, which can be viewed as strings of the letters A, C, G, and T.

[0255] Different forms of edit distance use different sets of string operations. Levenshtein distance is a common type of edit distance. The string operation of Levenshtein distance explains the number of deletions, insertions and substitutions of characters in a string. In some embodiments, other variants of edit distance can be used. For example, other variants of edit distance can be obtained by restricting the set of operations. The longest common subsequence (LCS) distance is an edit distance with insertion and deletion as the only two editing operations (both at unit cost). The Jaro-Winkler distance can be obtained from the edit distance that only allows transposition. Similarly, by only allowing substitutions, the Hamming distance is obtained, which is restricted to equal length strings. The Hamming distance between two strings of equal length is the number of positions where the corresponding symbols are different. In other words, it measures the minimum number of substitutions required to transform a string into another string, or the minimum number of errors required to transform a string into another string.

[0256] In some embodiments, different string operations may have different weights for edit distance. For example, a substitution operation may have a weight of 3, while an insertion / deletion (indel) may have a weight of 2. In some embodiments, different kinds of matches may have different weights. For example, an AA match may have twice the weight of a GG match.

[0257] As used herein, the term "universal sequence" refers to a sequence region common to two or more nucleic acid molecules (e.g., adapter-target-adapter molecules), wherein the molecules also have sequence regions that are different from each other. Universal sequences present in different members of a molecular set can allow the use of a population of universal capture nucleic acids complementary to a portion of the universal sequence (e.g., a universal extension primer binding site) to capture multiple different nucleic acids. Non-limiting examples of universal extension primer binding sites include sequences identical or complementary to P5 primers and P7 primers. Similarly, universal sequences present in different members of a molecular set can allow the use of a population of universal primers complementary to a portion of the universal sequence (e.g., a universal primer binding site) to replicate or amplify multiple different nucleic acids. Therefore, universal capture nucleic acids or universal primers include sequences that can specifically hybridize with universal sequences. Target nucleic acid molecules can be modified to, for example, attach adapters at one or both ends of different target sequences, as described herein.

[0258] When referring to amplification primers, such as universal primer extension primers, the terms "P5" and "P7" can be used. The terms "P5'" (P5 prime) and "P7'" (P7 prime) refer to the complements of P5 and P7, respectively. It will be understood that any suitable amplification primer can be used in the methods presented herein, and the use of P5 and P7 is only an exemplary embodiment. The use of amplification primers such as P5 and P7 on flow cells is known in the art, as illustrated by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957. For example, any suitable forward amplification primer, whether immobilized or in solution, can be useful for hybridization with complementary sequences and amplification of sequences in the methods presented herein. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be useful in the methods presented herein for hybridization with complementary sequences and amplification of sequences. Those skilled in the art will understand how to design and use primer sequences suitable for capturing and amplifying nucleic acids as presented herein.

[0259] The terms "upstream" and "5'-of" with respect to a position in a nucleic acid sequence are used interchangeably to refer to the relative position in the nucleic acid sequence further toward the 5' end of the sequence.

[0260] The terms "downstream" and "3'-of" with respect to a position in a nucleic acid sequence are used interchangeably to refer to the relative position in the nucleic acid sequence further toward the 3' end of the sequence.

[0261] One step in some embodiments of the methods of the present disclosure is to fragment and tag the target DNA using an in vitro transposition reaction to generate tagged DNA fragments. The in vitro transposition reaction requires a transposase, a transposon end composition, and appropriate reaction conditions.

[0262] "Transposase" means an enzyme that is capable of forming a functional complex with a composition containing a transposon end (e.g., a transposon, a transposon end, a transposon end composition) and catalyzing the insertion or transposition of the composition containing a transposon end into a double-stranded target DNA incubated therewith in an in vitro transposition reaction. Transposases also include integrases from retrotransposons and retroviruses.

[0263] A "transposition reaction" is a reaction in which one or more transposon ends are inserted into a target DNA at a random site or a nearly random site. In some embodiments, the transposition reaction causes the target DNA or RNA to be fragmented at random positions. The important components in the transposition reaction are a transposase and a DNA oligonucleotide exhibiting the nucleotide sequence of the transposon end (including the transferred transposon end sequence and its complement, the non-transferred transposon end sequence) and other components required to form a functional transposition complex. The method of the present invention is exemplified by using a transposition complex formed by a hyperactive Tn5 transposase and a Tn5-type transposon end (Goryshin, I. and Reznikoff, WS, J. Biol. Chem., 273: 7367, 1998) or a transposition complex formed by a MuA transposase and a Mu transposon end comprising an R1 terminal sequence and an R2 terminal sequence (Mizuuchi, K., Cell, 35: 785, 1983; Savilahti, H, et al., EMBO J., 14: 4893, 1995). However, any transposition system capable of inserting transposon ends in a random or nearly random manner and having sufficient efficiency to allow 5′ tagging and fragmentation of target DNA for its intended purpose can be used in the present invention.Examples of transposition systems known in the art that can be used include, but are not limited to, Staphylococcus aureus Tn552 (Colegio OR et al., J Bacteriol., 183:2384-8, 2001; Kirby C et al., Mol Microbiol., 43:173-86, 2002), Ty1 (Devine SE and Boeke JD., Nucleic Acids Res., 22:3765-72, 1994 and International Patent Application No. WO 95 / 23875), transposon Tn7 (Craig, NL, Science, 271:1512, 1996; Craig, NL, Review in: Curr Top Microbiol Immunol., 204:27-48, 1996), Tn10 and IS10 (Kleckner N, et al., Curr Top Microbiol Immunol., 205:27-48, 1996), and Tn20 (Kleckner N et al., Curr Top Microbiol Immunol., 206:27-48, 1996). Immunol., 204:49-82, 1996), Mariner transposase (Lampe DJ, et al., EMBO J., 15:5470-9, 1996), Tc1 (Plasterk RH, Curr Top Microbiol Immunol, 204:125-43, 1996), P element (Gloor, GB, Methods Mol Biol., 260:97-114, 2004), Tn3 (Ichikawa H, and Ohtsubo E., J Biol Chem. 265:18829-32, 1990), bacterial insertion sequence (Ohtsubo, F and Sekine, Y, Curr. Top. Microbiol. Immunol. 204:1-26, 1996), retrovirus (Brown PO, et al., Proc Natl Acad Sci USA, 86:2525-9, 1989) and yeast retrotransposons (Boeke JD and Corces VG, Annual Rev Microbiol. 43:403-34, 1989).

[0264] The method for inserting the transposon end into the target sequence can be performed in vitro using any suitable transposon system, for which a suitable in vitro transposition system is available or can be developed based on knowledge in the art. Generally, a suitable in vitro transposition system for use in the method of the present invention requires: a transposase of sufficient purity, sufficient concentration and sufficient in vitro transposition activity; and a transposon end with which the transposase forms a functional complex, the functional complex having a respective transposase capable of catalyzing a transposition reaction. Suitable transposon end sequences that can be used in the present invention include, but are not limited to, a wild-type transposon end sequence, a derived transposon end sequence or a mutated transposon end sequence that forms a complex with a transposase selected from a wild-type transposase, a derived form of a transposase or a mutated form of a transposase. Exemplary transposases include wild-type or mutant forms of Tn5 transposase and MuA transposase (although EZ-Tn5 transposase is significantly more efficient in generating 5′-tagged DNA fragments in the methods of the invention than an equivalent protein amount of MuA transposase), but any other transposase for which compositions and conditions for efficient in vitro transposition of defined transposon ends are known or subsequently developed may be used in the methods of the invention. Transposon end sequences recognized by wild-type or mutant forms of Tn5 transposase or MuA transposase are suitable in some embodiments, and those transposon end sequences that result in the highest transposition efficiency when complexed with the transposase, along with the corresponding optimally active transposase complexed therewith, are advantageous for some embodiments. In some embodiments, a transposon is selected in which the transposon end sequence required by the transposase for transposition is not very large and the transposon end sequence is of the smallest possible size, which works well for the intended purpose, and is of sufficient size so that the same sequence is only rarely present or not present at all in the target DNA or sample DNA. For example, the Tn5-derived EZ-Tn5 TM The transposon end sequence of the transposon end sequence comprises only 19 nucleotides, whereas some other transposases require much larger end sequences for transposition (eg, MuA transposase requires a transposon end sequence of approximately 51 nucleotides).

[0265] Suitable in vitro transposition systems that can be used to insert the transposon ends into the target nucleic acid include, but are not limited to, the use of the EZ-Tn5 TM Hyperactive Tn5 transposase, or HyperMu from EPICENTRE TM In vitro transposition systems such as those with the superactive MuA transposase, or another MuA transposase such as available from Finnzymes Oy, Espoo, Finland.

[0266] In some embodiments, the insertion of the transposon end into the target DNA according to the present invention can also be performed in vivo. If transposition is performed in vivo, transposition into the target DNA is preferably achieved by electroporating a synaptic complex of a transposase and a suitable transposon end composition into a host cell, as described in U.S. Patent No. 6,159,736 (incorporated herein by introduction). The transposition method is exemplified by using the following transposition complex: a transposition complex formed by a hyperactive Tn5 transposase and a suitable Tn5-type transposon end composition using a method similar to that described by (Goryshin, I. and Reznikoff, WS, J. Biol. Chem., 273: 7367, 1998), or by a HyperMu TM A transposition complex formed by a hyperactive MuA transposase (EPICENTRE, Madison, Wis.) and a suitable MuA transposon end composition exhibiting an R1 end sequence and an R2 end sequence recognized by the transposase. A suitable association complex or "Transposome" between a transposon end composition and a transposase TM The "EPICENTRE" complex can be prepared as described in U.S. Pat. No. 6,159,736 and related patents by Goryshin and Reznikoff, or as described for Tn5 type EZ-Tn5 from EPICENTRE Technologies, Madison, Wis. TM Transposome TM Complex or HyperMu TM MuA Transposome TM The complexes were prepared as described in the product literature.

[0267] The term "transposon end" means a double-stranded DNA that exhibits only a nucleotide sequence ("transposon end sequence") that is necessary for forming a complex with a transposase or integrase that is functional in an in vitro transposition reaction. The transposon end forms a "complex" or "association complex" or "transposome complex" or "transposome composition" with a transposase or integrase that recognizes and binds to the transposon end, and the complex is capable of inserting or transposing the transposon end into a target DNA incubated with the complex in an in vitro transposition reaction. The transposon end exhibits two complementary sequences consisting of a "transferred transposon end sequence" or "transferred strand" and a "non-transferred transposon end sequence" or "non-transferred strand". For example, with a hyperactive Tn5 transposase (e.g., EZ-Tn5) that is active in an in vitro transposition reaction, TMTransposase, EPICENTRE Biotechnologies, Madison, Wis., USA) forms a complex with one transposon end including a transferred strand exhibiting the following "transferred transposon end sequence":

[0268]

[0269] and a non-transferred strand exhibiting a "non-transferred transposon end sequence" as follows:

[0270]

[0271] The name “pMETS” refers to a 19-base single-stranded transposon end oligonucleotide containing a 5′-phosphate that exhibits EZ-Tn5 TM Transposon end sequences:

[0272]

[0273] The name "METS" refers to a 19-base single-stranded transposon end oligonucleotide that exhibits EZ-Tn5 TM Transposon end sequences:

[0274]

[0275] The name “pMENTS” refers to a 19-base single-stranded transposon end oligonucleotide containing a 5′-phosphate that exhibits EZ-Tn5 TM Transposon end sequences:

[0276]

[0277] The name "pMEDS" refers to the 19 base pair double-stranded EZ-Tn5 TM Transposon ends, where both 5′ ends contain phosphates:

[0278]

[0279] pMEDS EZ-Tn5 TM Transposon ends were prepared by annealing the pMETS transposon end oligonucleotide to the pMENTS transposon end oligonucleotide.

[0280] The name "MEDS" refers to the 19 base pair double-stranded EZ-Tn5 TM Transposon ends where only the non-transferred strand (pMENTS) contains a 5′-phosphate:

[0281]

[0282] MEDS EZ-Tn5TM Transposon ends were prepared by annealing the METS transposon end oligonucleotide to the pMENTS transposon end oligonucleotide.

[0283] The 3' end of the transferred strand is ligated or transferred to the target DNA in an in vitro transposition reaction. The non-transferred strand, which exhibits a transposon end sequence complementary to the transferred transposon end sequence, is not ligated or transferred to the target DNA in an in vitro transposition reaction.

[0284] In some embodiments, the transfer strand and the non-transfer strand are covalently connected. For example, in some embodiments, the transfer strand sequence and the non-transfer strand sequence are provided on a single oligonucleotide, for example in the form of a hairpin configuration. Like this, although the free end of the non-transfer strand is not directly connected to the target DNA by the transposition reaction, the non-transfer strand becomes indirectly attached to the DNA fragmentation because the non-transfer strand is connected to the transfer strand by the loop of the hairpin structure.

[0285] "Transposon end composition" means a composition comprising a transposon end (i.e., a minimal double-stranded DNA segment capable of acting with a transposase to undergo a transposition reaction), optionally plus one or more additional sequences 5' to the transferred transposon end sequence and / or 3' to the non-transferred transposon end sequence. For example, a transposon end attached to a tag is a "transposon end composition". In some embodiments, a transposon end composition comprises or consists of two transposon end oligonucleotides consisting of a "transferred transposon end oligonucleotide" or "transferred strand" and a "non-transferred strand end oligonucleotide" or "non-transferred strand", wherein the "transferred transposon end oligonucleotide" or "transferred strand" and the "non-transferred strand end oligonucleotide" or "non-transferred strand" in combination exhibit the sequence of a transposon end, and wherein one or both strands contain an additional sequence.

[0286] The terms "transferred transposon end oligonucleotide" and "transferred strand" are used interchangeably and refer to the transferred portion of both a "transposon end" and a "transposon end composition", i.e., regardless of whether the transposon end is attached to a tag or other moiety. Similarly, the terms "non-transferred transposon end oligonucleotide" and "non-transferred strand" are used interchangeably and refer to the non-transferred portion of both a "transposon end" and a "transposon end composition". In some embodiments, the transposon end composition is a "hairpin transposon end composition".

[0287] As used herein, "hairpin transposon end composition" means a transposon end composition composed of a single oligodeoxyribonucleotide, which exhibits a non-transferred transposon end sequence at its 5' end, a transferred transposon end sequence at its 3' end, and an intervening arbitrary sequence between the non-transferred transposon end sequence and the transferred transposon end sequence, the intervening arbitrary sequence being long enough to allow intramolecular stem loop formation so that the transposon end portion can function in the transposition reaction. In some embodiments, the 5' end of the hairpin transposon end composition has a phosphate group in the 5' position of the 5' nucleotide. In some embodiments, the intervening arbitrary sequence between the non-transferred transposon end sequence and the transferred transposon end sequence of the hairpin transposon end composition provides a tag (e.g., including one or more tag domains) for a specific purpose or application.

[0288] In some embodiments, the methods of the present disclosure generate tagged circular ssDNA fragments. In some embodiments, the tagged circular ssDNA fragments exhibit only the sequence of the transferred strand of the transposon end composition, while the tagged circular ssDNA fragments do not exhibit the sequence of the non-transferred strand of the transposon end composition.

[0289] In some embodiments, the transposon end oligonucleotide used in the method of the present invention only exhibits the transposon end sequence required in the transposition reaction. However, in some embodiments, at least one of the transposon end oligonucleotides additionally exhibits one or more other nucleotide sequences at the 5' of the transposon end sequence. Therefore, in some embodiments, the method uses a transfer chain with a 3' portion and a 5' portion, wherein the 3' portion exhibits the transferred transposon end sequence, and the 5' portion exhibits one or more additional sequences that do not participate in forming a functional complex with the transposase. There is no restriction on which additional sequences can be used for one or more additional sequences in the 5' portion of the transfer chain, and these sequences can be used to achieve any desired purpose. For example, in some embodiments, the 5' portion of the transfer chain exhibits one or more additional tag sequences. In some embodiments, the tag sequence can be an index sequence associated with a specific sample. In some embodiments, the tag sequence allows capture by annealing to a specific sequence on the surface. In some embodiments, the tag sequence allows the 5' tagged target fragments to be captured on a flow cell substrate for next generation sequencing; for example, a P5 tag or a P7' tag for being captured on a flow cell of an Illumina sequencing platform, or a 454A tag or a 454B tag sequence for being captured on a bead for sequencing using a Roche 454 next generation sequencer.

[0290] In some embodiments, the tag sequence can be one or more sequences for identification, detection (e.g., fluorescence detection) or sorting of the product of the method. In some other embodiments, the 5' portion of the transfer chain exhibits one or more additional nucleotides or sequences or chemical groups or parts, which contain affinity binding molecules or consist of affinity binding molecules, which, for example, allow for the tag sequence to be captured by annealing to a specific sequence on a surface such as a bead or a probe on a microchip or array. In some preferred embodiments, the size of one or more additional sequences in the 5' portion of the transfer chain is minimized so as to minimize the probability or frequency of the transfer chain being inserted into itself during an in vitro transposase reaction. For example, in some embodiments, the size of the 5' portion of the transfer chain is less than about 150 nucleotides, less than about 100 nucleotides, less than about 75 nucleotides, less than about 50 nucleotides, less than about 25 nucleotides, or less than about 15 nucleotides.

[0291] In some embodiments, the 5' end of the transferred strand has a 5' monophosphate group. In some embodiments, both the transferred strand and the non-transferred strand have a 5' monophosphate group. In some preferred embodiments, only the 5' end of the non-transferred strand has a 5' monophosphate group. In some other embodiments, there is no 5' monophosphate group on the 5' end of the transferred strand.

[0292] In some embodiments, the transposon end composition used in the methods of the present disclosure comprises a transposon end oligonucleotide that exhibits only the transposon end sequence that forms a complex with a transposase or integrase and is required for the transposition reaction; in these embodiments, the tag in the tagged circular ssDNA fragments generated using the method exhibits only the transferred transposon end sequence. However, in some embodiments, the transposon end composition comprises or consists of at least one transposon end oligonucleotide that exhibits one or more other nucleotide sequences in addition to the transposon end sequence. Thus, in some embodiments, the transposon end composition comprises a transferred strand that exhibits one or more other nucleotide sequences 5′ of the transferred transposon end sequence, which are also exhibited by the tag. Thus, in addition to the transferred transposon end sequence, the tag may have one or more other tag portions or tag domains.

[0293] As used herein, a "tag" is a nucleic acid sequence that is or can be associated with one or more nucleic acid molecules.

[0294] As used herein, "tag portion" or "tag domain" means a portion or domain of a tag that exhibits a sequence for a desired desired purpose or application. One tag portion or tag domain is a "transposon end domain," which exhibits the transferred transposon end sequence. In some embodiments, where the transferred strand also exhibits one or more other nucleotide sequences 5' to the transferred transposon end sequence, the tag also has one or more other "tag domains" in the 5' portion, each of which is provided for any desired purpose. For example, some embodiments of the present disclosure include or consist of a transposon end composition comprising or consisting of: (i) a transferred strand exhibiting one or more sequences 5′ of the transferred transposon end sequence, the one or more sequences comprising or consisting of a tag domain selected from one or more of a sample-specific index sequence, a primer binding sequence, a restriction site tag domain, a capture tag domain, a sequencing tag domain, an amplification tag domain, a detection tag domain, and a transcription promoter domain; and (ii) a non-transferred strand exhibiting a non-transferred transposon end sequence. The present disclosure includes embodiments of methods of using any one or more of the transposon end compositions.

[0295] In some embodiments, the transposon end composition comprises a transferred strand comprising a primer binding sequence that is reverse complementary to a sequence in a PCR primer. In some embodiments, the PCR primer is an index primer comprising a sample-specific index sequence. In some embodiments, after the transferred strand is transposed and attached to a target polynucleotide, the sample-specific index primer hybridizes to the primer binding sequence in the transferred strand attached to the target polynucleotide.

[0296] As used herein, a "restriction site tag domain" or "restriction site domain" means a tag domain that exhibits a sequence for the purpose of facilitating cleavage using a restriction endonuclease. For example, in some embodiments, a restriction site domain is used to generate di-tagged linear ssDNA fragments. In some embodiments, a restriction site domain is used to generate a compatible double-stranded 5' end in the tag domain so that the end can be connected to another DNA molecule using a template-dependent DNA ligase. In some preferred embodiments, the restriction site domain in the tag exhibits the sequence of a restriction site that only rarely exists (if it does occur) in the target DNA (e.g., a restriction site for a rare cutting restriction endonuclease such as NotI or AscI). In some preferred embodiments, the restriction site in the restriction site domain is for a type II restriction endonuclease, such as a FokI restriction endonuclease.

[0297] In some embodiments in which the transferred strand of the transposon end composition comprises one or more restriction site domains 5′ of the transferred transposon end sequence, the method further comprises: annealing oligodeoxyribonucleotides complementary to the single-stranded restriction sites of the tagged circular ssDNA fragments, and then cleaving the tagged circular ssDNA fragments at the restriction sites using a restriction endonuclease that recognizes the restriction sites. Thus, in some embodiments, the method comprises linearizing the tagged circular ssDNA fragments to generate di-tagged linear ssDNA fragments.

[0298] In some other embodiments in which the transferred strand of the transposon end composition comprises one or more restriction site domains 5′ of the transferred transposon end sequence, the transferred strand of the transposon end composition comprises a double-stranded hairpin comprising a restriction site, and the method further comprises the step of cleaving the tagged linear ssDNA fragments at the restriction site using a restriction endonuclease that recognizes the restriction site; however, in some embodiments, this method is not preferred because the double-stranded hairpin provides a site for dsDNA into which the transposon end composition can be transposed by a transposase or an integrase.

[0299] In some preferred embodiments, the method comprises (i) generating a double-stranded restriction site by annealing an oligodeoxyribonucleotide complementary to the single-stranded restriction site or by using a transferred strand comprising a double-stranded hairpin, and (ii) then cleaving the restriction site using a restriction endonuclease that recognizes the double-stranded restriction site, the method further comprising the step of ligating the restriction endonuclease-cleaved tagged linear ssDNA fragments to another DNA molecule having a compatible 3′ end.

[0300] As used herein, a "capture tag domain" or "capture tag" means a tag domain that exhibits a sequence for the purpose of facilitating capture of ssDNA fragments to which the tag domain is attached (e.g., providing an annealing site or affinity tag for capturing tagged circular ssDNA fragments or di-tagged linear ssDNA fragments on a bead or other surface, e.g., where the annealing site of the tag domain sequence allows capture by annealing to a specific sequence on a surface, such as a probe on a bead, or on a microchip or microarray, or on a sequencing bead). In some embodiments, the "capture tag" comprises a flow cell amplification primer binding sequence. In some embodiments, the flow cell amplification primer binding sequence comprises a P5 sequence or a P7' sequence. In some embodiments of the method, after the tagged circular ssDNA fragments or the di-tagged linear ssDNA fragments are captured by annealing to complementary probes on the surface, the capture tag domain provides a site for priming DNA synthesis using the tagged circular ssDNA fragments or the di-tagged linear ssDNA fragments (or the complement of the tagged circular ssDNA fragments or the di-tagged linear ssDNA fragments) as a template. In some other embodiments, the capture tag domain comprises a 5′ portion of the transferred strand that is linked to a chemical group or moiety that comprises or consists of an affinity binding molecule (e.g., wherein the 5′ portion of the transferred strand is linked to a first affinity binding molecule, such as biotin, streptavidin, an antigen, or an antibody that binds the antigen, which allows the circular tagged ssDNA fragments or the di-tagged linear ssDNA fragments to be captured on the surface to which a second affinity binding molecule is attached that forms a specific binding pair with the first affinity binding molecule).

[0301] As used herein, "sequencing tag domain", "sequencing tag" or "sequencing primer binding sequence" means a sequence used to facilitate sequencing of the ssDNA fragment to which the tag is attached (e.g., providing a priming site for synthetic sequencing, or providing an annealing site for ligation sequencing, or providing an annealing site for hybridization sequencing). For example, in some embodiments, the sequencing tag domain or sequencing primer binding sequence provides a site for priming DNA synthesis of the ssDNA fragment or the complement of the ssDNA fragment. In some embodiments, the sequencing tag domain or sequencing primer binding sequence comprises an SBS3 sequence, an SBS8' sequence, an SBS12' sequence, or an SBS491' sequence.

[0302] As used herein, "amplification tag domain" means a tag domain that exhibits a sequence for the purpose of promoting amplification of the nucleic acid to which the tag is attached. For example, in some embodiments, the amplification tag domain provides a priming site for a nucleic acid amplification reaction (e.g., a PCR amplification reaction or a strand displacement amplification reaction or a rolling circle amplification reaction) using a DNA polymerase, or a ligation template for ligating probes using a template-dependent ligase in a nucleic acid amplification reaction (e.g., a ligation chain reaction).

[0303] As used herein, "detection tag domain" or "detection tag" means a tag domain that exhibits a sequence or a detectable chemical or biochemical moiety for the purpose of facilitating detection of tagged circular ssDNA fragments or di-tagged linear ssDNA fragments (e.g., wherein the sequence or chemical moiety comprises or is linked to a detectable molecule; such as a detectable molecule selected from the group consisting of a visible dye, a fluorescent dye, a chemiluminescent dye, or other detectable dye; an enzyme detectable in the presence of a substrate, such as alkaline phosphatase in the presence of NBT plus BCIP, or peroxidase in the presence of a suitable substrate; a detectable protein, such as green fluorescent protein; and an affinity binding molecule that is bound to a detectable moiety or can form an affinity binding pair or specific binding pair with another detectable affinity binding molecule; or any of the many other detectable molecules or systems known in the art).

[0304] As used herein, “transcription promoter domain” or “promoter domain” means a tag domain exhibiting a sequence of a sense promoter sequence or an antisense promoter sequence of an RNA polymerase promoter.

[0305] As used herein, "DNA fragment" means a portion, piece, or segment of a target DNA that is cleaved from a longer DNA molecule or released or broken from a longer DNA molecule so that it is no longer attached to a parent molecule. DNA fragments can be double-stranded ("dsDNA fragments") or single-stranded ("ssDNA fragments"), and the process of generating DNA fragments from a target DNA is referred to as "fragmenting" the target DNA. In some preferred embodiments, the method is used to generate a "DNA fragment library" comprising a collection or population of tagged DNA fragments.

[0306] As used herein, “target DNA” refers to any DNA of interest that is subjected to processing, e.g., for use in generating a library of tagged DNA fragments (e.g., 5′- and 3′-tagged or di-tagged linear ssDNA or dsDNA fragments or tagged circular ssDNA fragments).

[0307] "Target DNA" can be derived from any in vivo or in vitro source (including from one or more cells, tissues, organs, or organisms, whether alive or dead), or from any biological or environmental source (e.g., water, air, soil). For example, in some embodiments, the target DNA comprises or consists of eukaryotic and / or prokaryotic dsDNA, which originates from or is derived from humans, animals, plants, fungi (e.g., mold or yeast), bacteria, viruses, viroids, mycoplasmas, or other microorganisms. In some embodiments, the target DNA comprises or consists of genomic DNA, subgenomic DNA, chromosomal DNA (e.g., from an isolated chromosome or portion of a chromosome, such as one or more genes or loci from a chromosome), mitochondrial DNA, chloroplast DNA, plasmid or other episomal source of DNA (or recombinant DNA contained therein), or double-stranded cDNA prepared by reverse transcribing RNA using an RNA-dependent DNA polymerase or reverse transcriptase to generate a first-strand cDNA, and then extending a primer annealed to the first-strand cDNA to generate dsDNA. In some embodiments, the target DNA comprises a plurality of dsDNA molecules in or prepared from a nucleic acid molecule (e.g., a plurality of dsDNA molecules in or prepared from genomic DNA or cDNA prepared from RNA in or from a biological (e.g., cell, tissue, organ, organism) or environmental (e.g., water, air, soil, saliva, sputum, urine, feces) source). In some embodiments, the target DNA is from an in vitro source. For example, in some embodiments, the target DNA comprises or consists of dsDNA that is prepared in vitro from single-stranded DNA (ssDNA) or from single-stranded or double-stranded RNA (e.g., using methods well known in the art, such as primer extension using a suitable DNA-dependent and / or RNA-dependent DNA polymerase (reverse transcriptase)).In some embodiments, the target DNA comprises or consists of dsDNA prepared from all or part of one or more double-stranded or single-stranded DNA or RNA molecules using any method known in the art, including methods for: DNA or RNA amplification (e.g., PCR or reverse transcriptase-PCR (RT-PCR), transcription-mediated amplification methods, and amplification of all or part of one or more nucleic acid molecules); molecular cloning of all or part of one or more nucleic acid molecules in a plasmid, fosmid, BAC or other vector, followed by replication in a suitable host cell; or capturing one or more nucleic acid molecules by hybridization, such as by hybridization to DNA probes on an array or microarray (e.g., by "sequence capture"; for example, using kits and / or arrays from ROCHE NIMBLEGEN, AGILENT or FEBIT).

[0308] In some embodiments, “target DNA” means dsDNA or ssDNA that is prepared or modified (e.g., prepared or modified using various biochemical or molecular biology techniques) prior to being used to generate a library of tagged DNA fragments (e.g., 5′- and 3′-tagged or di-tagged linear ssDNA or dsDNA fragments or tagged circular ssDNA fragments).

[0309] As used herein, "amplify," "amplifying," or "amplification reaction," and their derivatives, generally refer to any action or process by which at least a portion of a nucleic acid molecule is replicated or copied to at least one additional nucleic acid molecule. The additional nucleic acid molecule optionally comprises a sequence that is substantially identical or substantially complementary to at least some portion of the template nucleic acid molecule. The template nucleic acid molecule may be single-stranded or double-stranded, and the additional nucleic acid molecule may independently be single-stranded or double-stranded. Amplification optionally comprises linear or exponential replication of the nucleic acid molecule. In some embodiments, such amplification may be performed using isothermal conditions; in other embodiments, such amplification may comprise thermal cycling. In some embodiments, amplification is a multiplex amplification comprising simultaneously amplifying multiple target sequences in a single amplification reaction. In some embodiments, "amplification" comprises amplifying at least some portions of DNA- and RNA-based nucleic acids, either individually or in combination. The amplification reaction may comprise any amplification process known to those of ordinary skill in the art. In some embodiments, the amplification reaction comprises a polymerase chain reaction (PCR).

[0310] As used herein, the term "polymerase chain reaction" ("PCR") refers to the method of Mullis U.S. Patent Nos. 4,683,195 and 4,683,202, which describes a method for increasing the concentration of a section of a polynucleotide of interest in a mixture of genomic DNA without cloning or purification. The process for increasing the polynucleotide of interest consists of the following steps: a large amount of excessive two oligonucleotide primers are introduced into a DNA mixture containing the desired polynucleotide of interest, followed by a series of thermal cycles in the presence of a DNA polymerase. The two primers are complementary to the chains of their corresponding double-stranded polynucleotides of interest. First the mixture is denatured at a higher temperature, and then the primers are annealed to the complementary sequence in the polynucleotide molecule of interest. After annealing, the primers are extended to form a new pair of complementary chains with a polymerase. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (referred to as thermal cycles), to obtain the amplified section of the desired polynucleotide of interest at high concentrations. The length of the amplification section (amplicon) of the polynucleotide of interest of expectation is determined by the relative position of primers relative to each other, and therefore, this length is a controllable parameter. By means of repeating this process, the method is called "polymerase chain reaction" (hereinafter referred to as "PCR"). Because the amplification section of the polynucleotide of interest of expectation becomes the main nucleic acid sequence (in terms of concentration) in the mixture, they are called "PCR amplification". In the modification of the method discussed above, the target nucleic acid molecule can use a plurality of different primers to (in some cases, each target nucleic acid molecule of interest uses one or more primers to) carry out pcr amplification, thereby form a multiple PCR reaction.

[0311] As defined herein, "multiplex amplification" refers to the selective and non-random amplification of two or more target sequences in a sample using at least one target-specific primer. In some embodiments, multiple amplification is performed so that some or all of the target sequences are amplified in a single reaction vessel. The "plexy" or "plex" of a given multiple amplification generally refers to the number of different target-specific sequences amplified during this single multiple amplification. In some embodiments, the plex can be about 12-plex, 24-plex, 48-plex, 96-plex, 192-plex, 384-plex, 768-plex, 1536-plex, 3072-plex, 6144-plex or higher. It is also possible to detect the amplified target sequence by several different methodologies (e.g., gel electrophoresis, followed by density determination, quantitatively measured with a bioanalyzer or quantitative PCR, hybridized with labeled probes; incorporation of biotinylated primers, followed by detection of avidin-enzyme conjugates; incorporation of 32P-labeled deoxynucleotide triphosphates into the amplified target sequence).

[0312] As used herein, the term "primer" and its derivatives generally refer to any polynucleotide that can hybridize with a target sequence of interest. Typically, a primer acts as a substrate on which nucleotides can be polymerized by a polymerase; however, in some embodiments, a primer can become incorporated into a synthetic nucleic acid chain and provide a site with which another primer can hybridize to initiate synthesis of a new chain complementary to the synthetic nucleic acid molecule. A primer can include any combination of nucleotides or their analogs. In some embodiments, a primer is a single-stranded oligonucleotide or polynucleotide.

[0313] In a number of embodiments, the primer has a free 3'-OH group that can be extended by a nucleic acid polymerase. For template-dependent polymerases, typically at least the 3' portion of the primer oligonucleotide is complementary to a portion of the template nucleic acid, and the oligonucleotide is "bound" (or "complexed", "annealed" or "hybridized") to a portion of the template nucleic acid by hydrogen bonding with the template and other molecular forces to give a primer / template complex for initiating synthesis by a DNA polymerase, and the primer oligonucleotide is extended (i.e., "primer extension") by adding a covalently bound base complementary to the template connected at its 3' end during DNA synthesis. The result is a primer extension product. Template-dependent DNA polymerases (including reverse transcriptases) typically require complexation of an oligonucleotide primer with a single-stranded template to initiate DNA synthesis ("priming"), but RNA polymerases typically do not require a primer complementary to a DNA template for RNA synthesis (transcription).

[0314] A "template" is a nucleic acid molecule that is copied by a nucleic acid polymerase, such as a DNA polymerase. Whether the nucleic acid molecule comprises two strands (i.e., is "double-stranded") or only one strand (i.e., is "single-stranded"), the strand of the nucleic acid molecule that specifies the sequence of nucleotides exhibited by the synthesized nucleic acid is the "template" or "template strand". The nucleic acid synthesized by a nucleic acid polymerase is complementary to the template. Both RNA and DNA are always synthesized in a 5'-to-3' direction starting from the 3' end of the template strand, and the two strands of the nucleic acid duplex are always matched so that the 5' ends of the two strands are located at opposite ends of the duplex (and, inevitably, the 3' ends are then also true). For both RNA templates and DNA templates, primers are required to initiate synthesis by DNA polymerase, but primers are not required to initiate synthesis by DNA-dependent RNA polymerase, which is usually simply referred to as "RNA polymerase".

[0315] The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein, referring to the polymeric form of nucleotides of any length, and may include ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. In some cases, the term "polynucleotide" may refer to a nucleotide polymer with a relatively large amount of nucleotide monomers, and the term "oligonucleotide" may refer to a nucleotide polymer with a relatively small amount of nucleotide monomers. However, unless otherwise specified, this distinction is not applicable herein. Instead, the terms "polynucleotide" and "oligonucleotide" should be understood as analogs including DNA or RNA made from nucleotide analogs as equivalents, and are applicable to single-stranded (such as sense or antisense) polynucleotides and double-stranded polynucleotides. The term as used herein also encompasses cDNA, i.e., complementary or copy DNA produced from an RNA template, for example, by the action of a reverse transcriptase. The term refers only to the primary structure of a molecule. Therefore, the term includes triple-stranded, double-stranded and single-stranded deoxyribonucleic acid ("DNA"), and triple-stranded, double-stranded and single-stranded ribonucleic acid ("RNA").

[0316] In addition, the terms "polynucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably and refer to a covalently linked sequence of nucleotides (i.e., ribonucleotides for RNA and deoxyribonucleotides for DNA) in which the 3' position of the pentose of one nucleotide is linked to the 5' position of the pentose of the next nucleotide via a phosphodiester group. Nucleotides include sequences of nucleic acids of any form, including but not limited to RNA molecules and DNA molecules, such as cell-free DNA (cfDNA) molecules. The term "polynucleotide" includes but is not limited to single-stranded polynucleotides and double-stranded polynucleotides.

[0317] As used herein, the terms "ligating," "ligation," and their derivatives generally refer to a process for covalently linking two or more molecules together, such as covalently linking two or more nucleic acid molecules to each other. In some embodiments, the linking comprises a gap between adjacent nucleotides of the linking nucleic acids. In some embodiments, the linking comprises forming a covalent bond between the end of a first nucleic acid molecule and the end of a second nucleic acid molecule. In some embodiments, the linking may comprise forming a covalent bond between a 5' phosphate group of one nucleic acid and a 3' hydroxyl group of a second nucleic acid, thereby forming a linked nucleic acid molecule. Generally for the purposes of the present disclosure, an amplified target sequence may be linked to an adaptor to generate an adaptor-linked amplified target sequence.

[0318] As used herein, "ligase" and its derivatives generally refer to any agent capable of catalyzing the connection of two substrate molecules. In some embodiments, ligases include enzymes capable of catalyzing the connection of gaps between adjacent nucleotides of a nucleic acid. In some embodiments, ligases include enzymes capable of catalyzing the formation of a covalent bond between the 5' phosphate of a nucleic acid molecule and the 3' hydroxyl of another nucleic acid molecule, thereby forming an enzyme of a connected nucleic acid molecule. Suitable ligases may include, but are not limited to, T4 DNA ligase, T4 RNA ligase, and E. coli DNA ligase.

[0319] As used herein, the term "adapter" generally refers to any linear oligonucleotide that can be connected to a nucleic acid molecule to generate a nucleic acid product that can be sequenced on a sequencing platform such as various Illumina sequencing platforms. In some embodiments, the adaptor includes two reverse complementary oligonucleotides that form a double-stranded structure. In some embodiments, the adaptor includes two oligonucleotides that are complementary at one part and mismatched at another part, forming a Y-shaped adaptor or forked adaptor that is double-stranded at the complementary part and has two soft overhangs at the mismatched part. Since Y-shaped adaptors have complementary double-stranded regions, they can be considered as a special form of double-stranded adaptors. When the present disclosure contrasts Y-shaped adaptors and double-stranded adaptors, the term "double-stranded adaptor" is used to refer to an adaptor with two chains that are completely complementary, substantially (e.g., greater than 90% or 95%) complementary or partially complementary.

[0320] In some embodiments, the adapter comprises a sequence that binds to a sequencing primer (e.g., SEQ ID NO: 3 and SEQ ID NO: 5). In some embodiments, the adapter comprises a sequence that binds to a flow cell oligonucleotide (e.g., SEQ ID NO: 7 and SEQ ID NO: 8 or a P7 sequence and a P5 sequence).

[0321] In some embodiments, the adapter is not substantially complementary to the 3' end or 5' end of any target sequence present in the sample. Typically, the adapter can include any combination of nucleotides and / or nucleic acids. In some aspects, the adapter can include one or more cleavable groups at one or more positions. In another aspect, the adapter can include a sequence that is substantially identical or substantially complementary to at least a portion of a primer (e.g., a universal primer). In some embodiments, the adapter can include an index sequence (also referred to as a barcode or tag) to help downstream error correction, identification, or sequencing.

[0322] The terms "adapter" and "linker" are used interchangeably herein.

[0323] As used herein, the term "flow cell" or "flow cell" refers to a chamber comprising a solid surface through which one or more fluid reagents can flow. Examples of flow cells and related fluid systems and detection platforms that can be readily used in the methods of the present disclosure are described in, for example, Bentley et al., Nature 456:53-59 (2008); WO 04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and US 2008 / 0108082, each of which is incorporated herein by reference.

[0324] As used herein, the term "amplicon" when referring to nucleic acid use, means the product of copy nucleic acid, wherein the product has a nucleotide sequence identical or complementary to at least a portion of the nucleotide sequence of nucleic acid.Amplicon can be produced by using nucleic acid or its amplicon as any one of the multiple amplification methods of template, and the multiple amplification methods include, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), connection extension or connection chain reaction.Amplicon can be a nucleic acid molecule with a single copy (for example PCR product) of a specific nucleotide sequence or multiple copies (for example concatemer (concatameric) product of RCA) of a nucleotide sequence. The first amplicon of target nucleic acid is typically a complementary copy. Subsequent amplicon is a copy produced from target nucleic acid or from the first amplicon after generating the first amplicon. Subsequent amplicon can have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.

[0325] The term "paired end read" refers to a read obtained from paired end sequencing, which obtains a read from each end of a nucleic acid fragment. Paired end sequencing involves DNA fragmentation into a sequence called an insert. In some schemes such as those used by Illumina, reads from shorter inserts (e.g., about tens to hundreds of bp) are referred to as short insert paired end reads or simply paired end reads. In contrast, reads from longer inserts (e.g., about several thousand bp) are referred to as matched pairs (matepair) reads. In the present disclosure, both short insert paired end reads and long insert matched pairs reads can be used, and there is no difference in the process for determining the sequence of a DNA fragment. Therefore, the term "paired end read" can refer to both short insert paired end reads and long insert matched pairs reads, which will be further described below. In some embodiments, paired end reads include reads of about 20bp to 1000bp. In some embodiments, the paired-end reads include reads of about 50 bp to 500 bp, about 80 bp to 150 bp, or about 100 bp.

[0326] As used herein, the terms "alignment" and "alignment" refer to comparing a read with a reference sequence, and thereby determining whether a reference sequence comprises a read sequence. As used herein, the alignment process attempts to determine whether a read can be mapped to a reference sequence, but does not always result in a read that matches a reference sequence. If a reference sequence comprises a read, the read can be mapped to the reference sequence, or in some embodiments, is mapped to a specific position in the reference sequence. In some cases, the alignment simply determines whether the read is a member of a specific reference sequence (that is, whether the read exists or does not exist in the reference sequence). For example, the alignment of a read with the reference sequence of human chromosome 13 will determine whether the read exists in the reference sequence of chromosome 13.

[0327] Of course, the comparison tool has many other aspects and many other applications in bioinformatics, which are not described in this application. For example, the comparison can also be used to determine the similarity of two DNA sequences from two different species, thereby providing a measure of their close relatedness on the evolutionary tree.

[0328] In some cases, the comparison additionally indicates that the read is mapped to the position in the reference sequence. For example, if the reference sequence is the entire human genome sequence, the comparison can indicate that the read is present on chromosome 13, and can also indicate that the read is in a specific chain and / or site of chromosome 13. In some cases, the comparison tool is imperfect because a) all effective comparisons are not found, and b) some comparisons obtained are invalid. This occurs due to various reasons, for example, the read can include errors, and the read of sequencing can be different from the reference genome due to haplotype differences. In some applications, the comparison tool includes a built-in mismatch tolerance, which tolerates a certain degree of mismatch of base pairs, and still allows the comparison of the read with the reference sequence. This can contribute to the effective comparison of the read that would otherwise be missed.

[0329] As used herein, the term "mapping" refers to the assignment of a read sequence to a larger sequence, such as a reference genome, by alignment.

[0330] The term "test sample" refers to a sample generally derived from a biological fluid, cell, tissue, organ or organism in this article, and the sample comprises a nucleic acid or a mixture of nucleic acids having at least one nucleic acid sequence to be analyzed. Such samples include, but are not limited to, sputum / oral fluid, amniotic fluid, blood, blood fractions or fine needle biopsy samples, urine, peritoneal fluid, pleural fluid, etc. Although the sample is usually obtained from a human subject (e.g., a patient), the assay can be used for samples from any mammal (including, but not limited to, dogs, cats, horses, goats, sheep, cattle, pigs, etc.) and mixed populations (such as from wild microbial populations or from patient's viral populations). The sample can be used directly as obtained from a biological source or after a pretreatment that modifies the characteristics of the sample. For example, such pretreatment can include preparing plasma from blood, diluting viscous fluids, etc. The method of pretreatment can also include, but is not limited to, filtering, precipitation, dilution, distillation, mixing, centrifugation, freezing, freeze-drying, concentration, amplification, nucleic acid fragmentation, inactivating interfering components, the addition of reagents, cracking, etc. If such a pretreatment method is employed with respect to a sample, such a pretreatment method typically causes the nucleic acid of interest to remain in the test sample, sometimes at a concentration proportional to the concentration in an untreated test sample (e.g., that is, a sample that has not been subjected to any such pretreatment method). With respect to the methods described herein, such a "treated" or "processed" sample is still considered a biological "test" sample.

[0331] The term "next generation sequencing (NGS)" herein refers to sequencing methods that allow for massively parallel sequencing of clonally amplified molecules and single nucleic acid molecules. Non-limiting examples of NGS include sequencing by synthesis using reversible dye terminators and sequencing by ligation.

[0332] The term "read" refers to a sequence read from a part of a nucleic acid sample. Typically, although not required, a read represents a short sequence of continuous base pairs in a sample. The read can be represented symbolically by the base pair sequence of A, T, C and G of the sample portion, together with a probability estimate (quality score) of base correctness. It can be stored in a memory device, and is processed as appropriate to determine whether it matches a reference sequence or meets other standards. The read can be obtained directly from a sequencing device, or indirectly from the sequence information stored about a sample. In some cases, the read is a DNA sequence long enough (e.g., at least about 20bp), which can be used to identify a larger sequence or region, for example, can be compared and mapped to a chromosome or genomic region or gene.

[0333] The terms "site" and "alignment position" are used interchangeably and refer to a unique position on a reference genome (i.e., chromosome ID, chromosome position and orientation). In some embodiments, a site can be the position of a residue on a reference sequence, the position of a sequence tag, or the position of a segment.

[0334] As used herein, the term "reference genome" or "reference sequence" refers to any specific known gene sequence (whether partial or complete) of any organism or virus that can be used as a reference for an identified sequence from a subject. For example, reference genomes for human subjects and many other organisms can be found at the National Center for Biotechnology Information at ncbi.nlm.nih.gov. "Genome" refers to the complete genetic information of an organism or virus represented by a nucleic acid sequence. However, it should be understood that "complete" is a relative concept, because even the gold standard reference genome is expected to contain spaces and errors.

[0335] In various embodiments, the reference sequence is significantly larger than the reads to which it is aligned. For example, it can be at least about 100 times larger, or at least about 1000 times larger, or at least about 10,000 times larger, or at least about 10,000 times larger. 5 times, or at least about 10 6 times, or at least about 10 7 times.

[0336] In one example, the reference sequence is the sequence of the full-length human genome. Such a sequence can be referred to as a genome reference sequence. In another example, the reference sequence is limited to a specific human chromosome, such as chromosome 13. In some embodiments, the reference Y chromosome is the Y chromosome sequence from human genome version hg19. Such a sequence can be referred to as a chromosome reference sequence. Other examples of reference sequences include genomes of other species, and chromosomes of any species, subchromosome regions (such as chains) etc.

[0337] When used in the context of nucleic acids or nucleic acid mixtures, the term "derived from" herein refers to the means by which nucleic acids are obtained from the source from which they originate. For example, in one embodiment, a mixture of nucleic acids derived from two different genomes means that nucleic acids, such as cfDNA, are naturally released by cells via naturally occurring processes such as necrosis or apoptosis. In another embodiment, a mixture of nucleic acids derived from two different genomes means that nucleic acids are extracted from two different types of cells from a subject.

[0338] The term "biological fluid" herein refers to a liquid obtained from a biological source, and includes, for example, blood, serum, plasma, sputum, lavage fluid, cerebrospinal fluid, urine, semen, sweat, tears, saliva, etc. As used herein, the terms "blood", "plasma" and "serum" explicitly encompass fractions or processed portions thereof. Similarly, in the case where the sample is obtained from a biopsy, swab, smear, etc., the "sample" explicitly encompasses processed fractions or portions derived from a biopsy, swab, smear, etc.

[0339] As used herein, the term "chromosome" refers to the genetic carrier of a living cell that carries hereditary characteristics, which is derived from a chromatin chain containing DNA and protein components (particularly histones). The conventional internationally recognized individual human genome chromosome numbering system is used herein.

[0340] Introduction and Background

[0341] Next generation sequencing (NGS) technology has developed rapidly, providing new tools for advancing research and science as well as healthcare and services that rely on genetic and related biological information. The NGS method is performed in a massively parallel manner, providing increasingly higher speeds for determining biomolecular sequence information. Index sequences have been used in the art to label or identify the source of samples for multiple NGS sequencing. However, many NGS methods and related sample manipulation techniques introduce errors, so that the resulting sequence has a relatively high error rate, ranging from one error in hundreds of base pairs to one error in thousands of base pairs. When such an error occurs in the read of the sample index sequence, the read cannot be correctly associated with the source of the sample, and can cause an erroneous association between the read and the source of the sample.

[0342] One source of sequencing errors is related to index hopping. Index hopping or index jumping is observed when the sequenced DNA library molecules contain index sequences that are different from the index sequences present in the library adapters during library preparation. Index hopping can occur during sample preparation or during cluster amplification of pooled multiplex libraries. One mechanism causing index hopping involves the presence of free, unattached adapter molecules present after library preparation.

[0343] Without intending to be limited by theory, the problem of index jumping has multiple modes, some of which involve the presence of residual unconnected adapter molecules left over from library preparation. One type of index jumping can be caused by free unconnected adapter molecules with specific universal primer extension sequences (e.g., P7') present in the library pool, which can contribute to the formation of a library with exchanged indices. This problem can be prevented by using a 5' exonuclease for degradation that specifically targets the P7' adapter chain. Such measures solve index jumping using biochemical methods. Some embodiments use bioinformatics methods as further described below to correct index jumping.

[0344] Some sequencing platforms use one color (e.g., green laser) to sequence two base types (e.g., G / T) and another color (e.g., red laser) to sequence two other base types (e.g., A / C). On some of these platforms, at least 1 of the 2 nucleotides for each color channel needs to be read in each cycle to ensure proper image registration. It is important to maintain color balance for each base of the index read being sequenced; otherwise, index read sequencing may fail due to registration failure. This can be particularly a problem during low-repetition sequencing, where a relatively small number of index sequences makes it more likely that all nucleotides in a read cycle will activate one color.

[0345] In various applications, it may be desirable to layout the index plate so that the user can select groups of 3 across rows (i.e., one quarter of a row) or groups of 4 down columns (i.e., one half of a column) or other rearrangements such as 6-plex, 8-plex, and 9-plex without sacrificing the color balance of the oligonucleotides in the flow cell.

[0346] Various implementations provide at least some of the following advantages.

[0347] Some embodiments using short universal adapters and index primers can be easily scaled up to high sample numbers without requiring new adapter design. Only new index primers with new index sequences are needed.

[0348] Some embodiments using short universal adapters and index primers are cost effective, involving 1 complex section instead of 40 complex sections for 384 samples in a 16x24 multiwell plate with combined index pairs.

[0349] Because oligonucleotide purification is expensive, processing of shorter length (e.g., 33 bp compared to 70 bp) adapters is cheaper and provides higher yields. In addition, high performance liquid chromatography (HPLC) purification columns for different oligonucleotides can be shared across projects.

[0350] In some embodiments, universal adapters can be made using a simpler manufacturing process. In embodiments involving Y-shaped adapters and blunt-ended adapters, two oligonucleotides need to be annealed to make one universal adapter. In embodiments involving double-stranded blunt-ended A&B version adapters, four oligonucleotides need to be annealed to make two universal adapters.

[0351] Some embodiments provide for a simpler quality control (QC) process. Various existing processes and tools are fully functional for adaptors, including gravimetric analysis (weighing of oligonucleotides), OD, mass spectrometry, and purity assays for index primers.

[0352] Assay performance may be improved due to smaller adaptor size, resulting in increased ligation efficiency and more efficient cleanup to remove dimers (eg, using SPRI beads).

[0353] Workflow for sequencing nucleic acid fragments using index sequences

[0354] Figures 1A-1CThe figure shows exemplary workflows 100 and 120 for sequencing nucleic acid fragments using index sequences. Workflows 100 and 120 are merely illustrations of some embodiments. It should be understood that some embodiments employ workflows with additional operations not illustrated here, while other embodiments may skip some operations illustrated here. For example, workflow 120 is used for whole genome sequencing. In some embodiments involving targeted sequencing, the operational steps of hybridization and enrichment of certain regions may be applied between operation 122 and operation 128. In addition, the workflow shows the application of index sequences by connection of sample-specific indexed adapters. Transposome-mediated adapters may be applied. In addition, universal adapters without sample-specific sequences may be applied alternatively or additionally.

[0355] Operation 102 applies oligonucleotides to both ends of nucleic acid fragments (or target fragments) of multiple samples, the oligonucleotides comprising index sequences for identifying the sources of the multiple samples. In some embodiments, the index sequences are selected from an index sequence set comprising at least 6 different index sequences, and each of the multiple subsets of oligonucleotides comprises multiple index sequences of the index sequence set. In some embodiments, the Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2. The index sequence set comprises multiple pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences comprise both of the following: (i) adenine (A) bases or cytosine (C) bases, and (ii) guanine (G) bases, thymine (T) bases, or uracil (U) bases.

[0356] In some embodiments, operation 102 attaches to each end of a double-stranded target fragment isolated from a source to produce an adapter-target-adapter molecule. Attachment can be performed by standard library preparation techniques using ligation, or by tagmentation using a transposase complex (Gunderson et al., WO 2016 / 130704). In some embodiments, attachment can be performed by Figure 1B The connection process 120 shown in FIG. 1 is performed.

[0357] Process 120 involves fragmenting the nucleic acid of multiple samples. In some embodiments, the fragment is a double-stranded DNA of size, for example, less than 1000bp. For example, DNA fragments can be obtained by, for example, genomic DNA fragmentation, collecting natural fragmented DNA (e.g., cfDNA or ctDNA) or synthesizing DNA fragments from RNA. In some embodiments, in order to synthesize DNA fragments from RNA, messenger RNA or non-coding RNA is first purified using poly A (poly A) selection or ribosomal RNA exhaustion, and then random hexamer is used to trigger the selected mRNA to be chemically fragmented and converted into single-stranded cDNA. The complementary chain of cDNA is generated to produce double-stranded cDNA, which is ready for library construction. In order to obtain double-stranded DNA fragments from genomic DNA (gDNA), input gDNA is fragmented, for example, by hydrodynamic shearing, nebulization, enzymatic fragmentation, etc., to generate fragments of appropriate length, for example, about 1000bp, 800bp, 500bp or 200bp. For example, nebulization can break down DNA into fragments smaller than 800 bp in a short period of time. This process generates double-stranded DNA fragments.

[0358] In some embodiments, fragmented or damaged DNA can be processed without the need for additional fragmentation. For example, formalin-fixed, paraffin-embedded (FFPE) DNA or certain cfDNA are sometimes sufficiently fragmented that no additional fragmentation step is needed.

[0359] Figure 1C Shown in Figure 1B The DNA fragments / molecules and adapters used in the initial steps of the workflow 120. Figure 1C Only one double-stranded fragment is illustrated, but thousands to millions of fragments of a sample can be prepared simultaneously in the workflow. DNA fragmentation by physical methods produces heterogeneous ends, including a mixture of 3' overhangs, 5' overhangs, and blunt ends. The overhangs will have varying lengths, and the ends may or may not be phosphorylated. An example of a double-stranded DNA fragment obtained from fragmenting the genomic DNA of operation 122 is shown in Figure 1C Shown as fragment 133.

[0360] Fragment 133 has both a 3' overhang on the left end and a 5' overhang shown on the right end. If the DNA fragments are produced by physical methods, the workflow 120 continues with an end repair operation 124, which produces a flat-ended fragment with a 5'-phosphorylated end. In some embodiments, this step uses T4 DNA polymerase and Klenow enzyme to convert the overhangs produced from fragmentation into flat ends. The 3' to 5' exonuclease activity of these enzymes removes the 3' overhang, and the 5' to 3' polymerase activity fills the 5' overhang. In addition, T4 polynucleotide kinase phosphorylates the 5' ends of the DNA fragments in this reaction. Figure 1C Fragment 135 in is an example of an end-repaired blunt-ended product.

[0361] After end repair, workflow 120 continues with operation 126 to adenylate the 3' ends of the fragments, which is also referred to as A-tailing or dA-tailing because a single dATP is added to the 3' ends of the blunt-ended fragments to prevent them from ligating to each other during the adapter ligation reaction. Figure 1C The double-stranded molecule 137 shows an A-tailed fragment with a blunt end, and the double-stranded molecule 137 has a 3′-dA overhang and a 5′-phosphate end. Figure 1C As seen in entry 139 of , the single "T" nucleotide on the 3' end of each of the two sequencing adaptors provides an overhang complementary to the 3'-dA overhang on each end of the insert for ligating the two adaptors to the insert.

[0362] After adenylating the 3' ends, the workflow 120 proceeds to operation 128 to ligate oligonucleotides (eg, adaptors) to both ends of the fragments of the plurality of samples. The oligonucleotides include an index sequence for identifying the source of the plurality of samples.

[0363] Figure 1CEntry 139 of illustrates two adapters to be connected to double-stranded fragments, the adapter comprising two index sequences i5 and i7. Index sequences provide means for identifying the source of multiple samples, thereby allowing multiple samples to be multiplexed on a sequencing platform. Other index sequences can be applied. P5 oligonucleotides and P7' oligonucleotides are complementary to the amplification primers on the surface of the flow pool bound to the Illumina sequencing platform, and are also referred to as amplification primer binding sites. They allow adapter-target-adapter libraries to undergo bridge amplification. Other designs of adapters and sequencing platforms can be used for various embodiments. Adapters and sequencing techniques are further described in the following sections. Adapters also comprise two sequence primer binding sequences SP1 (e.g., SBS3 primers of Illumina, for reading i5 index sequences) and SP2 (e.g., SBS12'). Other sequencing primer binding sequences can be included in adapters for different reactions and platforms.

[0364] Back to Figure 1A , process 100 continues to pool nucleic acid fragments from multiple samples for sequencing reactions. See module 104. Index oligonucleotides containing index sequences are attached to the fragments, and the index sequences are applied in a manner specific to the source of the sample. Various techniques for pooling samples are further described below.

[0365] In some embodiments, the product of the ligation reaction is purified and / or size-selected by agarose gel electrophoresis or magnetic beads. The size-selected DNA is then PCR amplified to enrich for fragments with adapters at both ends. See module 106. As mentioned above, in some embodiments, operations of hybridizing and enriching certain regions of DNA fragments can be applied to target regions for sequencing.

[0366] The workflow 100 then proceeds to cluster amplify the PCR products, for example, on an Illumina platform. See operation 108. By clustering the PCR products, the libraries can be pooled for multiplexing, for example, with 96 or more samples per lane, using different index sequences on the adapters to track different samples. 1536 multiplexing techniques are contemplated.

[0367] After cluster amplification, sequencing reads can be obtained by synthetic sequencing on the Illumina platform. See operation 110. The obtained reads contain reads of the target sequence and the index sequence. Although the adapter and sequencing process described here are based on the Illumina platform, other sequencing technologies, especially NGS methods, can also be used instead of the Illumina platform or in addition to the Illumina platform. Finally, the workflow 100 determines the sample source of the target sequence based on the index sequence associated with the sample. See operation 112.

[0368] Figure 1D The figure shows a process 150 for sequencing target nucleic acids derived from multiple samples. Process 150 involves applying index sequences to target nucleic acids of multiple samples by contacting multiple index polynucleotides with target nucleic acids derived from the samples to generate multiple index-target polynucleotides. In some embodiments, the multiple index polynucleotides include DNA or RNA. Each sample is associated with a unique index sequence or a unique combination of index sequences. See module 152. In some embodiments, the multiple index polynucleotides include sample-specific adapters that include index sequences uniquely associated with each sample. Figure 1C , Figure 2A and Figure 2B The figure illustrates an embodiment using sample-specific adaptors.In other embodiments, the plurality of index polynucleotides comprises index primers that can hybridize to universal adaptors attached to target nucleic acids. Figure 1C , Figure 1K , Figure 2C and Figure 2D The figure illustrates some embodiments using index primers and universal adaptors.

[0369] In some embodiments, applying index primers to target nucleic acids in multiple samples can be accomplished by Figure 1F The process 160 shown in FIG. Figure 1K The second half of process 199 shown in the figure is completed. Figure 1E and Figure 1F Shown is the process of performing transposome-mediated fragmentation and applying index primers to nucleic acids having double-stranded short universal adaptors attached to both ends.

[0370] Process 160 involves providing multiple double-stranded nucleic acid molecules derived from multiple samples. Double-stranded nucleic acid 166 (e.g., DNA) is a schematic diagram of one of the double-stranded nucleic acid molecules. Process 160 also involves providing multiple transposome complexes. Each transposome complex contains a transposase and two transposon end compositions. Elements 161-165 form a transposome complex. Three transposome complexes 169a-169c are illustrated here. Transposome complex 169a contains a transposase 161 and two transposon end compositions. Transposon end sequence duplex 162 and 5' tag 163 form a transposon end composition. Transposon end sequence duplex 164 and 5' tag 165 form another transposon end composition. Transposon end sequence duplex 162 and 164 contain two sequence chains collectively referred to as MEDS. One chain of the MEDS duplex contains the sequence of SEQ ID NO:1, which will be transferred from the transposome complex to the target DNA and is referred to as the transfer chain. The other strand of MEDS comprises the transposon end sequence of SEQ ID NO:2, which is not transferred to the target nucleic acid and is referred to as the non-transferred strand. At the 5' end of the transferred strand, the transposon end composition comprises a 5' tag 165. In some embodiments, the 5' tag is a sequence primer binding sequence SP1, which provides a sequence binding site on the target nucleic acid after being transposed to the target nucleic acid. The transposon end duplex MEDS162 and the 5' tag 163 form another transposon end composition. The 5' end of the transferred strand of the transposon end composition is a 5' tag sequence 163, which provides a sequence primer binding sequence SP2.

[0371] Similarly, transposome complexes 169b and 169c contain the same components as transposome complex 169a. For example, transposome complex 169b contains two transposon end compositions, one of which contains transposon end duplex 162b and 5' tag 163b (SP2).

[0372] Process 160 involves incubating DNA fragments and transposome complexes under conditions that allow for transposition reactions with appropriate concentrations of transposon complexes and DNA molecules. The transposase in the transposome complex digests double-stranded nucleic acid 166 at random sites indicated by black triangles 167a-167f. Digestion separates double-stranded nucleic acid molecules 166 into multiple fragments including fragments 168a-168d.

[0373] The transposase also transposes the transfer strand of the MEDS duplex to the 5' end of the nucleic acid fragment in the digestion site (167a-167f). After fragmentation and transposition, the 5' end of the top strand of fragment 168b has the transfer strand of the MED duplex (164) transposed and attached to the 5' end. There is a 5' tag (165) corresponding to the sequencing primer binding sequence SP1 at the 5' end of the transfer strand. At each 3' end of the double-stranded target fragment 168b, there is a vacancy between the non-transferred strand and the target fragment of the MEDS transposon end sequence. After fragmentation and transposition, four fragments (170a-170d) are formed. Two of the four fragments, 170b and 170c, have MEDS duplexes on both ends, and the MEDS duplexes have 5' tags. Two of the fragments (170a and 170d) have a transposon end composition only on one end, which is not processed in the downstream sequencing reaction. In some embodiments, after the target DNA fragments are formed and tagged, a DNA polymerase with strand displacement or 5'-to-3' exonuclease activity is added to extend the 3' end of the target nucleic acid.

[0374] Figure 1F Shown are additional downstream processes of DNA fragments produced by transposome-mediated fragmentation to obtain target nucleic acid fragments with double-stranded universal adapters on both ends. The figure also shows the addition of index sequences (i5 index sequence and i7 index sequence) and flow cell amplification primer binding sequences (P5 sequence and P7 sequence). After adding a polymerase with strand displacement or 5'-to-3' exonuclease activity, the 3' end of the target nucleic acid is extended and the non-transferred strand of the MEDS duplex is removed (see arrows 173a and 173b, which indicate the extension of the 3' end of the target nucleic acid fragment). The extension fills the gap between the 3' end of the target nucleic acid and the non-transferred strand of the MEDS duplex. The extension also generates nucleotides complementary to the 5' tag. As a result, a double-stranded target nucleic acid fragment flanked by a MEDS sequence and a sequencing primer binding sequence is formed, which has two complementary chains 174 and 175a. The double-stranded nucleic acid comprises two double-stranded short universal adapters, each of which comprises a sequencing primer sequence and a MEDS sequence. In some embodiments, the double-stranded nucleic acid has Figure 1G The nucleotides indicated.

[0375] Figure 1GThe sequence of the target nucleic acid with double-stranded short universal adapters attached to both ends is shown. The sequencing primer binding sequence SP1 has the sequence TCGTCGGCAGCGTC (SEQ ID NO: 3) at the top strand and the reverse complement (GACGCTGCCGACGA (SEQ ID NO: 4) at the bottom strand. The MEDS duplex has the sequences of SEQ ID NO: 1 and SEQ ID NO: 2. The sequencing primer binding sequence (SP2) has the sequence CCGAGCCCACGAGAC (SEQ ID NO: 5) at the top strand and the reverse complement GTCTCGTGGGCTCGG (SEQ ID NO: 6) at the bottom strand.

[0376] Fig. 1I Sequences in the i7 index primer are shown. In some embodiments, the i7 index primer (e.g., 178a) has the P7 flow cell amplification primer binding sequence CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 7), the i7 index sequence, and the SP2 sequencing primer binding sequence GTCTCGTGGGCTCGG (SEQ ID NO: 6) from 5′ to 3′.

[0377] Figure 1J Sequences in the i5 index primer are shown. In some embodiments, the i5 index primer (e.g., 176a) has the P5 flow cell amplification primer binding sequence AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 8), the i5 index sequence, and the SP1 sequencing primer binding sequence TCGTCGGCAGCGTC (SEQ ID NO: 3) from 5′ to 3′.

[0378] In other embodiments, the target insert with a Y-shaped universal adaptor can be in a Figure 1K The process shown in is used. Figure 1H The sequence of a target nucleic acid with a Y-shaped short universal adaptor attached to both ends according to some embodiments is shown. The Y-shaped universal adaptor has the sequence TCGTCGGCAGCGTC (SEQ ID NO: 3) at the 5' arm and the sequence CCGAGCCCACGAGAC (SEQ ID NO: 5) at the 3' arm.

[0379] Process 160 also involves denaturing double-stranded nucleic acid fragments with double-stranded short universal adapters at both ends. It also involves adding primers (176a) and nucleases that hybridize with the denatured nucleic acid fragments. As shown in the figure, bottom chain 175a is further processed. Primer (176a) includes a P5 flow cell amplification primer binding site at the 5' end, an i5 index sequence and SP1 at the downstream of the P5 sequence. This polynucleotide is also referred to as an index primer. The index primer hybridizes with single-stranded nucleic acid 175b at the SP1 primer binding site. Polymerase extends the 3' end of index primer 176a to form an extended single-stranded nucleic acid fragment using fragment 175b as a template. The resulting nucleic acid fragment is shown as 176b. Then, the process further adds primers and polymerase to further extend fragment 176b. The primer added in this reaction is included in the P7 flow cell amplification primer binding site at 5', the i7 index sequence at 3' of the P7 sequence and the SP2 sequencing primer binding sequence. Then the 3' end of index primer sequence 178a is extended using single-stranded nucleic acid 176b as a template. In addition, the 3' end of nucleic acid 176b is also extended using index primer 178a as a template. As a result, a double-stranded nucleic acid fragment is formed, wherein one chain 176c extends from fragment 176b, and another chain 178b extends from index primer 178a. The final double-stranded nucleic acid fragment comprises a P5 flow cell amplification primer binding site, an i5 sequence, an SP1 sequencing primer binding sequence, a MEDS sequence, a target sequence, a MEDS sequence, an SP2 sequence, an i7 sequence, and a P7' sequence in the top chain (176c) from 5' to 3' direction. The final double-stranded nucleic acid fragment forms a library fragment for a sequencing platform such as the SBS platform of Illumina.

[0380] According to process 160, some embodiments provide a method for sequencing target nucleic acids derived from multiple samples. The method includes: (a) providing multiple double-stranded nucleic acid molecules derived from multiple samples; (b) providing multiple transposome complexes, wherein each transposome complex comprises a transposase and two transposon end compositions; (c) incubating the double-stranded nucleic acid molecules with the transposome complexes to obtain double-stranded nucleic acid fragments, wherein the double-stranded nucleic acid fragments comprise sequences transposed from the transposon end compositions at one or both ends; (d) contacting multiple index primers with the double-stranded nucleic acid fragments to generate multiple index-fragment polynucleotides, wherein the index primers contacted with the double-stranded nucleic acid fragments derived from each sample comprise an index sequence or a combination of index sequences uniquely associated with the sample, and the index sequence or the combination of index sequences is selected from an index sequence set; (e) pooling multiple index-fragment polynucleotides; (f) sequencing the pooled index-fragment polynucleotides to obtain index reads of the index sequence and multiple target reads of the target sequence, each target read being associated with at least one index read; and (g) using the index reads to determine the sample source of the target reads.

[0381] In some embodiments, at least one transposome complex comprises a Tn5 transposase and a Tn5 transposon end composition. In some embodiments, at least one transposome complex comprises a Mu transposase and a Mu transposon end composition. Some embodiments include both a Tn5 transposase and a Mu transposase and a transposon end composition.

[0382] Figure 1K A process 199 is shown for adding an index sequence to a target nucleic acid having short Y-shaped universal adapters at both ends. The process 199 is similar to Figure 1E In process 160, a target nucleic acid fragment having a double-stranded short universal adapter attached to both ends is used. In process 199, a target nucleic acid having a Y-shaped short adapter attached to both ends is used. Because the two chains of the Y-shaped adapter have two different sequencing primer binding sequences, both chains of the nucleic acid can be used to generate downstream fragments, which can be sequenced on a sequencing platform. In contrast, in an embodiment using a double-stranded adapter, only one chain of the product of the double-stranded nucleic acid can be used for sequencing.

[0383] according to Figures 1H-1J In the embodiment illustrated in FIG, the nucleic acid sequences of the Y-shaped adaptors and index primers are shown. A double-stranded nucleic acid with two Y-shaped short universal adaptors attached to both ends is shown at the beginning of the process. The double-stranded nucleic acid comprises a top strand 190 and a bottom strand 191. A blocking portion 198 is shown at the 3′ end of the top strand 190, which blocks nucleic acid extension when a polymerase is added. Although only one blocking group is shown in the figure, in some embodiments, additional blocking groups can be applied to the other ends of the double-stranded nucleic acid.

[0384] Various blocking agents can be implemented. One possible form of blocking agent includes phosphorothioate (PS) bonds. Phosphorothioate (PS) bonds replace non-bridging oxygens in the phosphate backbone of an oligonucleotide with a sulfur atom. About 50% of the time (due to the 2 resulting stereoisomers that can be formed), PS modification makes the internucleotide linkage more resistant to nuclease degradation. Therefore, it is recommended to include at least 3 PS bonds at the 5' oligonucleotide end and the 3' oligonucleotide end to inhibit exonuclease degradation. Including PS bonds throughout the oligonucleotide will also help reduce attack by endonucleases, but may also increase toxicity.

[0385] Another possible form of blocking agent includes reverse dT and reverse ddT. Reverse dT can be incorporated at the 3' end of the oligonucleotide, resulting in a 3'-3' linkage that will inhibit degradation by 3' exonucleases and extension by DNA polymerases. In addition, placing reverse 2',3' dideoxy-dT bases (5' reverse ddT) at the 5' end of the oligonucleotide prevents spurious ligation and can protect against some forms of enzymatic degradation.

[0386] Another possible form of blocking agent includes phosphorylation. Phosphorylation of the 3' end of the oligonucleotide will inhibit degradation by some 3' exonucleases.

[0387] Another possible blocking agent format includes LNA, where the xGen locked nucleic acid modification prevents both endonuclease and exonuclease digestion.

[0388] The top strand 190 comprises an SP1 sequence, a MEDS sequence, a target insert, a MEDS sequence, and an SP2 sequence from 5′ to 3′. The bottom strand 191 comprises an SP2 sequence, a MEDS sequence, a target insert, a MEDS sequence, and an SP1 sequence from 3′ to 5′. Process 199 denatures the double-stranded nucleic acid, and adds primers and a polymerase to the nucleic acid. An index primer 192a hybridizes with the SP2 primer binding sequence, and is extended using the single-stranded fragment 190 as a template. The 3′ end of the single-stranded nucleic acid 190 is not extended because it is blocked by a blocking group 198. After extension, a double-stranded structure comprising the top strand 190 and the bottom strand 192b is obtained. Then, the double-stranded nucleic acid is denatured again. Process 199 adds primers and a polymerase to the reaction mixture. An i5 index primer 194a is added, which hybridizes with SP1. The i5 index primer 194a comprises a P5 sequence, an i5 index sequence, and an SP1 primer binding sequence from 5′ to 3′. The i5 index primer hybridizes with the SP1 sequence of the single-stranded nucleic acid 192c. Then, the PCR reaction extends the 3' end of the i5 index primer 194a, and the 3' end of the single-stranded fragment 192c. After polymerase extension, a double-stranded nucleic acid is obtained, which comprises a top strand 194b and a bottom strand 192d. The top strand 194b comprises a P5 flow cell amplification primer binding sequence, an i5 index sequence, an SP1 sequencing primer binding sequence, a MEDS sequence, a target sequence, a MEDS sequence, an SP2 sequencing primer binding sequence, an i7 index sequence, and a P7' flow cell amplification primer binding sequence from 5' to 3'. The double-stranded nucleic acid comprises the sequences required for the amplification and sequencing reactions on the Illumina sequencing platform.

[0389] Back to Figure 1D, process 150 involves applying the index sequence to the target nucleic acid of multiple samples. In some embodiments, this is achieved by contacting multiple index polynucleotides with target nucleic acids derived from multiple samples to generate multiple index-target polynucleotides. In some embodiments, the index polynucleotides contacted with the target nucleic acid derived from each sample contain an index sequence or a combination of index sequences uniquely associated with the sample. The index sequence or combination of index sequences is selected from a set of index sequences. The Hamming distance between any two index sequences in the set of index sequences is not less than a first standard value, wherein the first standard value is at least 2.

[0390] In some embodiments, the set of index sequences includes a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an A base or a C base, and (ii) a G base, a T base, or a U base. In some embodiments, the set of index sequences includes at least six different index sequences.

[0391] In some embodiments, the plurality of index polynucleotides comprises an index primer that can hybridize to a universal adaptor. In some embodiments, the plurality of index primers comprises an index sequence of a set of index sequences. In some embodiments, each index primer further comprises a flow cell amplification primer binding sequence. In some embodiments, the flow cell amplification primer binding sequence comprises a P5 sequence or a P7′ sequence. Figure 2C and Figure 2D In some embodiments, target nucleic acids derived from multiple samples include nucleic acids having universal adaptors covalently attached to one or both ends. Figure 1F A nucleic acid having a top strand 174 and a bottom strand 175a and Figure 1K A nucleic acid having a top strand 190 and a bottom strand 191.

[0392] In some embodiments, contacting a plurality of index polynucleotides with target nucleic acids derived from a plurality of samples comprises: hybridizing a plurality of index primers with a universal adapter covalently attached to one or both ends of the nucleic acid; and extending the plurality of index primers to obtain a plurality of index-adapter-target polynucleotides. In some embodiments, the universal adapter and the target nucleic acid are double-stranded, and hybridizing a plurality of index primers with the universal adapter comprises hybridizing a plurality of index primers with only one strand of the universal adapter.

[0393] In some embodiments, the universal adaptor and the target nucleic acid are double-stranded, and hybridizing the plurality of index primers to the universal adaptor comprises hybridizing the plurality of index primers to both strands of the universal adaptor. Figure 1F and Figure 1K .

[0394] In some embodiments, the index primer that hybridizes to the first strand of the universal adaptor comprises an index sequence selected from a first subset of the set of index sequences, and the index primer that hybridizes to the second strand of the universal adaptor comprises a sequence selected from a second subset of the set of index sequences, the first subset and the second subset not overlapping. In some embodiments, the first subset includes the index sequences listed in Table 1, and the second subset includes the index sequences listed in Table 2. In some embodiments, the index primers that hybridize to both strands of the universal adaptor comprise index sequences selected from the same subset of the set of index sequences. In some embodiments, the subset of index sequences is selected from one of the subsets of index sequences in Table 3.

[0395] In some embodiments, the universal adaptor comprises a double-stranded adaptor. See, e.g., Figure 2D In some embodiments, the universal adaptor comprises a Y-shaped adaptor. See, e.g., Figure 2C In some embodiments, the universal adaptors include single-stranded adaptors. In some embodiments, the universal adaptors include hairpin adaptors. In some embodiments, each of the universal adaptors, prior to being attached to a nucleic acid, comprises an overhang at one end to be attached to the nucleic acid. In some embodiments, the overhang is a T overhang. Figure 1C and Figure 2A-2C In some embodiments, each of the universal adaptors, prior to being attached to a nucleic acid, comprises a blunt end to be attached to the nucleic acid. Figure 2D .

[0396] In some embodiments, the method comprises, prior to applying the index sequence to the target nucleic acid, attaching a universal adaptor to one or both ends of the nucleic acid. In some embodiments, attaching comprises attaching the universal adaptor by transposome-mediated fragmentation.

[0397] In some embodiments, attaching comprises ligating a universal adaptor to one or both ends of the nucleic acid. In some embodiments, ligating comprises enzymatic ligation or chemical ligation.

[0398] In some embodiments, attachment is performed by amplification with target-specific primers containing terminal universal adaptors.

[0399] Some embodiments utilize multiple index polynucleotides comprising sample-specific adapters. The adapters comprise index sequences of a set of index sequences. Figure 1C and Figure 2A-2C. In some embodiments, a sample-specific adapter comprises two chains. In some embodiments, only one chain comprises an index sequence. In some embodiments, each chain of a sample-specific adapter comprises an index sequence. In some embodiments, a first chain of a sample-specific adapter comprises an index sequence selected from a first subset of a set of index sequences, and a second chain of a sample-specific adapter comprises an index sequence selected from a second subset of a set of index sequences, and the first subset does not overlap with the second subset. In some embodiments, the first subset of index sequences includes the index sequences listed in Table 1, and the second subset includes the index sequences listed in Table 2. In some embodiments, the first chain and the second chain of a sample-specific universal adapter comprise index sequences selected from the same subset of a set of index sequences. In some embodiments, a subset of index sequences is selected from one of the subsets of index sequences in Table 3.

[0400] In some embodiments, each sample-specific adaptor comprises a flow cell amplification primer binding sequence. Figure 1C , Figure 2A and Figure 2B In some embodiments, the flow cell amplification primer binding sequence includes a P5 sequence or a P7' sequence.

[0401] In some embodiments, contacting a plurality of index polynucleotides with a target nucleic acid comprises attaching a sample-specific adapter to the target nucleic acid by transposome-mediated fragmentation. In some embodiments, contacting a plurality of index polynucleotides with a target nucleic acid comprises connecting a sample-specific adapter to the target nucleic acid. In some embodiments, the connection comprises enzymatic connection or chemical connection. In some embodiments, chemical connection comprises chemical reaction connection.

[0402] In some embodiments, the sample-specific adapter comprises a Y-shaped adapter having a complementary double-stranded region and a mismatched single-stranded region. In some embodiments, each chain of the sample-specific adapter comprises an index sequence at the mismatched single-stranded region. In some embodiments, only one chain of the sample-specific adapter comprises an index sequence at the mismatched single-stranded region. In some embodiments, the sample-specific adapter comprises a single-stranded adapter. In some embodiments, the sample-specific adapter comprises a hairpin adapter. In some embodiments, contacting a plurality of index polynucleotides with a target nucleic acid involves attaching a plurality of index polynucleotides to both ends of the target nucleotide.

[0403] In some embodiments, contacting a plurality of index polynucleotides with a target nucleic acid comprises attaching the plurality of index polynucleotides to both ends of the target nucleic acid. In some embodiments, contacting a plurality of index polynucleotides with a target nucleic acid comprises attaching the plurality of index polynucleotides to only one end of the target nucleic acid.

[0404] In some embodiments, a combination of index sequences uniquely associated with a sample is an ordered combination of index sequences.

[0405] In some embodiments, the index sequence set includes multiple non-overlapping subsets of index sequences, and the Hamming distance between any two index sequences in any subset is not less than a second standard value, wherein the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5. In some embodiments, the first standard value is 3. In some embodiments, the first standard value is 4. Various other designs of index sequence sets can be applied as further described below.

[0406] In some embodiments, process 150 includes fragmenting nucleic acid molecules obtained from multiple samples to obtain target nucleic acids before applying the index sequence to the target nucleic acids of the multiple samples. In some embodiments, fragmentation includes transposome-mediated fragmentation, such as Figure 1E The process shown in .

[0407] In some embodiments, fragmentation is contacted with a plurality of PCR primers targeting a sequence of interest to obtain a target nucleic acid comprising the sequence of interest.

[0408] Process 150 involves pooling the plurality of index-target polynucleotides after obtaining the plurality of index-target polynucleotides. See module 154. In some embodiments, process 150 further comprises amplifying the pooled index-target polynucleotides before sequencing the polynucleotides.

[0409] In some embodiments, process 150 further involves sequencing the pooled index-target polynucleotides to obtain a plurality of index reads of the index sequence and a plurality of target reads of the target sequence, each target read being associated with at least one index read. See module 156.

[0410] Process 150 also involves using the index reads to determine the sample origin of the target reads. In some embodiments, this is achieved by a method comprising the following steps: for each index read, obtaining a comparison score for a set of index sequences, each comparison score indicating a similarity between a sequence of the index read and an index sequence of the set of index sequences; determining a match of the index read to a particular index sequence based on the comparison score; and determining that the target read associated with the particular index read is derived from a sample uniquely associated with the particular index sequence.

[0411] Index sequence design

[0412] In various embodiments, index sequences or oligonucleotides are identified taking into account various factors including, but not limited to, means for detecting errors within the index sequence, transformation efficiency, assay compatibility, GC content, homopolymers, and manufacturing considerations.

[0413] For example, the index sequence may be designed to provide a mechanism for facilitating error detection. Figure 3 Schematic diagram shows an index oligonucleotide design that provides a mechanism for detecting errors that occur in index sequences during the sequencing process. According to the design, each of the index sequences has six nucleotides and differs from all other index sequences by at least two nucleotides. Figure 3 As illustrated in , index sequence 344 differs from index sequence 342 in the first two nucleotides from the left, as shown by the underlined nucleotides T and nucleotide G in index sequence 344 and the nucleotides A and nucleotide C in index sequence 342. Index sequence 346 is a sequence identified as part of a read, and it is different from all other index sequences of the adapter provided in the process. Since the index sequences in the reads are presumably derived from the index sequences in the adapters, errors may have occurred during the sequencing process, such as during amplification or sequencing. Index sequence 342 and index sequence 344 are illustrated as the two index sequences that are most similar to index sequence 346 in the reads. It can be seen that index sequence 346 differs from index sequence 342 by one nucleotide in the first nucleotide from the left, which is T instead of A. In addition, index sequence 346 also differs from index sequence 344 by one nucleotide (although in the second nucleotide from the left), which is C instead of G. Because index sequence 346 in the read differs from both index sequence 342 and index sequence 344 by one nucleotide, it is not possible to determine from the illustrated information whether index sequence 346 is derived from index sequence 342 or index sequence 344. However, in many other cases, an index sequence error in a read will not be equally different from the two most similar index sequences. As shown in the example for index sequence 348, index sequence 342 and index sequence 344 are also the two index sequences most similar to index sequence 348. It can be seen that index sequence 348 differs from index sequence 342 by one nucleotide in the third nucleotide from the left, which is an A instead of a T. In contrast, index sequence 348 differs from index sequence 344 by three nucleotides. Therefore, it can be determined that index sequence 348 is derived from index sequence 342 rather than index sequence 344, and that the error may have occurred in the third nucleotide from the left. By controlling the level of differences between index sequences (e.g., as measured by Hamming distance or edit distance), some embodiments provide index oligonucleotides for identifying the sources of multiple samples, where sequencing errors, sample processing errors, and other errors can be corrected by assigning index sequence reads to closely matching index sequences and samples associated with the closely matching index sequences.

[0414] Some embodiments apply i5-i7 index pairs to multiple samples, where each ordered index pair is unique. The Hamming distance between any two index sequences in the complete set of index sequences is controlled to be above a threshold. In some embodiments, the Hamming distance between ordered index pairs is also controlled to be above a threshold. In addition, in some embodiments, the edit distance between index sequences is also controlled. These and other elements of the index oligonucleotides allow for detection and correction of index jumps by identifying errors that would otherwise be ambiguous and uncorrectable.

[0415] A typical calculation of edit distance is the Levenshtein distance, where each insertion, deletion or substitution is treated as a single editing operation and scored equally. Consider the case of "ACTGACTA" and "ACTACTAA". In this case, the Levenshtein edit distance would be 2, as shown in the alignment below.

[0416] ACTGACTA-

[0417] ACT-ACTAA

[0418] However, in the case of index sequences, this may underestimate the true distance between the two sequences. In reality, the index sequence will be extended by bases from the surrounding adapters. If the bases from the surrounding adapters happen to match another index sequence, this will actually only require a single deletion event to convert one index sequence into another index sequence. In addition, the index can be read in the opposite direction, in which case an additional adapter sequence may appear at the 5′ end of the index. Although it is possible to look at the expected adapter sequence to understand the possibility of this happening, this will make the index sequence valid only in the context of a specific adapter. More precisely, a custom edit distance is generated that always assumes that the adjacent adapter sequence will match the adapter. In this custom edit distance, only a single insertion / deletion event is allowed. An edit distance threshold of 3 means that index pairs are not allowed in which a single deletion + substitution can convert one index sequence into another index sequence.

[0419] In some embodiments, the edit distance is a modified Levenshtein distance in which end gaps are not assigned a penalty. US Provisional Patent Application No. 62 / 447,851, which is incorporated herein by reference in its entirety, describes various methods for determining a modified Levenshtein distance of a nucleic acid sequence.

[0420] Indexing oligonucleotides, adapters, and primers

[0421] In addition to the reference above Figures 1A-1CIn addition to the adaptor designs described in the example workflow 100, other designs of index oligonucleotides can be used in various embodiments of the methods and systems disclosed herein.

[0422] Figures 2A-2D Various embodiments of indexing oligonucleotides are shown.Although adaptors are labeled with various components, they may contain additional components that are not labeled, such as additional primer binding sites or cleavage or digestion sites. Figure 2A Standard Illumina Double index adapter. The adapter is partially double-stranded and is formed by annealing two oligonucleotides corresponding to the two chains. The two chains have many complementary base pairs (e.g., 12-17bp or 6-34bp), which allow the two oligonucleotides to anneal at the ends to be connected to the dsDNA fragments. The dsDNA fragments to be connected on the two ends to obtain the paired-end reads are also referred to as inserts. Other base pairs on the two chains do not match (not complementary), resulting in forked adapters or Y-shaped adapters with two soft overhangs.

[0423] On the chain with a 5' floppy overhang (top chain), from 5' to 3' direction, the adapter has a P5 sequence, an i5 index sequence, and a sequencing primer binding sequence SP1 (e.g., SBS3). On the chain with a 3' floppy overhang, from 3' to 5' direction, the adapter has a P7' sequence, an i7 index sequence, and an SP2 sequencing primer binding sequence (e.g., SBS12'). The P5 oligonucleotide and the P7' oligonucleotide are complementary to the amplification primers of the solid phase of the flow cell bound to the sequencing platform. They are also referred to as amplification primer binding sites, regions, or sequences. In some embodiments, the index sequence provides a means of tracking the source of the sample, thereby allowing multiplexing of multiple samples on the sequencing platform.

[0424] The complementary base pair is part of the sequencing primer binding sequence SP1 and SP2. Downstream of the SP1 primer sequence (e.g., SBS3) is a single nucleotide 3'-T overhang, which provides an overhang complementary to the single nucleotide 3'-A overhang of the dsDNA fragment to be sequenced, which can facilitate the hybridization of the two overhangs. The sequencing primer binding sequence SP2 (e.g., SBS12') is located on the complementary strand, and the phosphate group is attached to the upstream of the complementary strand. The phosphate group helps to connect the 5' end of the SP2 sequence to the 3'-A overhang of the DNA fragment.

[0425] In some embodiments, such as in which the index sequence is selected from a set of index sequences, each strand of the adapter comprises an index sequence selected from the set of index sequences such as those shown in Tables 1-3 and described elsewhere herein. In some embodiments, each double-stranded sequencing adapter in the set of oligonucleotides comprises a first strand and a second strand, wherein the first strand comprises an index sequence selected from a first subset of the set of index sequences and the second strand comprises an index sequence selected from a second subset of the set of index sequences. The first subset does not overlap with the second subset. In some embodiments, the first subset of index sequences includes the index sequences listed in Table 1, and the second subset of index sequences includes the index sequences listed in Table 2.

[0426] Table 1. I7 index set including subsets (index groups 0-3)

[0427]

[0428]

[0429] Table 2. I5 index set including subsets (index groups 0-3)

[0430]

[0431]

[0432] In some embodiments, the index sequence on the first strand of the adaptor and the index sequence on the second strand of the adaptor are both selected from the same subset of a plurality of subsets of a set of index sequences. In some embodiments, the subset of index sequences is one of the subsets of index sequences in Table 3 (labeled by plate number).

[0433] Table 3. Includes the I5 index set and the I7 index set of the subset (plates 1-4)

[0434]

[0435]

[0436]

[0437]

[0438] The set of index sequences contained in the oligonucleotide set includes a plurality of unique index sequences. In some embodiments, the Hamming distance between any two index sequences in the set of index sequences is not less than a first standard value, wherein the first standard value is 2 or greater. The set of index sequences includes a plurality of pairs of color-balanced index sequences. Any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of the following: (i) A bases or C bases, and (ii) G bases, T bases, or U bases. In some embodiments, the first standard value is 3. In some embodiments, the first standard value is 4.

[0439] In some embodiments, the set of index sequences includes multiple non-overlapping subsets of index sequences, such as the subsets shown in Tables 1-3. In these subsets, the Hamming distance between any two index sequences is not less than a second standard value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5.

[0440] In some embodiments, the oligonucleotide comprises an index sequence on its 3′ end and an index sequence on its 5′ end. In such embodiments, the oligonucleotide can be a single-stranded nucleic acid fragment with adaptors attached to both ends. It can be, for example, from Figure 1C Denatured fragments obtained from the adapter-target-adapter construct 140 shown in FIG.

[0441] In some embodiments, the edit distance between any two index sequences in the set of index sequences is no less than a third standard value. In some embodiments, the third standard value is 3. In some embodiments, the edit distance is a modified Levenshtein distance in which terminal gaps are not assigned a penalty. U.S. Patent Application No. 15 / 863,737, which is incorporated herein by reference in its entirety, describes a variety of methods for determining a modified Levenshtein distance of a nucleic acid sequence.

[0442] In some embodiments, each index sequence in the set of index sequences has 8 bases; the first standard value is 3; and the third standard value is 2. In some embodiments, the set of index sequences includes the sequences listed below under Example 2. In some embodiments, each index sequence in the set of index sequences has 10 bases; the first standard value is 4; and the third standard value is 3. In some embodiments, the set of index sequences includes the sequences listed below under Example 3.

[0443] From the perspective of bioinformatics, longer oligonucleotides can provide more candidates that meet various constraints of interest such as edit distance or Hamming distance. However, longer oligonucleotides are more difficult to manufacture, and will lead to undesirable reactions (such as undesirable reactions by self-hybridization, cross-hybridization, folding) and other side effects. In contrast, although shorter oligonucleotides can avoid some of these side effects, they may not be able to meet the constraints of bioinformatics, such as providing a sufficiently large Hamming distance or edit distance to allow error correction. The balance between bioinformatics robustness and biochemical function must be considered. In some embodiments, each index sequence in the oligonucleotide concentration has 32 or less bases. In some embodiments, each index sequence in the oligonucleotide concentration has 16 or less bases. In some embodiments, each index sequence in the oligonucleotide concentration has 10 or less bases. In some embodiments, each index sequence in the oligonucleotide concentration has 8 or less bases. In some embodiments, each index sequence in the oligonucleotide concentration has 8 bases. In some embodiments, each index sequence in the oligonucleotide concentration has 7 or less bases. In some embodiments, each index sequence in a set of oligonucleotides has 6 or fewer bases. In some embodiments, each index sequence in a set of oligonucleotides has 5 or fewer bases. In some embodiments, each index sequence in a set of oligonucleotides has 4 or fewer bases.

[0444] In some embodiments, the set of index sequences incorporated into the index oligonucleotides does not include index sequences that have been empirically determined to have poor performance in indexing the source of nucleic acid samples in multiple massively parallel sequencing. In some embodiments, the index sequences include the sequences in Table 4. Other sequences not listed in Table 4 may also not be included.

[0445] Table 4. Index sequences not included

[0446] Index Tags Index sequence ＞N501 TAGATCGC ＞N504 AGAGTAGA ＞N513 TCGACTAG ＞N515 TTCTAGCT ＞N516 CCTAGAGT >N501-rc GCGATCTA >N513-rc CTAGTCGA >N515-rc AGCTAGAA >N516-rc ACTCTAGG >N504-rc TCTACTCT ＞N704 TCCTGAGC ＞N715 ATCTCAGG ＞N710 CGAGGCTG ＞N705 GGACTCCT ＞N709 GCTACGCT >N709-rc AGCGTAGC >N715-rc CCTGAGAT >N705-rc AGGAGTCC >N704-rc GCTCAGGA >N710-rc CAGCCTCG

[0447] In some embodiments, the set of index sequences includes at least 12 different index sequences. In some embodiments, the set of index sequences includes at least 20 different index sequences. In some embodiments, the set of index sequences includes at least 24 different index sequences. In some embodiments, the set of index sequences includes at least 28 different index sequences. In some embodiments, the set of index sequences includes at least 48 different index sequences. In some embodiments, the set of index sequences includes at least 80 or at least 96 different index sequences. In some embodiments, the set of index sequences includes at least 112 or at least 384 different index sequences. In some embodiments, the set of index sequences includes at least 734, at least 1,026, or at least 1,536 different index sequences.

[0448] In some embodiments, the set of index sequences includes 4 subsets of 8 unique index sequences assigned as i5 sequences and 4 subsets of 12 unique index sequences assigned as i7 sequences. In some embodiments, the index sequences in the subsets are color-balanced sequence pairs. In some embodiments, each subset includes two or more pairs of index sequences to provide redundancy, so that when any index needs to be replaced, the color-balanced index pairs can be replaced together with the redundant pairs in the subset. In some embodiments, the set of index sequences includes 4 subsets of 12 unique index sequences assigned as i5 sequences and 4 subsets of 16 unique index sequences assigned as i7 sequences, totaling 112 sequences.

[0449] In some embodiments, the index sequence set includes 4 subsets of index sequences, and each sequence of the subsets can be applied as both an i5 index sequence and an i7 index sequence.

[0450] In some embodiments, the set of index sequences does not include any homopolymers having four or more consecutive identical bases. In some embodiments, the set of index sequences does not include index sequences that match or are reverse complementary to one or more sequencing primer sequences. In some embodiments, sequencing primer sequences are included in the sequence of oligonucleotides, such as Figure 2A In some embodiments, the set of index sequences does not include an index sequence that matches or is reverse complementary to one or more flow cell amplification primer sequences, such as a P5 sequence or a P7 sequence (amplification primer sequence). In some embodiments, the flow cell amplification primer sequence is included in the oligonucleotide sequence, such as the P5 sequence and the P7' sequence at the 5' end and the 3' end of the fork region of the Y-shaped adapter.

[0451] In some embodiments, the set of index sequences does not include any subsequence of a sequence of an adapter or primer in an Illumina sequencing platform, or a reverse complement of the subsequence. In some embodiments, the sequence of an adapter or primer in an Illumina sequencing platform comprises SEQ ID NO: 1 (AGATGTGTATAAGAGACAG), SEQ ID NO: 3 (TCGTCGGCAGCGTC), SEQ ID NO: 5 (CCGAGCCCACGAGAC), SEQ ID NO: 7 (CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO: 8 (AATGATACGGCGACCACCGAGATCTACAC).

[0452] In some embodiments, a set of index sequences includes index sequences having the same number of bases.

[0453] In some embodiments, each index sequence in the set of index sequences has a combined number of G bases and C bases between 2 and 6. In some embodiments, each index sequence has a guanine / cytosine (GC) content between 25% and 75%. In some embodiments, the set of oligonucleotides comprises DNA oligonucleotides or RNA oligonucleotides.

[0454] Figure 2B Different index oligonucleotide designs are shown, where only one strand of the Y-shaped adaptor contains the index sequence. Figure 2B The sequencing adapters shown in Figure 2A The sequencing adapter in is similar to that in, except that this adapter contains the i7 index sequence only on the P7' arm of the Y-shaped adapter. The i7 index sequence is a member of the index sequence set. The adapter does not contain an index sequence on its P5 arm.

[0455] Figure 2C Another embodiment of the index oligonucleotide is shown, where the index sequence is incorporated into two different index primers, i5 index primer (204) and i7 index primer (206). The i5 index primer (204) comprises the i5 index sequence located downstream of the P5 flow cell amplification primer binding site.

[0456] The i5 index primer comprises an i5 index sequence (210). The i7 index primer 206 comprises an i7 index sequence. The i5 index primer 204 and the i7 index primer 206 can hybridize with a short universal adapter 214 having a Figure 2A and Figure 2BThe Y-shaped adapters in FIG. 202 are similar in shape to the Y-shaped adapters in FIG. 203 , except that the unmatched floppy ends of adapter 202 are shorter and do not contain index sequences or flow cell amplification primer binding sites. Instead, index sequences and flow cell amplification primer binding sites are added to the adapters by i5 index primer 204 and i7 index primer 206, for example, by a nested PCR process as described in U.S. Pat. No. 8,822,150, which is incorporated herein by reference in its entirety for all purposes.

[0457] The short universal adapter 202 is universal and common to different samples, and Figure 2A The dual index adapter and Figure 2B The single index adapter is sample-specific. After the short universal adapter is attached or connected to the target nucleic acid fragment, the primer containing the index can be applied to the adapter-target fragment in a sample-specific manner to allow identification of the source of the sample. The i5 index primer 204 includes a P5 flow cell amplification primer binding site 208 located at the 5′ end, an i5 index sequence 210 located downstream of the P5 binding set, and a primer sequence 212 located downstream of the i5 index sequence. The i7 index primer 206 includes a P7′ flow cell amplification primer binding site 216 located at the 3′ end of the primer, an i7 index sequence located upstream of the P7′ region, and a primer sequence 220 located upstream of the i7 index sequence. When the i5 index primer 204 and the i7 index primer 206 are added to a reaction mixture containing a short universal adapter 202 attached to the target fragment, the index sequence and the amplification primer binding site can be incorporated into the adapter-target fragment by a PCR process (e.g., a nested PCR process) to provide a sequencing library containing a sample-specific index sequence.

[0458] Figure 2D Another index oligonucleotide design is shown, which involves an index primer that can be used to bind to a double-stranded short universal adapter. This design is similar to Figure 2C The design shown in Figure 2D The short universal adapter 232 in is double-stranded, rather than Figure 2C223. In the embodiment of the present invention, the adapter 232 is a Y-shape as shown in the adapter 202 in the middle. In addition, the adapter 232 is a flat end, rather than a T overhang as the adapter 202 has at 223. The i5 index primer 234 and the i7 index primer 236 can hybridize with the short universal adapter 232, thereby adding the relevant index sequence and amplification primer binding site to the target sequence. The i5 index primer 234 includes a P5 flow cell amplification primer binding site 238 located at the 5' end of the primer, an i5 index sequence 240 located downstream of the P5 binding site, and a primer sequence 242 located downstream of the i5 index sequence. The i5 index primer can be attached to the SP1 sequence primer binding site 244 of the double-stranded, short universal adapter 232. The i7 index primer 236 includes a P7' flow cell amplification primer binding site 246 located at the 3' end of the primer, an i7 index sequence 248 located upstream of the P7' amplification primer binding site, and a primer sequence 250 located upstream of the i7 index sequence. The i5 index primer 234 and the i7 index primer 236 can be used to incorporate index primer and amplification primer binding sites into the target sequence through a nested PCR reaction to provide a sequence library comprising sample-specific index sequences.

[0459] In some embodiments, the set of index oligonucleotides is provided in a container comprising a plurality of separate compartments. In some embodiments, the container comprises a multi-well plate. Figures 4A-4C Schematic diagram shows a multiwell plate in which index oligonucleotides can be provided. In some embodiments, each compartment contains a plurality of oligonucleotides, which contain an index sequence in the index sequence set. An index sequence in a compartment is different from the index sequences contained in other compartments. The oligonucleotides in each compartment can be applied to nucleic acid fragments from different sample sources to provide a mechanism for identifying the source of the sample.

[0460] In some embodiments, each compartment comprises a first plurality of oligonucleotides, the first plurality of oligonucleotides comprising a first index sequence in the index sequence set. The compartment also comprises a second plurality of oligonucleotides, the second plurality of oligonucleotides comprising a second index sequence in the index sequence set. The ordered combination of the first plurality of oligonucleotides and the second plurality of oligonucleotides is different from the ordered combination in any other compartment. The polynucleotide set comprises a first plurality of oligonucleotides and a second plurality of oligonucleotides.

[0461] Figure 4A The multiwell plate shown in comprises an array of holes in the form of 8 rows and 12 columns, totaling 96 compartments. In some embodiments, the array can have 16 rows and 24 columns, totaling 384 compartments. In some embodiments, the oligonucleotide set is provided in Figure 4AIn the multiwell plate shown in, wherein the compartments of each 1 / 4 row contain oligonucleotides containing at least one pair of color-balanced index sequences, and the compartments of each 1 / 4 column contain oligonucleotides containing at least one pair of color-balanced indexes. In such a configuration, each quarter row and each quarter column can be used in a multiple sequencing workflow. Therefore, this configuration enables double, triple, quadruple, sextuple, octaplex, nonaplex and 12-plex sequencing to be achieved while fully utilizing the holes.

[0462] Figure 4B The layout of the i5 index sequences in an 8×12 multiwell plate is shown. The sequences are labeled so that 2n-1 and 2n (n is a positive integer) are color-balanced pairs. The i501-i508 sequences can be selected from any subset in Table 1 or Table 3.

[0463] Figure 4C The layout of the i7 index sequence is shown. The i7 sequence is also organized in color balance pairs as described above. The i701-i712 sequences can be selected from any subset of Table 2 or Table 3. For both the i5 and i7 sequences, when a sequence needs to be replaced due to various reasons such as poor performance or experimental considerations, its color balance pair should also be replaced. The removed color balance pair can be replaced with another color balance pair from the same subset in Tables 1-3. Such replacement will maintain the color balance of the board. Figure 4B and Figure 4C The index sequence layout shown in is used for combining dual index applications. In other words, each hole comprises a first plurality of oligonucleotides and a second plurality of oligonucleotides, wherein the first plurality of oligonucleotides comprises a first index sequence of an index sequence set, and the second plurality of oligonucleotides comprises a second index sequence of an index sequence set. The ordered combination of the first oligonucleotide and the second oligonucleotide in each compartment is different from the ordered combination of any other compartment.

[0464] In some embodiments, such as Figure 4B and Figure 4C In the index sequence layout illustrated in FIG, the first plurality of oligonucleotides comprises a P5 flow cell amplification primer binding site. The second plurality of oligonucleotides comprises a P7′ flow cell amplification primer binding site. In some embodiments, such as in Figure 4B and Figure 4C In the illustrated embodiment, the first plurality of oligonucleotides comprises an i5 index sequence and the second plurality of oligonucleotides comprises an i7 index sequence.

[0465] In some embodiments, a set of oligonucleotides (including a first plurality of oligonucleotides and a second plurality of oligonucleotides) is implemented as a Y-shaped adaptor comprising an index sequence, such as Figure 2A and Figure 2BIn some embodiments, the oligonucleotide set provided in the plate includes a double-stranded adapter comprising an index sequence. In some embodiments, the oligonucleotide set includes a primer comprising an index sequence, such as Figure 2C and Figure 2D Primers shown in .

[0466] In some embodiments, each index sequence in the first plurality of oligonucleotides is selected from a first subset of the index sequence set, and each index sequence in the second plurality of oligonucleotides is selected from a second subset of the index sequence set, and the first subset does not overlap with the second subset. In some embodiments, the Hamming distance between any two index sequences in the first subset or between any two index sequences in the second subset is not less than a second standard value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5. In other words, the Hamming distance between sequences in the subset is greater than the Hamming distance between sequences across the subset. In some applications, a larger Hamming distance within a subset can increase the probability of identifying index sequence reads containing errors (such as substitutions, insertions, or deletions). In some embodiments, the first subset is a subset selected from Table 1, and the second subset is a subset selected from Table 2. In some embodiments, the first subset comprises an i5 index sequence, and the second subset comprises an i7 index sequence.

[0467] In some embodiments, the index sequence is incorporated into a sequencing adapter. In some embodiments, the sequencing adapter comprises a Y-shaped sequencing adapter, wherein each sequencing adapter comprises a first strand and a second strand, wherein the first strand comprises an index sequence selected from a first subset of a set of index sequences, and the second strand comprises an index sequence selected from a second subset of the set of index sequences, and the first subset does not overlap with the second subset.

[0468] In some embodiments, the index sequences contained in the first plurality of oligonucleotides and the second plurality of oligonucleotides are selected from the same subset of the index sequence set. In some embodiments, the Hamming distance between any two index sequences in the same subset is not less than a second standard value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5. In some embodiments, the subset is selected from the subsets listed in Table 3. In some embodiments, a plurality of separate compartments of a multiwell plate are arranged in an array of compartments in one or more rows and compartments in one or more columns. In some embodiments, every 1 / n row and / or every 1 / m column of compartments contains oligonucleotides containing at least one pair of color-balanced index sequences, wherein n and m are each selected from integers in the range of 1 to 24. In some embodiments, a plurality of separate compartments are arranged in an 8x 12 array, such as Figure 4A As shown in .

[0469] Some embodiments provide oligonucleotides consisting mainly of multiple subsets of oligonucleotides. The oligonucleotide set is configured to identify the source of a nucleic acid sample in multiple massively parallel sequencing, each of the nucleic acid samples comprising multiple nucleic acid molecules. Each subset of the multiple subsets of oligonucleotides comprises a unique index sequence, and the index sequences of the multiple subsets consist of an index sequence set. The Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2. The index sequence set comprises multiple pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include the following two: (i) adenine (A) bases or cytosine (C) bases, and (ii) guanine (G) bases, thymine (T) bases or uracil (U) bases.

[0470] Construction of indexing oligonucleotides

[0471] Some embodiments provide a method for preparing a plurality of oligonucleotides for multiple massively parallel sequencing. The method comprises selecting an index sequence set from a collection of different index sequences. The index sequence set comprises at least six different sequences. The Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2. The index sequence set comprises a plurality of pairs of color-balanced index sequences. Any two bases at corresponding sequence positions of each pair of color-balanced index sequences comprise both of the following: (i) A bases or C bases, and (ii) G bases, T bases, or U bases.

[0472] In some embodiments, a process for selecting a set of index sequences from a collection of different index sequences is based on Figure 5 Steps 402-416 of process 400 are performed. In some embodiments, selecting an index sequence set from a collection of different index sequences includes selecting a candidate set of index sequences from the collection of index sequences; separating the selected candidate set into a plurality of groups of color-balanced index sequence pairs; and using a bipartite graph matching algorithm to divide each group into two subgroups of color-balanced pairs. Each color-balanced pair is a node in a bipartite graph.

[0473] Figure 5A process 400 for preparing index oligonucleotides such as indexed adapters is shown. Process 400 involves providing a collection of all possible n-mer sequences. In some embodiments, the n-mer is an 8-mer. In some embodiments, the n-mer is a 9-mer. In some embodiments, the n-mer is a 10-mer. Oligonucleotides of other sizes described herein can be generated similarly. See module 402. Process 400 also involves removing a subset of index sequences from the collection of index sequences. See module 404. In some embodiments, the subset of index sequences that are removed includes index sequences having four or more consecutive identical bases. In some embodiments, the subset of index sequences that are removed includes index sequences having a combined number of G bases and C bases less than two and oligonucleotide sequences having a combined number of G bases and C bases greater than six. In some embodiments, the subset of index sequences that are removed includes index sequences having a sequence that matches or is reverse complementary to one or more sequencing primer sequences. In some embodiments, a sequencing primer sequence is included in the sequence of an index oligonucleotide, such as Figures 2A-2D In some embodiments, the subset of index sequences removed includes index sequences having sequences that match or are reverse complementary to one or more flow cell amplification primer sequences. In some embodiments, flow cell amplification primer sequences are included in the sequence of index oligonucleotides, such as Figures 2A-2D In some embodiments, the subset of index sequences removed includes index sequences that are empirically determined to have poor performance in indexing the source of nucleic acid samples in multiple massively parallel sequencing. In some embodiments, the subset of index sequences removed includes the sequences in Table 4.

[0474] Process 400 proceeds by randomly selecting a pair of color-balanced sequences from the collection of sequences. See module 406. Process 400 also involves adding the pair of color-balanced sequences to a candidate set and removing the pair from the collection. See module 408. Process 410 involves sorting the remaining index sequences in the collection of index sequences based on a minimum Hamming distance to a member in the candidate set. See module 410. Process 400 also involves removing any remaining index sequences whose minimum Hamming distance to a member in the candidate set is less than a first criterion value or whose minimum edit distance to a member in the candidate set is less than a third criterion value. In some embodiments, the first criterion value is 4 and the third criterion value is 3. See module 412.

[0475] Process 400 also involves determining whether there are any sequences left in the collection. See module 414. If so, the process loops back to module 406 to randomly select a pair of color-balanced sequences from the collection of sequences. See the "yes" branch of decision module 414. If no more sequences remain in the collection, process 400 continues to separate the candidate set into multiple groups of color-balanced pairs. See module 416. In some embodiments, the separation is performed by randomly selecting a seed for each of the multiple groups and greedily expanding each of the multiple groups. The greedy approach involves having each group take turns obtaining the furthest color-balanced pair remaining in the collection.

[0476] Process 400 also involves using a bipartite graph matching algorithm to divide each group into two subsets of color-balanced pairs, each color-balanced index sequence pair being a node in a bipartite graph. In the bipartite graph matching algorithm, two nodes are connected if the Hamming distance between the two nodes is less than a second criterion value, where the second criterion value is greater than the first criterion value. The matching algorithm generates two sets of index sequences. In some embodiments, the first criterion value is 4 and the second criterion value is 5. In some embodiments, one set can be used as an i5 index sequence and the other set can be used as an i7 index sequence.

[0477] Then, process 400 involves synthesizing a plurality of oligonucleotides, each of which has at least one index sequence in the candidate set. In some embodiments, the plurality of oligonucleotides comprises a double-stranded sequencing adapter, wherein each strand of each double-stranded sequencing adapter comprises an index sequence of the index sequence set. In some embodiments, the double-stranded sequencing adapter comprises a first strand and a second strand, wherein the first strand comprises an index sequence selected from a first subset of the index sequence set, and the second strand comprises an index sequence selected from a second subset of the index sequence set, and the first subset does not overlap with the second subset. In some embodiments, the first strand of each double-stranded sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each double-stranded sequencing adapter comprises a P7′ flow cell amplification primer binding site. Other forms of oligonucleotides described herein can be synthesized.

[0478] sample

[0479] The sample used to determine the sequence of the DNA fragment may include a sample obtained from any cell, fluid, tissue or organ, wherein the sample contains nucleic acid in which the sequence of interest is to be determined. In some embodiments involving the diagnosis of cancer, circulating tumor DNA can be obtained from a subject's body fluids such as blood or plasma. In some embodiments involving the diagnosis of the fetus, it is advantageous to obtain cell-free nucleic acids, such as cell-free DNA (cfDNA) from maternal body fluids. Cell-free nucleic acids (including cell-free DNA) can be obtained from biological samples including, but not limited to, plasma, serum, and urine by various methods known in the art (see, e.g., Fan et al., Proc Natl Acad Sci 105:16266-16271

[2008] ; Koide et al., Prenatal Diagnosis 25:604-607

[2005] ; Chen et al., Nature Med. 2:1033-1035

[1996] ; Lo et al., Lancet 350:485-487

[1997] ; Botezatu et al., Clin Chem. 46:1078-1084, 2000; and Su et al., J Mol. Diagn. 6:101-107

[2004] ).

[0481] In various embodiments, the nucleic acid (e.g., DNA or RNA) present in the sample can be enriched specifically or non-specifically before use (e.g., before preparing a sequencing library). Non-specific enrichment of sample DNA refers to the whole genome amplification of the genomic DNA fragments of the sample, which can be used to increase the level of sample DNA before preparing a cfDNA sequencing library. Methods for whole genome amplification are known in the art. PCR (DOP) triggered by degenerate oligonucleotides, primer extension PCR techniques (PEP) and multiple displacement amplification (MDA) are examples of whole genome amplification methods. In some embodiments, the sample is not enriched for DNA.

[0482] Samples containing nucleic acids to which the methods described herein are applied typically include biological samples as described above ("test samples").In some embodiments, nucleic acids to be sequenced are purified or isolated by any of a number of well-known methods.

[0483] Therefore, in certain embodiments, the sample comprises a polynucleotide that is purified or separated or is mainly composed of a polynucleotide that is purified or separated, or it may include samples such as tissue samples, biological fluid samples, cell samples, etc. Suitable biological fluid samples include, but are not limited to, blood, plasma, serum, sweat, tears, sputum, urine, sputum, ear flow, lymph, saliva, cerebrospinal fluid, lavage fluid, bone marrow suspension, vaginal flow, cervical lavage, brain fluid, ascites, milk, secretions of the respiratory tract, intestinal tract and urogenital tract, amniotic fluid, milk and leukocyte apheresis samples. In some embodiments, the sample is a sample that is easily obtainable by a non-invasive procedure, such as blood, plasma, serum, sweat, tears, sputum, urine, feces, sputum, ear flow, saliva or excreta. In certain embodiments, the sample is a peripheral blood sample, or the plasma and / or serum fractions of a peripheral blood sample. In other embodiments, the biological sample is a swab or smear, a biopsy specimen or a cell culture. In another embodiment, the sample is a mixture of two or more biological samples, for example, the biological sample can include two or more of a biological fluid sample, a tissue sample, and a cell culture sample. As used herein, the terms "blood", "plasma", and "serum" explicitly encompass fractions or processed portions thereof. Similarly, in the case where the sample is obtained from a biopsy, swab, smear, etc., the "sample" explicitly encompasses processed fractions or portions derived from a biopsy, swab, smear, etc.

[0484] In certain embodiments, samples can be obtained from sources including, but not limited to, samples from different individuals, samples from different developmental stages of the same or different individuals, samples from different diseased individuals (e.g., individuals suspected of having a genetic disorder), normal individuals, samples obtained at different stages of an individual's disease, samples obtained from individuals undergoing different disease treatments, samples from individuals subjected to different environmental factors, samples from individuals with a predisposition to a pathology, samples from individuals exposed to infectious disease agents, and the like.

[0485] In an illustrative but non-limiting embodiment, the sample is a maternal sample obtained from a pregnant female, such as a pregnant woman. In this case, the sample can be analyzed using the method described herein to provide a prenatal diagnosis of potential chromosome abnormalities in the fetus. The maternal sample can be a tissue sample, a biological fluid sample, or a cell sample. As a non-limiting example, biological fluids include blood, plasma, serum, sweat, tears, sputum, urine, sputum, ear flow, lymph, saliva, cerebrospinal fluid, lavage fluid, bone marrow suspension, vaginal flow, cervical lavage fluid, brain fluid, ascites, milk, secretions of the respiratory tract, intestinal tract and urogenital tract, and leukocyte apheresis samples.

[0486] In certain embodiments, samples can also be obtained from in vitro cultured tissues, cells or other sources containing polynucleotides. Cultivated samples can be obtained from sources including, but not limited to, cultures (e.g., tissues or cells) maintained in different culture media and conditions (e.g., pH, pressure or temperature), cultures (e.g., tissues or cells) maintained for different lengths of period, cultures (e.g., tissues or cells) treated with different factors or reagents (e.g., candidate drugs or modulators) or cultures of different types of tissues and / or cells.

[0487] The method for separating nucleic acid from biological sources is well known, and will be different depending on the nature of the source. Those skilled in the art can easily separate nucleic acid from the source according to the needs of the method described herein. In some cases, it can be advantageous to fragment the nucleic acid molecules in the nucleic acid sample. Fragmentation can be random, or it can be specific, as for example achieved by digestion with restriction endonucleases. The method for random fragmentation is well known in the art, and includes for example limited DNA enzyme digestion, alkali treatment and physical shearing.

[0488] Sequencing library preparation

[0489] In various embodiments, sequencing can be carried out on various sequencing platforms requiring the preparation of sequencing libraries.This preparation typically involves DNA fragmentation (sound treatment, atomization or shearing), followed by DNA repair and terminal smoothing (polishing) (flat end or A overhang), and the connection of platform-specific adapters.In one embodiment, method described herein can utilize next generation sequencing technology (NGS), and this next generation sequencing technology (NGS) allows multiple samples to be sequenced individually as genomic molecules (that is, single sequencing) or as the sample of the collection of the genomic molecules comprising indexing to be sequenced in a single sequencing run (for example, multiple sequencing).These methods can generate up to billions of DNA sequence reads.In various embodiments, the sequence of genomic nucleic acid and / or the genomic nucleic acid of indexing can be determined using, for example, next generation sequencing technology (NGS) described herein.In various embodiments, the analysis of the large amount of sequence data obtained using NGS can be carried out using one or more processors as described herein.

[0490] In various embodiments, the use of such sequencing techniques does not involve the preparation of sequencing libraries.

[0491] However, in certain embodiments, the sequencing methods contemplated herein relate to the preparation of sequencing libraries. In an illustrative method, the preparation of sequencing libraries relates to the generation of a random collection of adapter-modified DNA fragments (e.g., polynucleotides), which are ready for sequencing. The sequencing library of polynucleotides can be prepared by the following: DNA or RNA, including equivalents, analogs of DNA or cDNA, such as complementary DNA or cDNA, or by the action of reverse transcriptase, a copy DNA produced by an RNA template. The polynucleotides can originate in double-stranded form (e.g., dsDNA such as genomic DNA fragments, cDNA, PCR amplification products, etc.), or in certain embodiments, the polynucleotides can originate in single-stranded form (e.g., ssDNA, RNA, etc.), and have been converted into dsDNA forms. As an example, in certain embodiments, a single-stranded mRNA molecule can be copied as a double-stranded cDNA suitable for preparing a sequencing library. The precise sequence of a primary polynucleotide molecule is generally unimportant for the method of library preparation, and can be known or unknown. In one embodiment, the polynucleotide molecule is a DNA molecule. More specifically, in certain embodiments, the polynucleotide molecule represents the entire gene complement of an organism or substantially the entire gene complement of an organism, and is a genomic DNA molecule (e.g., cellular DNA, cell-free DNA (cfDNA), etc.), which typically contains both intron sequences and exon sequences (coding sequences), as well as non-coding regulatory sequences such as promoter sequences and enhancer sequences. In certain embodiments, the primary polynucleotide molecule comprises a human genomic DNA molecule, such as a cfDNA molecule present in the peripheral blood of a pregnant subject.

[0492] The preparation of sequencing libraries for some NGS sequencing platforms is facilitated by using polynucleotides containing a specific range of fragment sizes. The preparation of such libraries typically involves fragmentation of large polynucleotides (e.g., cellular genomic DNA) to obtain polynucleotides in the desired size range.

[0493] Paired-end reads can be used in the sequencing methods and systems disclosed herein.The fragment or insert length is longer than the read length, and sometimes longer than the sum of the lengths of the two reads.

[0494] In some illustrative embodiments, sample nucleic acid is obtained as genomic DNA, which is fragmented into fragments longer than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000 or 5000 base pairs, and the NGS method can be easily applied to the fragments. In some embodiments, paired end reads are obtained from the insert fragments of about 100-5000bp. In some embodiments, the length of the insert fragment is about 100-1000bp. These are sometimes implemented as conventional short insert fragment paired end reads. In some embodiments, the length of the insert fragment is about 1000-5000bp. These are sometimes implemented as long insert fragments as described above matching paired reads.

[0495] In some embodiments, long inserts are designed to evaluate very long sequences. In some embodiments, matching pairs of reads can be applied to obtain reads spaced apart by thousands of base pairs. In these embodiments, the inserts or fragments are in the range of from hundreds to thousands of base pairs, with two biotin-connected adapters at both ends of the insert. The biotin-connected adapters are then connected to the two ends of the insert to form a circular molecule, which is then further fragmented. The subfragments comprising the biotin-connected adapters and the two ends of the original insert are selected for sequencing on a platform designed to sequence shorter fragments.

[0496] Fragmentation can be achieved by any of a number of methods known to those skilled in the art. For example, fragmentation can be achieved by mechanical means, including but not limited to nebulization, sonication, and hydroshear. However, mechanical fragmentation typically cleaves the DNA backbone at CO bonds, PO bonds, and CC bonds, producing a heterogeneous mixture of blunt ends with broken CO bonds, PO bonds, and CC bonds, as well as 3′-overhangs and 5′-overhangs (see, e.g., Alnemri and Liwack, J Biol. Chem 265: 17323-17333

[1990] ; Richards and Boyer, J Mol Biol 11: 327-240

[1965] ), which may need to be repaired because they may lack the 5′-phosphate necessary for subsequent enzymatic reactions, e.g., the ligation of sequencing adapters, which are required for preparing DNA for sequencing.

[0497] In contrast, cfDNA typically exists as fragments smaller than about 300 base pairs, and therefore, fragmentation is generally not necessary for generating sequencing libraries using cfDNA samples.

[0498] Typically, whether the polynucleotides are forcibly fragmented (e.g., in vitro fragmentation) or naturally exist as fragments, they are converted into blunt-ended DNA having 5'-phosphate and 3'-hydroxyl groups. Standard protocols, for example, using, for example, as described above in reference Figure 1A and Figure 1B The protocol for sequencing on the Illumina platform described in the example workflow guides the user to end-repair sample DNA, to purify the end-repair products before adenylation or dA-tailing of the 3′ ends, and to purify the dA-tailing products before the adapter-ligation step of library preparation.

[0499] Various embodiments of the methods of sequence library preparation described herein eliminate the need to perform one or more steps typically enforced by standard protocols to obtain modified DNA products that can be sequenced by NGS. The simplified method (ABB method), the 1-step method, and the 2-step method are examples of methods for preparing sequencing libraries, which can be found in U.S. Patent Publication No. 2013 / 0029852A1, which is incorporated herein by reference in its entirety.

[0500] Sequencing methods

[0501] Method and apparatus described herein can adopt next generation sequencing technology (NGS), which allows large-scale parallel sequencing. In certain embodiments, the DNA template or single DNA molecule of cloned amplification is sequenced in a large-scale parallel manner in a flow cell (for example, as in Volkerding et al. Clin Chem 55:641-658

[2009] ; Metzker M Nature Rev 11: described in 31-46

[2010] ). The sequencing technology of NGS includes but is not limited to pyrophosphate sequencing, synthetic sequencing using reversible dye terminator, oligonucleotide probe connection sequencing and ion semiconductor sequencing. DNA from a single sample can be sequenced individually (that is, single sequencing), or DNA from multiple samples can be collected and sequenced (that is, multiple sequencing) as an indexed genomic molecule in a single sequencing run, to generate up to hundreds of millions of DNA sequence reads. The example of sequencing technology that can be used to obtain sequence information according to the inventive method is further described here.

[0502] Several sequencing technologies are commercially available, such as the hybridization sequencing platform from Affymetrix Inc. (Sunnyvale, CA) and the synthetic sequencing platforms from 454 Life Sciences (Bradford, CT), Illumina / Solexa (Hayward, CA) and Helicos Biosciences (Cambridge, MA), and the ligation sequencing platform from Applied Biosystems (Foster City, CA), as described below. In addition to single molecule sequencing using synthetic sequencing from Helicos Biosciences, other single molecule sequencing technologies include, but are not limited to, SMRT from Pacific Biosciences. TM Technology, ION TORRENT TM Technologies and nanopore sequencing such as that developed by Oxford Nanopore Technologies.

[0503] Although the automated Sanger method is considered a "first generation" technique, Sanger sequencing including automated Sanger sequencing can also be used for the methods described herein. Other suitable sequencing methods include, but are not limited to, nucleic acid imaging techniques, such as atomic force microscopy (AFM) or transmission electron microscopy (TEM). Illustrative sequencing techniques are described in more detail below.

[0504] In some embodiments, the disclosed method involves obtaining sequence information of nucleic acids in a test sample by massively parallel sequencing of millions of DNA fragments using Illumina's synthetic sequencing and sequencing chemistry based on reversible terminators (e.g., as described in Bentley et al., Nature 6:53-59

[2009] ). Template DNA can be genomic DNA, such as cellular DNA or cfDNA. In some embodiments, genomic DNA from isolated cells is used as a template, and it is fragmented into a length of several hundred base pairs. In other embodiments, cfDNA or circulating tumor DNA (ctDNA) is used as a template, and fragmentation is not required because cfDNA or ctDNA exists as short fragments. For example, fetal cfDNA circulates in the bloodstream as fragments of about 170 base pairs (bp) in length (Fan et al., Clin Chem 56:1279-1286

[2010] ), and DNA fragmentation is not required before sequencing. Illumina sequencing technology relies on attaching fragmented genomic DNA to a planar, optically transparent surface, and oligonucleotide anchors are bound to the surface. The template DNA is end-repaired to generate a 5'-phosphorylated flat end, and the polymerase activity of the Klenow fragment is used to add a single A base to the 3' end of the phosphorylated DNA fragment of the flat end. The addition is prepared for the DNA fragment connected to the oligonucleotide adapter, which has an overhang of a single T base at its 3' end to increase the connection efficiency. The adapter oligonucleotide is complementary to the flow cell anchor oligonucleotide. Under limiting dilution conditions, the single-stranded template DNA modified by the adapter is added to the flow cell and fixed to the anchor oligonucleotide by hybridization. The attached DNA fragment is extended and bridge-amplified to produce an ultra-high density sequencing flow cell with hundreds of millions of clusters, each cluster containing about 1,000 copies of the same template. In one embodiment, the genomic DNA of random fragmentation is amplified using PCR before it is subjected to cluster amplification. Alternatively, a non-amplified genomic library product is used, and cluster amplification is used alone to enrich the genomic DNA of random fragmentation (Kozarewa et al., Nature Methods 6: 291-295

[2009] ). In some applications, templates are sequenced using a robust four-color DNA synthesis sequencing technology that uses reversible terminators with removable fluorescent dyes. High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Short sequence reads of about tens to hundreds of base pairs are compared to a reference genome, and the unique mapping of short sequence reads to the reference genome is identified using a specially developed data analysis pipeline software. After completing the first read, the template can be regenerated in situ to enable a second read from the opposite end of the fragment.Therefore, single-end sequencing or paired-end sequencing of DNA fragments can be used.

[0505] Each embodiment of the present disclosure can use synthetic sequencing that allows paired end sequencing.In some embodiments, the synthetic sequencing platform of Illumina is related to fragment clustering.Clustering is the process that each fragment molecule is amplified isothermally.In some embodiments, as the example described here, fragment has two different adapters attached to the two ends of the fragment, and adapter allows two different oligonucleotide hybridizations on the surface of the fragment and the flow cell swimming lane.Fragment also includes two index sequences located at the two ends of the fragment or is connected to two index sequences at the two ends of the fragment, and the index sequence provides a label to identify different samples in multiple sequencing.In some sequencing platforms, the fragment to be sequenced from the two ends is also referred to as an insert.

[0506] In some embodiments, the flow cell used for clustering in the Illumina platform is a slide with lanes. Each lane is a glass channel coated with a large amount of (a lawn of) two types of oligonucleotides (e.g., P5 oligonucleotides and P7' oligonucleotides). Hybridization is achieved by the first type of the two types of oligonucleotides on the surface. The oligonucleotide is complementary to the first adapter on one end of the fragment. The polymerase produces a complementary strand of the hybridized fragment. The double-stranded molecule is denatured and the original template strand is washed off. The remaining strand, in parallel with many other remaining strands, is clonally amplified by bridge amplification.

[0507] In bridge amplification and other sequencing methods involving clustering, the strand folds and the second adapter region on the second end of the strand hybridizes to a second type of oligonucleotide on the surface of the flow cell. A polymerase generates a complementary strand, forming a double-stranded bridge molecule. This double-stranded molecule is denatured, resulting in two single-stranded molecules that are tethered to the flow cell by two different oligonucleotides. This process is then repeated over and over again and occurs simultaneously for millions of clusters, resulting in clonal amplification of all fragments. After bridge amplification, the reverse strand is cleaved and washed away, leaving only the forward strand. The 3′ end is blocked to prevent unwanted priming.

[0508] After clustering, sequencing begins by extending the first sequencing primer to generate the first read. With each cycle, fluorescently labeled nucleotides compete to be added to the growing chain. Based on the sequence of the template, only one nucleotide is incorporated. After each nucleotide is added, the cluster is excited by a light source and emits a characteristic fluorescent signal. The number of cycles determines the length of the read. The emission wavelength and signal intensity determine the base determination. For a given cluster, all identical chains are read simultaneously. Hundreds of millions of clusters are sequenced in a massively parallel manner. After the first read is completed, the read product is washed away.

[0509] In the next step of the protocol involving two index primers, an Index 1 primer is introduced and hybridized to the Index 1 region on the template. The Index region provides identification of the fragments, which is useful for demultiplexing the sample during multiplex sequencing. The Index 1 read is generated similarly to the first read. After the Index 1 read is completed, the read product is washed away and the 3' end of the strand is deprotected. The template strand is then folded and bound to the second oligonucleotide on the flow cell. The Index 2 sequence is read in the same manner as Index 1. The Index 2 read product is then washed away when this step is completed.

[0510] After reading the two indexes, read 2 starts by using a polymerase to extend the second flow cell oligonucleotide to form a double-stranded bridge. The double-stranded DNA is denatured and the 3′ end is closed. The original forward chain is cleaved and washed away, leaving the reverse chain. Read 2 starts with the introduction of read 2 sequencing primer. As with read 1, the sequencing step is repeated until the desired length is reached. The read 2 product is washed away. This entire process generates millions of reads, representing all fragments. Sequences from the pooled sample libraries are separated based on the unique index introduced during sample preparation. For each sample, the reads of the base determination of similar segments are locally clustered. The forward read and the reverse read are paired, producing continuous sequences. These continuous sequences are aligned with the reference genome for variant identification.

[0511] The example of synthetic sequencing described above relates to paired end reads, which are used in many embodiments of the disclosed method. Paired end sequencing relates to 2 reads from the two ends of the fragment. Paired end reads are used to resolve ambiguous comparisons. Paired end sequencing allows the user to select the length of the insert (or fragment to be sequenced) and to sequence either end of the insert, generating high-quality, comparable sequence data. Because the distance between each paired read is known, the alignment algorithm can use this information to more accurately map the reads on the repeat region. This results in a better comparison of the reads, particularly across the better comparison of the reads of the repeat regions that are difficult to sequence in the genome. Paired end sequencing can detect rearrangements, including insertions and deletions (insertions / deletions) and inversions.

[0512] Paired end reads can use inserts of different lengths (i.e., different sizes of fragments to be sequenced). As the default meaning in the present disclosure, paired end reads are used to refer to reads obtained from various insert lengths. In some cases, in order to distinguish short insert paired end reads from long insert paired end reads, the latter are specifically referred to as matched pair reads. In some embodiments involving matched pair reads, two biotin-connected adapters are first attached to the two ends of a relatively long insert (e.g., several kb). Then, the biotin-connected adapter connects the two ends of the insert to form a circular molecule. Then, the sub-fragments covering the biotin-connected adapters can be obtained by further fragmenting the circular molecule. Then, the sub-fragments containing the two ends of the original fragment in reverse sequence order can be sequenced by the same procedure as the short insert paired end sequencing described above. Further details of matched pair sequencing using the Illumina platform are set forth in an online publication at the following address, which is incorporated by reference in its entirety: https: / / www.illumina.com / documents / products / technotes / technote_nextera_matepair_data_processing.pdf.

[0513] After sequencing the DNA fragments, sequence reads of a predetermined length (e.g., 100bp) are located by mapping to a known reference genome (compared with a known reference genome). Mapped reads and their corresponding positions on the reference sequence are also referred to as tags. In another embodiment of the program, positioning is achieved by k-mer sharing and read-read comparison. The analysis of many embodiments disclosed herein utilizes poor matching or unmatched reads, and matched reads (tags). In one embodiment, the reference genome sequence is NCBI36 / hg18 sequence, which is available on the world wide web at genome.ucsc.edu / cgi-bin / hgGateway? org=Human&db=hg18&hgsid=166260105. Alternatively, the reference genome sequence is GRCh37 / hg19 or GRCh38, which is available on the world wide web at genome.ucsc.edu / cgi-bin / hgGateway. Other sources of public sequence information include GenBank, dbEST, dbSTS, EMBL (European Molecular Biology Laboratory), and DDBJ (DNA Databank of Japan). Many computer algorithms can be used to align sequences, including but not limited to BLAST (Altschul et al., 1990), BLITZ (MPsrch) (Sturrock & Collins, 1993), FASTA (Person & Lipman, 1988), BOWTIE (Langmead et al., Genome Biology 10: R25.1-R25.10

[2009] ), or ELAND (Illumina, Inc., San Diego, CA, USA). In one embodiment, one end of a cloned amplified copy of plasma cfDNA is sequenced and processed by bioinformatics alignment analysis of an Illumina genome analyzer using the Efficient Large-Scale Alignment of Nucleotide Databases; ELAND software.

[0514] Other sequencing methods can also be used to obtain sequence reads and their alignments. Additional suitable methods are described in U.S. Patent Publication No. 2016 / 0319345A1, which is incorporated herein by reference in its entirety.

[0515] In some embodiments of the methods described herein, the sequence read is about 20 bp, about 25 bp, about 30 bp, about 35 bp, about 40 bp, about 45 bp, about 50 bp, about 55 bp, about 60 bp, about 65 bp, about 70 bp, about 75 bp, about 80 bp, about 85 bp, about 90 bp, about 95 bp, about 100 bp, about 110 bp, about 120 bp, about 130 bp, about 140 bp, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 450 bp, or about 500 bp. It is expected that technological advances will enable single-end reads greater than 500 bp, which enables reads greater than about 1000 bp when generating paired-end reads. In some embodiments, paired end reads are used to determine a sequence of interest, which comprises a sequence read of about 20bp to 1000bp, about 50bp to 500bp or 80bp to 150bp. In a plurality of embodiments, paired end reads are used to assess a sequence of interest. The sequence of interest is longer than the read. In some embodiments, the sequence of interest is longer than about 100bp, 500bp, 1000bp or 4000bp. The mapping of sequence reads is achieved by comparing the sequence of the read with the sequence of the reference to determine the chromosome origin of the nucleic acid molecule of sequencing, and specific gene sequence information is not required. A small mismatch degree (0-2 mismatches / read) may be allowed to explain the micro-polymorphisms that may be present in the genome in the reference genome and the mixed sample. In some embodiments, the read matched with the reference sequence is used as an anchor read, and paired with the anchor read but with a reference to a read that cannot match or a poor match is used as an anchored read. In some embodiments, poorly matched reads can have a relatively large percentage of mismatches per read, for example, at least about 5%, at least about 10%, at least about 15%, or at least about 20% mismatches per read.

[0516] Multiple sequence tags (i.e., reads that match a reference sequence) are typically obtained for each sample. In some embodiments, at least about 3 x 10 ... 6 sequence tags, at least about 5x 10 6 sequence tags, at least about 8x 10 6 sequence tags, at least about 10x 10 6 sequence tags, at least about 15x10 6 sequence tags, at least about 20x 10 6 sequence tags, at least about 30x 10 6 sequence tags, at least about 40x 10 6 sequence tags, or at least about 50 x 10 6In some embodiments, all sequence reads are mapped to all regions of the reference genome, providing whole genome reads. In other embodiments, reads are mapped to sequences of interest.

[0517] Device and system for preparing indexed oligonucleotides

[0518] As should be apparent, some embodiments of the present invention adopt the process that works under the control of the instruction and / or data that is stored in one or more computer systems or transmitted by one or more computer systems. Some embodiments also relate to the equipment for performing these operations. The equipment can be specially designed and / or constructed for the desired purpose, or it can be a general-purpose computer that is selectively configured by one or more computer programs and / or data structures that are stored in a computer or otherwise available to a computer. In particular, various general-purpose machines can be used together with the program written according to the teachings herein, or it can be more convenient to construct more specialized equipment to carry out the required method steps. The specific structure of various described machines is shown and described below.

[0519] Certain embodiments also provide functions (e.g., code and processes) for storing any of the results (e.g., query results) or data structures generated as described herein. Such results or data structures are typically stored at least temporarily on a computer-readable medium. The results or data structures may also be output in any of a variety of ways, such as display, printing, etc.

[0520] Examples of tangible computer-readable media suitable for use in the computer program products and computing devices of the present invention include, but are not limited to, magnetic media, such as hard disks, floppy disks, and magnetic tapes; optical media, such as CD-ROM disks; magneto-optical media; semiconductor memory devices (e.g., flash memory) and hardware devices specifically configured to store and execute program instructions, such as read-only memory devices (ASICs) and random access memories (ROMs), and sometimes application-specific integrated circuits (ASICs), programmable logic devices (PLDs), and signal transmission media for transmitting computer-readable instructions, such as local area networks, wide area networks, and the Internet. The data and program instructions provided herein may also be embodied on a carrier wave or other transmission medium (including electronic or optical conductive paths). The data and program instructions of the present invention may also be embodied on a carrier wave or other transmission medium (e.g., optical lines, electrical lines, and / or radio waves).

[0521] Examples of program instructions include low-level code such as produced by a compiler, and high-level code that can be executed by a computer using an interpreter. In addition, program instructions can be machine code, source code, and / or any other code that directly or indirectly controls the operation of a computing machine. The code can specify inputs, outputs, calculations, conditions, branches, iterative loops, etc.

[0522] The analysis of sequencing data and the diagnosis derived therefrom are typically performed using various computer-implemented algorithms and programs. Therefore, some embodiments adopt processes involving data stored in one or more computer systems or other processing systems or transmitted by one or more computer systems or other processing systems. Embodiments disclosed herein also relate to equipment for performing these operations. The equipment can be specially constructed for the desired purpose, or it can be a general-purpose computer (or computer group) selectively activated or reconfigured by a computer program and / or a data structure stored in a computer. In some embodiments, a processor group performs some or all of the listed analysis operations collaboratively (e.g., via a network or cloud computing) and / or in parallel. The processor or processor group for performing the method described herein can be various types of processors or processor groups, including microcontrollers and microprocessors, such as programmable devices (e.g., CPLD and FPGA) and non-programmable devices such as gate array ASICs or general-purpose microprocessors.

[0523] One embodiment provides a system for determining sequences in multiple test samples containing nucleic acids, the system comprising a sequencer for receiving nucleic acid samples and providing nucleic acid sequence information from the samples; a processor; and a machine-readable storage medium having instructions stored thereon, the instructions being executed on the processor to determine the sequences of interest in the test samples by the method described above.

[0524] In some embodiments of any system provided herein, the sequencer is configured to perform next generation sequencing (NGS). In some embodiments, the sequencer is configured to use a reversible dye terminator and use synthetic sequencing to perform large-scale parallel sequencing. In other embodiments, the sequencer is configured to perform connection sequencing. In yet other embodiments, the sequencer is configured to perform single molecule sequencing.

[0525] Another embodiment provides a system comprising a nucleic acid synthesizer, a processor, and a machine-readable storage medium having stored thereon instructions for execution on the processor to prepare sequencing adapters. The instructions include: (a) code for adding to a candidate set of index sequences pairs of color-balanced index sequences randomly selected from a collection of different index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base; (b) code for sorting the remaining index sequences in the collection of index sequences based on a minimum Hamming distance to a member in the candidate set; (c) code for removing any remaining index sequences whose minimum Hamming distance to a member in the candidate set is less than a first criterion value or whose minimum edit distance to a member in the candidate set is less than a second criterion value; (d) code for repeating (a)-(c) to maximize the size of the candidate set; and (e) code for selecting a set of index sequences from the candidate set to be incorporated into an oligonucleotide set configured for multiplexed massively parallel sequencing.

[0526] In some embodiments, the instructions include: (a) code for receiving multiple index reads and multiple target reads of target sequences obtained from target nucleic acids derived from multiple samples, wherein each target read comprises a target sequence obtained from a target nucleic acid of a sample derived from the multiple samples, each index read comprises an index sequence obtained from a target nucleic acid of a sample derived from the multiple samples, the index sequences are selected from a set of index sequences, each target read is associated with at least one index read, each sample in the multiple samples is uniquely associated with one or more index sequences in the set of index sequences, and the Hamming distance between any two index sequences in the set of index sequences is not less than a first standard value, wherein the first standard value is at least 2; (b) code for identifying a subset of target reads associated with the index reads among the multiple target reads, the index reads match at least one index sequence, and the at least one index sequence is uniquely associated with a specific sample in the multiple samples; and (c) code for determining the target sequence of the specific sample based on the identified subset of target reads.

[0527] In addition, some embodiments relate to tangible and / or non-transient computer-readable media or computer program products, which include program instructions and / or data (including data structures) for performing various computer-implemented operations. Examples of computer-readable media include, but are not limited to, semiconductor memory devices, magnetic media such as disk drives, tapes, optical media such as CDs, magneto-optical media, and hardware devices such as read-only memory devices (ROMs) and random access memories (RAMs) that are specifically configured to store and execute program instructions. Computer-readable media can be directly controlled by end users, or the media can be indirectly controlled by end users. Examples of directly controlled media include media located at user facilities and / or media that are not shared with other entities. Examples of indirectly controlled media include media that are indirectly accessible to users via external networks and / or via services that provide shared resources such as "clouds". Examples of program instructions include both machine codes such as those generated by a compiler and files containing high-level codes that can be executed by a computer using an interpreter.

[0528] In various embodiments, the data or information adopted in the disclosed method and apparatus are provided in electronic format. Such data or information can include reads and labels derived from nucleic acid samples, reference sequences (including only or mainly providing polymorphic reference sequences), determinations such as cancer diagnosis determinations, consultations, advice, diagnosis, etc. As used herein, data or other information provided in electronic format can be used for storage on a machine and for transmission between machines. Routinely, data in electronic format are provided in digital form, and can be stored in various data structures, lists, databases, etc. as bits and / or bytes. Data can be embodied electronically, optically, etc.

[0529] One embodiment provides a kind of computer program product, and this computer program product is used to generate the output of the sequence of the DNA fragment of interest in the indication test sample.Computer product can comprise for carrying out any one or more instructions of the method for determining the sequence of interest described above.As explained, computer product can comprise non-transient and / or tangible computer readable medium having computer executable or compilable logic (for example, instruction) recorded thereon, for enabling the processor to determine the sequence of interest.In an example, computer product comprises computer readable medium having computer executable or compilable logic (for example, instruction) recorded thereon, for enabling the processor to diagnose the condition or determine the nucleic acid sequence of interest.

[0530] It should be understood that for unassisted humans, it is impractical to perform the computational operations of the methods disclosed herein, or even impossible in most cases. For example, without the help of computing equipment, mapping a single 30bp read from a sample to any one of the human chromosomes may require years of effort. Of course, the problem is complex, because reliable determination of low allele frequency mutations typically requires thousands (e.g., at least about 10,000) or even millions of reads to be mapped to one or more chromosomes.

[0531] The method disclosed herein can be performed using a system for determining a sequence of interest in a plurality of test samples. The system may include: (a) a sequencer for receiving nucleic acids from a test sample and providing nucleic acid sequence information from the sample; (b) a processor; and (c) one or more computer-readable storage media having instructions stored thereon, the instructions being used to execute on the processor to determine a sequence of interest in a test sample. In some embodiments, the method is indicated by a computer-readable medium having computer-readable instructions stored thereon, the computer-readable instructions being used to perform a method for determining a sequence of interest. Therefore, one embodiment provides a computer program product comprising a non-transient machine-readable medium storing a program code, the program code causing the computer system to implement a method for determining a sequence of nucleic acid fragments in a plurality of test samples when executed by one or more processors of a computer system.

[0532] In some embodiments, the program code or instruction may also include automatically recording information relevant to the method. Patient medical records may be maintained by, for example, a laboratory, a physician's office, a hospital, a health maintenance organization, an insurance company, or a personal medical record website. In addition, based on the results of the analysis implemented by the processor, the method may also involve prescribing, starting, and / or changing the treatment of a human subject from which a test sample is obtained. This may involve performing one or more additional tests or analyses on additional samples obtained from the subject.

[0533] The disclosed method can also be performed using a computer processing system, which is suitable for or configured to perform a method for determining a sequence of interest. One embodiment provides a computer processing system, which is suitable for or configured to perform a method as described herein. In one embodiment, the device includes a sequencing device, which is suitable for or configured to sequence at least a portion of the nucleic acid molecules in the sample to obtain the type of sequence information described elsewhere herein. The device can also include a component for processing the sample. Such a component is described elsewhere herein.

[0534] Sequence or other data can be directly or indirectly input to computer or be stored on computer readable medium.In one embodiment, computer system is directly connected to sequencing device, and this sequencing device reads and / or analyzes the sequence of nucleic acid from sample.Sequence or other information from such instrument is provided via the interface in computer system.Selectively, the sequence processed by system is provided from sequence storage source such as database or other reservoir.After being available for treatment equipment, memory device or large capacity memory device at least temporarily buffer or store nucleic acid sequence.In addition, memory device can store various chromosomes or genome label count etc.Memory can also store various programs (routine) and / or program (program) for analyzing sequence presented or the data of mapping.Such program (program) / program (routine) can include program etc. for performing statistical analysis.

[0535] In one example, a user provides a sample to a sequencing device. Data is collected and / or analyzed by a sequencing device connected to a computer. Software on a computer allows data collection and / or analysis. Data can be stored, displayed (via a monitor or other similar device), and / or sent to another location. A computer can be connected to the Internet, which is used to transfer data to a handheld device used by a remote user (e.g., a physician, a scientist, or an analyst). It should be understood that data can be stored and / or analyzed before transmission. In some embodiments, raw data is collected and sent to a remote user or to an equipment that analyzes and / or stores data. Transmission can occur via the Internet, but can also occur via satellite or other connections. Alternatively, data can be stored on a computer-readable medium, and the medium can be shipped to an end user (e.g., via mail). Remote users can be in the same or different geographical locations, including but not limited to buildings, cities, states, countries, or continents.

[0536] In some embodiments, the method also includes collecting data about multiple polynucleotide sequences (for example, reads, labels and / or reference chromosome sequences), and sending the data to a computer or other computing system. For example, a computer can be connected to laboratory equipment, such as a sample collection device, a nucleotide amplification device, a nucleotide sequencing device or a hybridization device. Then, the computer can collect applicable data collected by a laboratory device. Data can be stored on a computer in any step, for example, when collected in real time, before sending, during sending or in conjunction with sending or after sending. Data can be stored on a computer-readable medium that can be extracted from a computer. The collected or stored data can be transferred from a computer to a remote location, for example, via a local area network or a wide area network such as the Internet. At a remote location, various operations can be performed on the data transmitted, as described below.

[0537] Among the types of data in electronic format that may be stored, transmitted, analyzed, and / or manipulated in the systems, devices, and methods disclosed herein are the following:

[0538] a) Reads obtained by sequencing nucleic acids in a test sample

[0539] b) Tags obtained by aligning the reads to a reference genome or one or more other reference sequences

[0540] c) Reference genome or sequence

[0541] d) Thresholds used to judge test samples as affected, unaffected, or no judgment

[0542] e) Actual determination of the medical condition associated with the sequence of interest

[0543] f) Diagnosis (clinical condition associated with the decision)

[0544] g) Recommendations for further testing resulting from diagnostic and / or

[0545] h) Treatment and / or monitoring plans derived from the diagnosis and / or assessment

[0546] These different types of data can be obtained, stored, transmitted, analyzed and / or manipulated at one or more locations using different equipment. Processing options span a wide spectrum. At one end of the spectrum, all or many of the information are stored and used at a location (e.g., a doctor's office or other clinical environment) where the test sample is processed. In other extreme cases, a sample is obtained at one location, processed and optionally sequenced at different locations, reads are compared and determined at one or more different locations, and a diagnosis, suggestion and / or plan are prepared at still another location (which may be the location where the sample is obtained).

[0547] In various embodiments, reads are generated by a sequencing device and then transmitted to a remote site where the reads are processed to determine the sequence of interest. As an example, at the remote location, the reads are aligned to a reference sequence to generate anchor reads and anchored reads. Among the processing operations that may be employed at different locations are the following operations:

[0548] a) Sample collection

[0549] b) Sample processing before sequencing

[0550] c) Sequencing

[0551] d) Analyze sequence data and obtain medical judgment

[0552] e) Diagnosis

[0553] f) Reporting the diagnosis and / or determination to the patient or healthcare provider

[0554] g) Develop plans for further treatment, testing and / or monitoring

[0555] h) Execution plan

[0556] i) Consultation

[0557] Any one or more of these operations can be automated, as described elsewhere herein. Typically, sequencing and analysis of sequence data and obtaining a medical decision will be performed computationally. Other operations can be performed manually or automatically.

[0558] Figure 6 An embodiment of a decentralized system for generating a determination or diagnosis from a plurality of test samples is shown. Sample collection location 01 is used to obtain test samples. The samples are then provided to processing and sequencing location 03, where the test samples can be processed and sequenced as described above. Location 03 includes equipment for processing samples and equipment for sequencing the processed samples. As described elsewhere herein, the result of sequencing is a collection of reads, which are typically provided in an electronic format and provided to a network such as the Internet, which is transmitted by Figure 6 Indicated by the reference numeral 05 in the figure.

[0559] The sequence data is provided to a remote location 07 where analysis and decision generation is performed. The location may include one or more powerful computing devices such as computers or processors. After the computing resources at location 07 have completed their analysis and generated a decision from the received sequence information, the decision is transmitted back to the network 05. In some embodiments, not only a decision is generated at location 07, but also an associated diagnosis. The decision and / or diagnosis is then transmitted over the network and transmitted back to the sample collection location 01, such as Figure 6 As illustrated in . As explained, this is just one of many variations on how the various operations associated with generating a determination or diagnosis are divided among various locations. One common variation involves providing sample collection, as well as processing and sequencing at a single location. Another variation involves providing processing and sequencing at the same location as analysis and determination generation.

[0560] Figure 7A typical computer system is illustrated in a simple module format, which can be used as a computing device according to certain embodiments when properly configured or designed. Computer system 2000 includes any number of processors 2002 (also referred to as central processing units or CPUs), which are connected to memory devices, including main memory 2006 (typically random access memory or RAM), main memory 2004 (typically read-only memory or ROM). CPU 2002 can be of various types, including microcontrollers and microprocessors, such as programmable devices (e.g., CPLD and FPGA) and non-programmable devices such as gate array ASICs or general-purpose microprocessors. In the depicted embodiment, main memory 2004 is used to transfer data and instructions unidirectionally to CPU, and main memory 2006 is typically used to transfer data and instructions in a bidirectional manner. The two main memory devices can include any suitable computer-readable media, such as the computer-readable media described above. Mass storage device 2008 is also bidirectionally connected to main memory 2006, and provides additional data storage capacity, and can include any of the computer-readable media described above. The mass storage device 2008 may be used to store programs, data, etc., and is typically a secondary storage medium such as a hard disk. Such programs, data, etc. are often temporarily copied to the main memory 2006 for execution on the CPU 2002. It will be understood that, where appropriate, the information retained in the mass storage device 2008 may be incorporated in a standard manner as part of the main memory 2004. Specific mass storage devices such as CD-ROM 2014 may also transfer data unidirectionally to the CPU or main memory.

[0561] CPU 2002 is also connected to interface 2010, and this interface 2010 is connected to one or more input / output devices, such as nucleic acid sequencer (2020), nucleic acid synthesizer (2022), video monitor, tracking ball, mouse, keyboard, microphone, touch-sensitive display, transducer card reader, magnetic tape or paper tape reader, tablet computer, stylus, voice or handwriting recognition peripheral equipment, USB port or other well-known input device, certainly, such as other computers.Finally, CPU 2002 can optionally use the external connection part generally shown at 2012 to be connected to external device, such as database or computer or telecommunication network.Through such connection part, it is envisioned that in the process of carrying out method steps described herein, CPU can receive information from network, or can output information to network.In some embodiments, nucleic acid sequencer or nucleic acid synthesizer can be connected to CPU 2002 via network connection part 2012 instead of interface 2010 or except via interface 2010 via network connection part 2012, communication ground.

[0562] In one embodiment, a system such as computer system 2000 is used as a data import, data association, and query system capable of performing some or all of the tasks described herein. Information and programs including data files can be provided via network connection 2012 for access or download by a researcher. Alternatively, such information, programs, and files can be provided to the researcher on a memory device.

[0563] In a specific embodiment, the computer system 2000 is directly connected to a data acquisition system such as a microarray, a high throughput screening system, or a nucleic acid sequencer (2020) that captures data from a sample. Data from such a system is provided via an interface 2010 for analysis by the system 2000. Alternatively, data processed by the system 2000 is provided from a data storage source such as a database or other repository of related data. Once in the device 2000, a memory device such as a main memory 2006 or a mass storage device 2008 buffers or stores the related data at least temporarily. The memory can also store various routines and / or programs for importing, analyzing, and presenting data, including selecting and / or verifying index sequences, codes for determining sequence reads, and correcting errors in reads, etc.

[0564] In certain embodiments, the computer used herein may include a user terminal, which may be any type of computer (e.g., a desktop computer, a laptop computer, a tablet computer, etc.), a media computing platform (e.g., a cable, satellite TV set-top box, a digital video recorder, etc.), a handheld computing device (e.g., a PDA, an email client, etc.), a mobile phone, or any other type of computing or communication platform.

[0565] In certain embodiments, the computer used herein may also include a server system communicated with a user terminal, and the server system may include a server device or a decentralized server device, and may include a mainframe computer, a minicomputer, a supercomputer, a personal computer or a combination thereof. A plurality of server systems may also be used without departing from the scope of the present invention. The user terminal and the server system may communicate with each other through a network. The network may include, for example, a wired network such as a LAN (local area network), a WAN (wide area network), a MAN (metropolitan area network), an ISDN (integrated services digital network), etc., and wireless networks such as wireless LAN, CDMA, Bluetooth and satellite communication networks, etc., without limiting the scope of the present invention.

[0566] The present disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics of the present disclosure. The described embodiments should be considered in all respects to be merely illustrative and not restrictive. Therefore, the scope of the present disclosure is indicated by the appended claims rather than by the foregoing description. All changes within the meaning and scope of the equivalent forms of the claims are included within the scope of the claims.

[0567] experiment

[0568] Example 1

[0569] Index sequence verification

[0570] Computer simulation experiments were performed to verify the validity and effectiveness of the index sequence according to some embodiments. The index sequence meets the following conditions.

[0571] ●The index sequence does not directly match the 8-mer subsequence (or reverse complement) of the sequencing platform sequencing adapter or primer

[0572] ○SBS491

[0573] ○P7

[0574] ○P5

[0575] ○SBS3

[0576] ●No homopolymers of the four nucleotides appear

[0577] ●G / C content is 2 to 6

[0578] ● Not using the sequences listed in Table 4 (known poor performer)

[0579] ● Design 1: The index sequences are selected from those in Table 1 and Table 2

[0580] ○ No two sequences have a Hamming distance < 4

[0581] ● Design 2: The index sequence is selected from those in Table 3

[0582] ○Hamming distance

[0583] ■ In a given board's I5 sequence or I7 sequence, the Hamming distance between any pairs is ≥5

[0584] ■ In all sequences (I5 and I7) across the entire design, the Hamming distance between any pair is ≥ 4

[0585] ○Edit Distance

[0586] ■ In all sequences across the entire design (I5 and I7), the "edit" distance between any pair is ≥ 3

[0587] The computer simulation experiment generated 1 million randomly varied index sequences with 3 editing operations, and no direct matches were found in the resulting sequences. The experiment generated 1 million randomly varied index sequences with 1 deletion and 1 substitution operation, and no direct matches were found in the resulting sequences.

[0588] The obtained sequence is assigned to the multiwell plate layout, as shown in Figure 4. Find that there is no i5 / i7 pair to appear more than once. Designed pair is color balanced. Triple (triple) (quarter row) is color balanced. Quadruple (quadruple) (half column) is color balanced. Hextuple (hextuple) (half row) is color balanced. Octuple (octuple) (full column) is color balanced. Designed collection (doublet, triplet, quadruple, sextuple, octuple) does not have repeated pair (i.e. they alleviate index jump).

[0589] Experimental results demonstrate that the index sequences and index oligonucleotides provided according to some embodiments can detect and correct errors in index sequence reads, thereby providing more accurate sample indexing in multiplexed massively parallel sequencing.

[0590] Example 2

[0591] 8-mer index set

[0592] This example describes design considerations for an 8-mer index sequence set according to some embodiments, and lists the sequences in the index set.

[0593] This index set supports a larger number of indexes and keeps the index length at 8 bp. Compared with the index design of Example 1, the edit distance threshold is reduced to zero and the Hamming distance threshold is reduced to 3.

[0594] An overview of the design strategy is given below.

[0595] The index sequence has no direct match to an 8-mer subsequence (or reverse complement) of a sequencing platform adapter or primer sequence, e.g.

[0596] ○SBS491

[0597] ○P7

[0598] ○P5

[0599] ○SBS3

[0600] ●No homopolymers of the four nucleotides appear

[0601] ●GC content between 25% and 75% (inclusive)

[0602] ● Not using the sequences listed in Table 4 (known poor performer)

[0603] ●The minimum Hamming distance is 3

[0604] ●The minimum edit distance is 2

[0605] The index is provided as color-balanced pairs. Each pair is labeled with the numbers 2n-1 and 2n, where n is a positive integer.

[0606] A total of 734 sequences were obtained, as listed below. They include all the sequences tested in Example 1 and shown in Table 3.

[0607]

[0608]

[0609]

[0610]

[0611]

[0612]

[0613] Example 3

[0614] 10-mer index set

[0615] This example describes the design considerations for a 10-mer index sequence set according to some embodiments and lists the sequences in the index set. The index set supports a larger number of indexes and keeps the index length at 10 bp. An overview of the design strategy is given below.

[0616] The index sequence has no direct match to a 10-mer subsequence (or reverse complement) of a sequencing platform adapter or primer sequence, e.g.,

[0617] ○SBS491

[0618] ○P7

[0619] ○P5

[0620] ○SBS3

[0621] ●No homopolymers of the four nucleotides appear

[0622] ●GC content between 25% and 75% (inclusive)

[0623] ● Not using the sequences listed in Table 4 (known poor performer)

[0624] ●The minimum Hamming distance is 4

[0625] ●The minimum edit distance is 3

[0626] ●Index is provided as a color-balanced pair

[0627] A total of 1026 10-mer sequences are obtained, and they are combined and displayed in the combined sequence of SEQ ID NO:9. The nth 10-mer sequence includes nucleotides 10(n-1)+1, 10(n-1)+2, 10(n-1)+3, ..., 10(n-1)+10 in SEQ ID NO:9. The (2m-1)th 10-mer and the 2mth 10-mer in SEQ ID NO:9 are color balanced, where m is an integer between 1 and 513. In some embodiments, an index sequence set is obtained. The index sequence set includes 1026 10-mer sequences of SEQID NO:9. In some embodiments, oligonucleotides are generated using index sequences. Oligonucleotides include double-stranded or Y-shaped sequencing adapters. Each strand of each double-stranded or Y-shaped sequencing adapter contains an index sequence corresponding to a 10-mer in SEQ ID NO:9. In other embodiments, the oligonucleotide set includes single-stranded oligonucleotide pairs, such as primer pairs. Each pair of single-stranded oligonucleotides is provided together in a reagent. Each oligonucleotide in a pair comprises an index sequence corresponding to the 10-mer in SEQ ID NO:9.

[0628] Ten subsets are selected from 1026 10-mers in SEQ ID NO:9 as subsets of index sequences. In order to select a subset of 10-mers, sequencing is performed using double-stranded sequencing adapters. Each chain of the double-stranded sequencing adapter contains an index sequence from the 1026 sequences in SEQ ID NO:9. Different index sequence pairs are used to generate different sequencing adapters. The sequencing performance of the adapter is measured. Based on the measured sequencing performance, the index sequences are sorted. Using the sorting of the index sequences as a criterion, one or more subsets of 10-mer sequences can be selected from the 1026 sequences.

[0629] In some embodiments, a subset of 96 different pairs of index sequences with the highest sequencing performance is selected. In one embodiment, each of the 96 index sequence pairs comprises the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11.

[0630] The 10-mers in each of the ten subsets are combined and shown in a combined sequence. The ten subsets correspond to ten combined sequences, respectively: SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. The n-th 10-mer sequence in the combined sequence includes nucleotides 10(n-1)+1, 10(n-1)+2, 10(n-1)+3, ..., 10(n-1)+10. The (2m-1)-th 10-mer and the 2m-th 10-mer in SEQ ID NO: 10 to SEQ ID NO: 19 are color balanced, where m is a positive integer. Each 10-mer is different from any other 10-mer in the subset. Each 10-mer in any one of the five subsets (corresponding to SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, and SEQ ID NO: 18) is different from all other 10-mers in any one of the five subsets. Each 10-mer in any one of the other five subsets (corresponding to SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, and SEQ ID NO: 19) is different from all other 10-mers in any one of the other five subsets.

[0631] In some embodiments, each Y-shaped or double-stranded sequencing adapter comprises a first strand comprising a first index sequence selected from a first subset of a set of index sequences and a second strand comprising a second index sequence selected from a second subset of a set of index sequences (or the reverse complement of the second subset). In some embodiments, each pair of oligonucleotides (e.g., primers) comprises a first oligonucleotide comprising a first index sequence selected from a first subset of a set of index sequences and a second oligonucleotide comprising a second index sequence selected from a second subset of a set of index sequences (or the reverse complement of the second subset).

[0632] In some embodiments, the first index sequence and the second index sequence are, respectively: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 (or its reverse complement); the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 (or its reverse complement); the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 (or its reverse complement); the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 (or its reverse complement); the nth 10-mer in SEQ ID NO:18 and the nth 10-mer in SEQ ID NO:19 (or its reverse complement).

[0633] In some embodiments, the first index sequence and the second index sequence are contained in oligonucleotides that are provided in a reaction compartment of a container comprising a plurality of separate compartments. Each compartment comprises (a) a first plurality of oligonucleotides comprising the first index sequence and (b) a second plurality of oligonucleotides comprising the second index sequence, and the ordered combination of (a) and (b) in a compartment is different from the ordered combination of (a) and (b) in any other compartment.

[0634] In some embodiments, the container comprises a multiwell plate. In some embodiments, the container comprises 8x12 compartments. Where the compartments are labeled as rows AH and columns 1-12, they may be listed as A1, A2, A3, ..., A12, B1, B2, ..., B12, ..., H1, H2, ..., H12. In some embodiments, in the nth compartment on the list, the first index sequence and the second index sequence are: the nth 10-mer in SEQ ID NO:10 and the nth 10-mer in SEQ ID NO:11 (or its reverse complement); the nth 10-mer in SEQ ID NO:12 and the nth 10-mer in SEQ ID NO:13 (or its reverse complement); the nth 10-mer in SEQ ID NO:14 and the nth 10-mer in SEQ ID NO:15 (or its reverse complement); or the nth 10-mer in SEQ ID NO:16 and the nth 10-mer in SEQ ID NO:17 (or its reverse complement).

Claims

1. An oligonucleotide set, the oligonucleotide set comprising a plurality of subsets of oligonucleotides, wherein: The oligonucleotide set is configured to identify the source of nucleic acid samples in multiplex massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules; Each oligonucleotide in the oligonucleotide set comprises an index sequence; The set of oligonucleotides comprises a set of index sequences, the set of index sequences comprises at least 6 different index sequences, each of the plurality of subsets of oligonucleotides comprises a plurality of index sequences of the set of index sequences; and The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) adenine (A) bases or cytosine (C) bases, and (ii) guanine (G) bases, thymine (T) bases or uracil (U) bases.

2. The oligonucleotide set of claim 1, wherein the Hamming distance between any two index sequences in the index sequence set is no less than a first standard value, wherein the first standard value is at least 2.

3. The oligonucleotide set of claim 1 , wherein the oligonucleotide set comprises (a) double-stranded or Y-shaped sequencing adapters, each strand of each double-stranded or Y-shaped sequencing adapter comprising an index sequence of the index sequence set or its reverse complement; or (b) single-stranded oligonucleotide pairs, each pair being provided together in a reagent, each oligonucleotide in a pair comprising an index sequence of the index sequence set or its reverse complement.

4. The set of oligonucleotides of claim 3, wherein (a) each Y-shaped or double-stranded sequencing adapter comprises a first strand and a second strand, wherein the first strand comprises a first index sequence selected from a first subset of the set of index sequences, and the second strand comprises a second index sequence selected from a second subset of the set of index sequences (or the reverse complement of the second subset); or (b) each pair of oligonucleotides comprises a first oligonucleotide and a second oligonucleotide, wherein the first oligonucleotide comprises a first index sequence selected from a first subset of the set of index sequences, and the second oligonucleotide comprises a second index sequence selected from a second subset of the set of index sequences (or the reverse complement of the second subset).

5. The oligonucleotide set of claim 4, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

6. The set of oligonucleotides of claim 4, wherein the first subset comprises the subset listed in Table 1 and the second subset comprises the subset listed in Table 2.

7. The set of oligonucleotides of claim 1, wherein each of the plurality of subsets of oligonucleotides comprises an index sequence corresponding to the reverse complement of a 10-mer of one of the following sequences: SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO:

19.

8. The set of oligonucleotides of claim 4, wherein the first subset and the second subset are identical.

9. The oligonucleotide set of claim 8, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site, and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.

10. The set of oligonucleotides of claim 8, wherein the subset is selected from one of the subsets of index sequences in Table 3.

11. The oligonucleotide set of claim 1, wherein the index sequence set comprises the 10-mer in SEQ ID NO:

9.

12. The set of oligonucleotides of claim 1, wherein each of the plurality of subsets of oligonucleotides comprises an index sequence corresponding to a 10-mer of one of the following sequences: SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO:

19.

13. The oligonucleotide set of claim 1, wherein the oligonucleotide set is provided in a container comprising a plurality of separate compartments.

14. The oligonucleotide set of claim 13, wherein each compartment comprises a plurality of oligonucleotides comprising one index sequence from the index sequence set, the one index sequence being different from the index sequences contained in the other compartments.

15. The oligonucleotide set of claim 13, wherein each compartment comprises (a) a first plurality of oligonucleotides comprising a first index sequence in the index sequence set and (b) a second plurality of oligonucleotides comprising a second index sequence in the index sequence set, the ordered combination of (a) and (b) in the compartment being different from the ordered combination of (a) and (b) in any other compartment.

16. An oligonucleotide set, the oligonucleotide set consisting essentially of a plurality of subsets of oligonucleotides, wherein: The oligonucleotide set is configured to identify the source of nucleic acid samples in multiplex massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules; Each oligonucleotide in the oligonucleotide set comprises an index sequence; The set of oligonucleotides comprises a set of index sequences, the set of index sequences comprises at least 6 different index sequences, each of the plurality of subsets of oligonucleotides comprises a plurality of index sequences of the set of index sequences; and The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) adenine (A) bases or cytosine (C) bases, and (ii) guanine (G) bases, thymine (T) bases or uracil (U) bases.

17. The oligonucleotide set of claim 16, wherein the Hamming distance between any two index sequences in the index sequence set is no less than a first standard value, wherein the first standard value is at least 2.

18. A method for preparing a plurality of oligonucleotides for multiplex massively parallel sequencing, the method comprising: (a) selecting a set of index sequences from a collection of different index sequences, where The index sequence set includes at least 6 different sequences; as well as The index sequence set comprises a plurality of pairs of color-balanced index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences include both of: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base; as well as (b) synthesizing the plurality of oligonucleotides comprising the set of index sequences.

19. The method of claim 18, wherein the Hamming distance between any two index sequences in the index sequence set is not less than a first standard value, wherein the first standard value is at least 2.

20. The method of claim 18, wherein step (a) comprises: (i) selecting a candidate set of index sequences from the collection of index sequences; (ii) separating the selected candidate set into a plurality of groups of color-balanced index sequence pairs; and (iii) Using a bipartite graph matching algorithm, each group is divided into two subgroups of color-balanced pairs, where each color-balanced pair is a node in the bipartite graph.

Images