Modified nucleoside analogs and uses thereof, and double-stranded oligonucleotides containing nucleotide analogs and uses thereof

Abstract

The invention relates to a nucleoside analogue and application thereof. The nucleoside analogue is a compound as shown in a formula (Ia) or a prodrug thereof. The nucleoside analogue can improve the targeted delivery effect of an oligonucleotide drug on nervous system cells, so that the inhibition rate of the targeted delivery oligonucleotide drug on specific gene expression in the nervous system cells is improved; or the purpose of preventing and / or treating pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells can be achieved by the targeted delivery oligonucleotide medicine. The present disclosure also relates to a double-stranded oligonucleotide comprising a nucleotide analogue and a use thereof, the double-stranded oligonucleotide comprising a sense strand and an antisense strand, each strand having 17-25 modified and / or unmodified nucleotides, the antisense strand being complementary to the sense strand to form a duplex region; the positive-sense strand and / or the antisense strand comprises at least one nucleotide analogue as shown in a formula (100) structure, or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof; the double-stranded oligonucleotide can effectively treat and / or prevent pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells. # imgabs0 #

Description

Modified nucleoside analogs and their uses, and double-stranded oligonucleotides containing nucleotide analogs and their uses

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202310540505.6, filed with the State Intellectual Property Office of China on May 12, 2023, and entitled “Modified nucleoside analogs and their uses”, and Chinese patent application No. 202311644617.2, filed with the State Intellectual Property Office of China on December 4, 2023, and entitled “Double-stranded oligonucleotides containing nucleotide analogs and their uses”, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present disclosure belongs to the field of biopharmaceutical technology. Specifically, the present disclosure relates to a modified nucleoside analog and its use, as well as an oligonucleotide containing a nucleotide analog and its use. More specifically, the present disclosure relates to a nucleoside analog, a double-stranded oligonucleotide, a composition and its use, a method for inhibiting the expression of specific genes in nervous system cells, and a method for preventing and / or treating diseases caused by inhibiting the abnormal expression of specific genes in nervous system cells. Background Art

[0004] RNA interference (RNAi) refers to the phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA), which is highly conserved in the process of evolution. Currently, RNAi agents containing oligonucleotides can be delivered to cells in the body to treat diseases caused by abnormal expression of specific genes in cells. For the treatment of liver-related disorders, oligonucleotides in RNAi agents can be targeted and delivered to liver cells to exert therapeutic effects, which has good application prospects; however, for the treatment of extrahepatic tissue diseases, the oligonucleotides in RNAi agents are less effective in targeted delivery to extrahepatic cells. At present, it is difficult to effectively target and deliver oligonucleotides to the central nervous system (CNS) for the treatment of diseases. This is because free oligonucleotides cannot cross the blood-brain barrier (BBB). One feasible way is to deliver oligonucleotides to the CNS through intrathecal delivery. However, the use of liposomes to form complexes cannot effectively deliver oligonucleotides to target cells in the CNS, resulting in the inability of oligonucleotides to achieve therapeutic effects in nervous system cells.

[0005] Therefore, there is an urgent need to develop a new drug or method that can deliver RNAi agents containing oligonucleotides to cells of the nervous system in a targeted manner.

[0006] Summary of the Invention

[0007] The present disclosure aims to, at least to some extent, address at least one of the technical problems existing in the prior art. To this end, the present disclosure provides a nucleoside analog that can enhance the targeted delivery of an oligonucleotide drug to nervous system cells, thereby increasing the inhibition rate of the targeted oligonucleotide drug on the expression of specific genes in nervous system cells, or enabling the targeted oligonucleotide drug to prevent and / or treat diseases caused by the inhibition of abnormal expression of specific genes in nervous system cells.

[0008] The present disclosure also provides nucleotide analogs, double-stranded oligonucleotides containing the nucleotide analogs, and their uses. By introducing nucleotide analogs into double-stranded oligonucleotides, the modified oligonucleotide molecules can enhance the targeted delivery of oligonucleotide drugs to nervous system cells, and can be used to treat and / or prevent pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells.

[0009] In the first aspect of the present disclosure, the present disclosure provides a nucleoside analog, which is a compound represented by formula (Ia) or a prodrug thereof:

[0010] wherein R1 is selected from H or a hydroxyl protecting group;

[0011] R2 is selected from H or a phosphorus-containing leaving group;

[0012] B is selected from a substituted or unsubstituted nucleoside base, or a substituted or unsubstituted nucleoside base analog, each substituent in B is independently selected from halogen, C1-C3 alkyl, C1-C3 alkyloxy, or substituted iminoyl; if there is an amino group in B, the amino group is protected with an amino protecting group;

[0013] X is selected from O, S, NH or -NH-C(=O)-;

[0014] L is selected from substituted or unsubstituted C4-C 12 Hydrocarbyl, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0015] p and q are each independently selected from 1, 2, 3 or 4;

[0016] n is selected from 1, 2 or 3.

[0017] In the second aspect of the present disclosure, the present disclosure provides a nucleoside analogue, which is a compound represented by formula (Ib), formula (Ic) or formula (Id) or a prodrug thereof:

[0018] wherein R1 is selected from H or a hydroxyl protecting group;

[0019] R2 is selected from H or a phosphorus-containing leaving group;

[0020] B' is selected from a substituted or unsubstituted nucleoside base or a substituted or unsubstituted nucleoside base analog; each substituent in B' is independently a halogen, a C1-C3 alkyl group, a C1-C3 alkyloxy group, or a substituted iminoyl group; if an amino group exists in B', the amino group is not protected;

[0021] X is selected from O, S, NH or -NH-C(=O)-;

[0022] L is selected from substituted or unsubstituted C4-C 12 Hydrocarbyl, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0023] p and q are each independently selected from 1, 2, 3 or 4;

[0024] n is selected from 1, 2 or 3.

[0025] In the third aspect of the present disclosure, the present disclosure proposes use of the nucleoside analogue described in the first aspect and / or the nucleoside analogue described in the second aspect in preparing oligonucleotides.

[0026] In the fourth aspect of the present disclosure, the present disclosure provides a double-stranded oligonucleotide, comprising a sense strand and an antisense strand, wherein the antisense strand and the sense strand have a complementary region of at least partial base pairing, and the sense strand and / or the antisense strand contain at least one nucleoside analogue described in the second aspect.

[0027] In a fifth aspect of the present disclosure, a composition is provided. According to an embodiment of the present disclosure, the composition comprises: the double-stranded oligonucleotide described in the fourth aspect.

[0028] In the sixth aspect of the present disclosure, the present disclosure proposes the use of the nucleoside analogue described in the first aspect, the nucleoside analogue described in the second aspect, the double-stranded oligonucleotide described in the fourth aspect, or the composition described in the fifth aspect in the preparation of a drug for treating and / or preventing pathological conditions or diseases caused by abnormal expression of specific genes in target cells.

[0029] In the seventh aspect of the present disclosure, the present disclosure provides a method for inhibiting the expression of a specific gene in a target cell, the method comprising: contacting the double-stranded oligonucleotide described in the fourth aspect or the composition described in the fifth aspect with the target cell.

[0030] In the eighth aspect of the present disclosure, the present disclosure proposes a method for preventing and / or treating pathological conditions or diseases caused by abnormal expression of specific genes in target cells, the method comprising: administering to a subject a pharmaceutically acceptable dose of the double-stranded oligonucleotide described in the fourth aspect or the composition described in the fifth aspect.

[0031] In a ninth aspect of the present disclosure, the present disclosure provides a nucleotide analogue as shown in formula (100), or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0032] in, represents the covalent bonding site of the nucleotide analog;

[0033] B is selected from an unsubstituted or substituted nucleoside base, or an unsubstituted or substituted nucleoside base analog; if B contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl, C1-C3 alkyloxy, or iminoyl;

[0034] L' is selected from substituted or unsubstituted C 16 -C 24 If the L 'contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0035] p is selected from 1, 2, 3 or 4;

[0036] q is selected from 1, 2, 3 or 4;

[0037] n is selected from 1, 2 or 3;

[0038] Z is selected from hydroxyl or mercapto.

[0039] In the tenth aspect of the present disclosure, the present disclosure provides a double-stranded oligonucleotide, comprising a sense strand and an antisense strand, each strand having 17-25 modified and / or unmodified nucleotides, the antisense strand being complementary to the sense strand to form a duplex region; the sense strand and / or the antisense strand comprising at least one nucleotide analogue according to the ninth aspect of the present disclosure, or a tautomer, a stereoisomer, or a pharmaceutically acceptable salt thereof:

[0040] in, represents the covalent bond site between the nucleotide analog and the adjacent nucleotide;

[0041] B is selected from unsubstituted or substituted nucleoside bases, or unsubstituted or substituted nucleoside base analogs; if B contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl, C1-C3 alkyloxy, or iminoyl;

[0042] L' is selected from substituted or unsubstituted C 16 -C 24 If the L 'contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0043] p is selected from 1, 2, 3 or 4;

[0044] q is selected from 1, 2, 3 or 4;

[0045] n is selected from 1, 2 or 3;

[0046] Z is selected from hydroxyl or mercapto.

[0047] In some embodiments of the present disclosure, the sense strand comprises one of the nucleotide analogs.

[0048] In some embodiments of the present disclosure, the nucleoside analog is located at positions 2 to 8 of the sense strand starting from the 5' end.

[0049] In some embodiments of the present disclosure, the antisense strand does not comprise the nucleotide analog, and the antisense strand is substantially reverse complementary, essentially reverse complementary, or completely reverse complementary to a nucleotide sequence in the mRNA expressed by the target gene.

[0050] In some optional embodiments of the present disclosure, the other nucleotides in the double-stranded oligonucleotide except the nucleotides replaced by the nucleotide analogs are modified, and each is independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides and 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides.

[0051] In the eleventh aspect of the present disclosure, the present disclosure further provides a composition comprising the double-stranded oligonucleotide according to the tenth aspect of the present disclosure.

[0052] In the twelfth aspect of the present disclosure, the present disclosure also provides the use of the nucleotide analogs described in the ninth aspect of the present disclosure, and / or the double-stranded oligonucleotides described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure in the preparation of drugs for treating and / or preventing pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells.

[0053] In the thirteenth aspect of the present disclosure, the present disclosure further provides a pharmaceutical composition, which comprises the double-stranded oligonucleotide described in the tenth aspect of the present disclosure and / or the composition described in the eleventh aspect of the present disclosure.

[0054] In some embodiments of the present disclosure, the composition further comprises, optionally, one or more pharmaceutically acceptable carriers or excipients.

[0055] In the fourteenth aspect of the present disclosure, the present disclosure further provides a drug, which includes the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure.

[0056] In the fifteenth aspect of the present disclosure, the present disclosure also provides a method for reducing gene expression in target cells, the method comprising: contacting the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure with the target cells.

[0057] In the sixteenth aspect of the present disclosure, the present disclosure also provides a method for reducing the expression of a target gene in a subject, the method comprising: administering to the subject the nucleotide analogue described in the ninth aspect of the present disclosure, and / or the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure.

[0058] In the seventeenth aspect of the present disclosure, the present disclosure also provides a method for preventing and / or treating pathological conditions or diseases caused by abnormal expression of specific genes in target cells, the method comprising: administering to a subject a pharmaceutically acceptable dose of the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure.

[0059] In an eighteenth aspect of the present disclosure, the present disclosure further provides a method for treating a subject suffering from a disease or condition related to a CNS disorder, the method comprising:

[0060] A therapeutically effective amount of the double-stranded oligonucleotide according to the tenth aspect of the present disclosure, and / or the composition according to the eleventh aspect of the present disclosure, and / or the pharmaceutical composition according to the thirteenth aspect of the present disclosure, and / or the drug according to the fourteenth aspect of the present disclosure is administered to the subject, thereby treating the CNS disorder-related disease or condition of the subject.

[0061] In the nineteenth aspect of the present disclosure, the present disclosure provides a kit comprising the nucleotide analogs described in the ninth aspect of the present disclosure, and / or the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure.

[0062] The double-stranded oligonucleotides and compositions provided by the present disclosure can effectively treat and / or prevent pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells.

[0063] In the twentieth aspect of the present disclosure, the present disclosure also provides a method for inhibiting target gene expression in skeletal muscle cells, eye cells, cardiomyocytes or fat cells, the method comprising: administering to the subject a therapeutically effective amount of the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure.

[0064] In the twenty-first aspect of the present disclosure, the present disclosure also provides a method for preventing and / or treating diseases or conditions related to skeletal muscle, myocardium, eye or adipose tissue, the method comprising: administering to the subject a therapeutically effective amount of the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure.

[0065] Additional aspects and advantages of the present disclosure will be given in part in the description that follows and, in part, will be obvious from the description that follows, or will be learned through practice of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] The above and / or additional aspects and advantages of the present disclosure will become apparent and readily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0067] FIG1 is a graph showing the relative expression levels of the target gene (SOD1) in different parts of the brain of mice in the RZ899008 group and the PBS group in Test Example 1 of the present disclosure;

[0068] FIG2 is a graph showing the relative expression levels of the target gene (SOD1) in the lumbar vertebrae samples of each group of mice in Test Example 2 of the present disclosure;

[0069] FIG3 is a graph showing the relative expression levels of the target gene (SOD1) in the thoracic vertebrae samples of each group of mice in Test Example 2 of the present disclosure;

[0070] FIG4 is a graph showing the relative expression levels of the target gene (SOD1) in the cerebellum samples of each group of mice in Test Example 2 of the present disclosure;

[0071] FIG5 shows the relative remaining expression levels of target genes in the mouse brain after administration of the siRNA described in Test Example 3;

[0072] FIG6 shows the relative remaining expression levels of the target gene in mice after administration of the siRNA described in Test Example 4;

[0073] Figure 7 shows the relative remaining expression levels of target genes in rats after administration of the siRNA described in Test Example 5.

[0074] FIG8 shows the relative expression levels of target genes in rats after administration of the siRNA conjugates described in Test Example 6;

[0075] FIG9 shows the relative expression levels of target genes in mouse heart tissue after administration of the siRNA conjugates described in Test Example 7;

[0076] FIG10 shows the relative expression levels of target genes in adipose tissue of mice after administration of the siRNA conjugates described in Test Example 7;

[0077] FIG11 shows the relative expression levels of target genes in mouse skeletal muscle tissue after administration of the siRNA conjugate described in Test Example 7;

[0078] FIG12 shows the relative expression levels of target genes in mouse liver tissue after administration of the siRNA conjugate described in Test Example 7;

[0079] FIG13 shows the relative expression levels of target genes in mouse kidney tissue after administration of the siRNA conjugate described in Test Example 7;

[0080] FIG14 shows the relative expression levels of target genes in adipose tissue of mice after administration of the siRNA conjugates described in Test Example 8;

[0081] FIG15 shows the relative expression levels of target genes in mice after administration of the siRNA conjugates described in Test Example 9;

[0082] FIG16 shows the relative expression levels of target genes in mouse heart tissue after administration of the siRNA conjugate described in Test Example 10;

[0083] FIG17 shows the relative expression levels of target genes in adipose tissue of mice after administration of the siRNA conjugates described in Test Example 10;

[0084] FIG18 shows the relative expression levels of target genes in mouse heart tissue after administration of the siRNA conjugate described in Test Example 11;

[0085] FIG19 shows the relative expression levels of target genes in mouse eye tissues after administration of the siRNA conjugates described in Test Example 11;

[0086] FIG20 shows the relative expression levels of target genes in adipose tissue of mice after administration of the siRNA conjugate described in Test Example 12. DETAILED DESCRIPTION

[0087] The embodiments of the present disclosure are described in detail below. The embodiments described below are exemplary and are only used to explain the present disclosure, and should not be understood as limiting the present disclosure.

[0088] Definitions and General Terms

[0089] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of the features. Furthermore, in the description of this disclosure, unless otherwise specified, "plurality" means two or more.

[0090] In the context of the present disclosure, unless otherwise indicated, the "nucleic acid analogs" of the present disclosure may independently exist in the form of salts, mixed salts, or non-salts (e.g., free acids or free bases). When present in the form of salts or mixed salts, they may be pharmaceutically acceptable salts.

[0091] As used herein, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients comprising the nucleic acid analog and / or the mammal to be treated therewith. Preferably, the "pharmaceutically acceptable" herein means approved by federal regulatory agencies or national governments or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopeia for use in animals, particularly humans.

[0092] In the context of the present disclosure, "pharmaceutically acceptable salts" include pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0093] In the context of this disclosure, "pharmaceutically acceptable acid addition salts" refer to salts formed with inorganic or organic acids that retain the biological effectiveness of the free base without other side effects. Inorganic acid salts include, but are not limited to, hydrochlorides, hydrobromides, sulfates, nitrates, phosphates, and the like; organic acid salts include, but are not limited to, formate, acetate, 2,2-dichloroacetate, trifluoroacetate, propionate, hexanoate, octanoate, decanoate, undecylenate, glycolate, gluconate, lactate, sebacate, adipate, glutarate, malonate, oxalate, maleate, succinate, fumarate, tartrate, citrate, palmitate, stearate, oleate, cinnamate, laurate, malate, glutamate, pyroglutamate, aspartate, benzoate, methanesulfonate, benzenesulfonate, p-toluenesulfonate, alginate, ascorbate, salicylate, 4-aminosalicylate, naphthalene disulfonate, and the like. These salts can be prepared by methods known in the art.

[0094] In the context of this disclosure, "pharmaceutically acceptable base addition salts" refer to salts formed with inorganic or organic bases that retain the biological effectiveness of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like. Preferred inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts, and magnesium salts, with sodium salts being preferred. Salts derived from organic bases include, but are not limited to, primary amines, secondary amines, and tertiary amines. Substituted amines include natural substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.

[0095] The term "prodrug" as used in this disclosure refers to a compound that is converted into a compound represented by formula (I) in vivo. Such conversion is affected by the hydrolysis of the prodrug in the blood or by enzyme conversion to the parent structure in the blood or tissue. The prodrug compounds disclosed in this disclosure can be esters. In the prior art, esters that can be used as prodrugs include phenyl esters, aliphatic (C1-C 24) esters, acyloxymethyl esters, carbonates, carbamates, and amino acid esters. For example, a compound of the present disclosure containing a hydroxyl group can be acylated to produce a prodrug form of the compound. Other prodrug forms include phosphate esters, such as these phosphate ester compounds, which are obtained by phosphorylating a hydroxyl group on the parent compound. For a complete discussion of prodrugs, see T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14 of the ACSSymposium Series, Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, J. Rautio et al., Prodrugs: Design and Clinical Applications, Nature Review Drug Discovery, 2008, 7, 255-270, and SJ Hecker et al., Prodrugs of Phosphates and Phosphonates, Journal of Medicinal Chemistry, 2008, 51, 2328-2345.

[0096] In the context of this disclosure, "pharmaceutical composition" may refer to a composition for use in treating a disease or in vitro cell culture experiments. When used in the treatment of a disease, the term "pharmaceutical composition" generally refers to a unit dosage form and can be prepared by any of the methods well known in the pharmaceutical art. All methods include the step of combining the active ingredient with an excipient that constitutes one or more adjunct ingredients. Typically, the composition is prepared by uniformly and thoroughly combining the active siRNA with a liquid excipient, a finely divided solid excipient, or both.

[0097] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present disclosure, but not excluding other contents.

[0098] As used herein, the terms "optionally," "optional," "optionally," "optionally," "optional," or "optional" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0099] The term "optionally substituted" can be used interchangeably with the term "unsubstituted or substituted with...", i.e., the structure is unsubstituted or substituted with one or more substituents described herein, including, but not limited to, D, F, Cl, Br, I, N3, -CN, -NO2, -NH2, -OH, -SH, -COOH, -CONH2, -C(=O)NHCH3, -C(=O)N(CH3)2, -C(=O)-alkyl, -C(=O)-alkoxy, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, alkylthio, alkylamino, hydroxy-substituted alkyl, cyano-substituted alkyl, amino-substituted alkyl, (alkoxy)-alkylene, (alkylamino)-alkylene, (cycloalkyl)-alkylene, (heterocyclyl)-alkylene, (aryl)-alkylene, (heteroaryl)-alkylene, cycloalkyl, heterocyclyl, aryl, heteroaryl, and the like.

[0100] In general, the terms "substituted," "substituted," and "substituted" are used interchangeably to indicate that any one or more hydrogen atoms in a given structure are replaced by a specified substituent (e.g., C 1-3 Alkyl, C 1-3 alkoxy or halogen), provided that the normal valence of the designated atom is not exceeded and the substitution results in a stable compound. Unless otherwise indicated, a substituted group may have a substituent at each substitutable position of the group. When more than one position in a given structural formula can be substituted with one or more substituents selected from a specified group, the substituents may be the same or different at each substitutable position.

[0101] In the context of this disclosure, the terms "each ... is independently selected from" and "... are each independently selected from" and "... are independently selected from" are interchangeable and should be understood in a broad sense. They can mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other. The term "hydrocarbon group" refers to a group formed by removing one or more hydrogen atoms from a hydrocarbon molecule (hydrocarbon compound), including a monovalent saturated group (also known as an alkyl group), a monovalent unsaturated group (also known as an alkenyl group, an alkynyl group), a divalent group (also known as a subgroup), or a trivalent group (also known as a subgroup).

[0102] The term "alkyl" has the general structural formula Alkyl groups may be straight chain or branched chain. For example, the term "C1-C3 alkyl" refers to a chain alkyl group having 1 to 3 carbon atoms; the term "C4-C 12 "Alkyl" refers to a chain alkyl group having 4 to 12 carbon atoms.

[0103] The term "alkylene" has the general structural formula The alkylene group can be a straight chain alkylene group or a branched chain alkylene group. For example, the structural formula of the term "methylene group" is -CH2-.

[0104] The term "alkyloxy" has the general structural formula The alkyl group may be a linear alkyl group or a branched alkyl group.

[0105] The term "alkyl acyl" has the general structural formula The alkyl group may be a linear alkyl group or a branched alkyl group.

[0106] The term "aryl" refers to a monocyclic, bicyclic, and tricyclic carbocyclic ring system containing 5-10 ring atoms, or 6-10 ring atoms, wherein at least one ring system is aromatic and each ring system comprises a ring composed of 3-7 atoms. An aryl group is typically, but not necessarily, attached to the parent molecule via the aromatic ring of the aryl group. The term "aryl" can be used interchangeably with the term "aromatic ring" or "aromatic ring". Aryl groups can include phenyl, indenyl, naphthyl, and anthracenyl. The aryl group is optionally substituted with one or more substituents described herein.

[0107] The term "aryloxy" is -O-aryl, wherein aryl is as that term is defined above.

[0108] The term "arylcarbonyl" is -CO-aryl, wherein the term aryl is as defined above.

[0109] The term "NH" refers to an imino group, which has the formula

[0110] The term "CO" or "C(=O)" refers to a carbonyl group having the formula

[0111] The structural formula of the term "-NH-CO-" or "-NH-C(=O)-" is

[0112] The terms "halogen" and "halo" are used interchangeably in this disclosure to refer to fluorine (F), chlorine (Cl), bromine (Br), or iodine (I).

[0113] The structural formula of the term "trityl" is:

[0114] The structural formula of the term "4-methoxytrityl" is

[0115] The structural formula of the term "4,4'-dimethoxytrityl" is

[0116] The structural formula of the term "4,4',4"-trimethoxytriphenyl" is

[0117] In the context of this disclosure, the term "stereoisomers" refers to compounds that have the same chemical constitution, but differ in the way the atoms or groups are arranged in space. Stereoisomers include enantiomers, diastereomers, conformers (rotamers), geometric isomers (cis / trans) isomers, atropisomers, and the like.

[0118] In the context of this disclosure, the term "chiral" refers to a molecule that has the property of being non-superimposable on its mirror image; whereas "achiral" refers to a molecule that is superimposable on its mirror image.

[0119] In the context of this disclosure, the term "enantiomers" refers to two non-superimposable isomers of a compound that are mirror images of each other.

[0120] In the context of this disclosure, the term "diastereoisomer" refers to stereoisomers that have two or more chiral centers and whose molecules are not mirror images of each other. Diastereoisomers have different physical properties, such as melting points, boiling points, spectral properties, and reactivity. Diastereomeric mixtures can be separated by high-resolution analytical procedures such as electrophoresis and chromatography, for example, HPLC.

[0121] In the context of the present disclosure, the term "ligand" generally refers to any compound or molecule that can be covalently or otherwise chemically bound to a biologically active substance (such as an oligonucleotide). In certain embodiments, a ligand can interact directly or indirectly with another compound, such as a receptor. The receptor that interacts with the ligand can be present on the cell surface, or alternatively can be an intracellular and / or intercellular receptor. The interaction of the ligand with the receptor can result in a biochemical reaction, or can be simply a physical interaction or binding.

[0122] the term The symbol indicates the site where a group is attached via a covalent bond.

[0123] In the chemical structure of the ligand or compound disclosed herein, the bond Indicates that the configuration is not specified. If chiral isomers exist in the chemical structure, the bond Can be or include both and Although all of the above structural formulae are drawn as certain isomers for simplicity, the present disclosure may include all isomers, such as tautomers, rotational isomers, geometric isomers, diastereomers, racemates, and enantiomers.

[0124] In the chemical structure of the ligand or compound disclosed herein, the bond Indicates that the configuration is not specified. If there are cis-trans isomers in the chemical structure, the bond The configuration can be E-type, Z-type, or both E and Z configurations.

[0125] In the context of the present disclosure, unless otherwise stated, "selected from . . . and . . . " of the present disclosure means that at least one of them can be selected.

[0126] In the context of the present disclosure, unless otherwise stated, "for... or..." in the present disclosure means that any one of them can be selected.

[0127] In the context of this disclosure, an "oligonucleotide" is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), typically consisting of 10 to 50 nucleotides. Oligonucleotides can regulate gene expression through a range of processes, including RNA interference, ribonuclease-mediated target degradation, splicing regulation, noncoding RNA inhibition, gene activation, and programmed gene editing.

[0128] In the context of this disclosure, the term "small interfering RNA (siRNA)" is a double-stranded RNA of 17 to 25 nucleotides in length, comprising a sense strand and an antisense strand. siRNA mediates the targeted cleavage of RNA transcripts in the RISC pathway by forming an RNA-induced silencing complex (RISC). Specifically, siRNA directs the specific degradation of mRNA sequences through the known RNA interference (RNAi) process, inhibiting the translation of mRNA into amino acids and proteins.

[0129] In the context of the present disclosure, the term "antisense strand (or guide strand)" includes a region that is substantially complementary to a target sequence. The term "sense strand (or trailing strand)" refers to an iRNA strand that is substantially complementary to the antisense strand. The term "substantially complementary" refers to complete complementarity or at least partial complementarity, for example, the antisense strand is completely complementary to the target sequence or at least partially complementary. In the case of partial complementarity, mismatches can exist in the interior or terminal regions of the molecule, wherein the most tolerated mismatches exist in the terminal regions, for example, within 5, 4, 3 or 2 nucleotides of the 5'- and / or 3' end of the iRNA. It should be noted that "at least partially substantially complementary" between the antisense strand and the mRNA means that the antisense strand has a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest.

[0130] In the context of this disclosure, "antisense oligonucleotides (ASOs)" are single-stranded oligonucleotide molecules, typically consisting of 10 to 50 nucleotides. After entering cells, ASOs bind to their complementary target mRNA through base pairing under the action of RNase H1, inhibiting the expression of the target gene.

[0131] In the context of the present disclosure, the terms "complementary" and "reverse complementary" are used interchangeably and have the meanings known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one chain are paired with bases on the other chain in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). Each base pair includes a purine and a pyrimidine. When adenine on one chain is always paired with thymine (or uracil) on the other chain, and guanine is always paired with cytosine, the two chains are considered to be complementary to each other, and the sequence of the chain can be inferred from the sequence of its complementary chain. Accordingly, "mismatch" means in the art that the bases at corresponding positions in a double-stranded nucleic acid are not paired in a complementary form.

[0132] In the context of the present disclosure, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there is no more than 1 base mismatch between the two nucleotide sequences; and "completely complementary" means that there is no base mismatch between the two nucleotide sequences.

[0133] In the context of the present disclosure, unless otherwise specified, "a region of complementarity having at least partial base pairing" refers to a polynucleotide having a continuous portion of substantial complementarity between two nucleotide chains, for example, complementarity of not less than 3, 5, 10, or 15 nucleotides.

[0134] In the context of the present disclosure, particularly when describing the preparation method of the double-stranded oligonucleotide or composition of the present application, unless otherwise specified, the nucleoside monomer (nucleoside monomer) refers to, according to the type and order of nucleotides in the oligonucleotide or composition to be prepared, the modified or unmodified nucleoside monomer used in phosphoramidite solid phase synthesis. Phosphoramidite solid phase synthesis is a method used in RNA synthesis well known to those skilled in the art. The nucleoside monomers used in the application are all commercially available.

[0135] The term "pharmaceutically acceptable carrier" includes any solvent, drug stabilizer, or combination thereof, which are known to those skilled in the art (e.g., as described in Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329). Except in the case where any conventional carrier is incompatible with the active ingredient, its use in therapeutic or pharmaceutical compositions is encompassed.

[0136] The term "pharmaceutically acceptable excipient" may include any solvent, etc., suitable for the particular intended dosage form. Except to the extent that any conventional excipient is incompatible with the nucleic acid analogs of the present disclosure, such as by producing any adverse biological effects or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition, their use is also contemplated by the present disclosure.

[0137] In the context of the present disclosure, the term "administer" generally refers to introducing the disclosed pharmaceutical formulation into the body of a subject by any introduction or delivery route. Any method known to those skilled in the art for contacting cells, organs or tissues with the drug can be used. The administration may include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous or oral administration. The daily dose may be divided into one, two or more dosages in a suitable form to be administered at one, two or more times during a certain time period.

[0138] As used herein, "treat," "treat," "alleviate," or "amortize" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Here, a therapeutic benefit is achieved by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

[0139] As used herein, "prevent" and "prevent" are used interchangeably. These terms refer to an approach for obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," a double-stranded oligonucleotide or composition can be administered to a subject at risk for a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though a diagnosis of the disease may not have yet been made.

[0140] As used herein, the term "subject" refers to any animal, such as a mammal or marsupial. The subject matter of this application includes, but is not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and any type of poultry.

[0141] As used herein, the term "modulate gene expression" means that the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, is upregulated or downregulated so that the expression, level, or activity is greater or less than that observed in the absence of the modulator. For example, the term "modulate" may mean "inhibit," but the use of the word "modulate" is not limited to this definition.

[0142] In the first aspect of the present disclosure, the present disclosure provides a nucleoside analog, which is a compound represented by formula (Ia) or a prodrug thereof:

[0143] wherein R1 is selected from H or a hydroxyl protecting group;

[0144] R2 is selected from H or a phosphorus-containing leaving group;

[0145] B is selected from a substituted or unsubstituted nucleoside base, or a substituted or unsubstituted nucleoside base analog, each substituent in B is independently selected from halogen, C1-C3 alkyl, C1-C3 alkyloxy, or substituted iminoyl; if there is an amino group in B, the amino group is protected with an amino protecting group;

[0146] X is selected from O, S, NH or -NH-C(=O)-;

[0147] L is selected from substituted or unsubstituted C4-C 12 Hydrocarbyl, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0148] p and q are each independently selected from 1, 2, 3 or 4;

[0149] n is selected from 1, 2 or 3.

[0150] In the present disclosure, the structural formula of the substituted iminoyl group is Among them, R can be selected from wait.

[0151] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Hydrocarbon, substituted or unsubstituted C4-C 11 Hydrocarbon, substituted or unsubstituted C4-C 10 Hydrocarbon, substituted or unsubstituted C5-C 12 Hydrocarbon, substituted or unsubstituted C5-C 11 Hydrocarbon, substituted or unsubstituted C5-C 10 Hydrocarbon, substituted or unsubstituted C6-C 12 Hydrocarbon, substituted or unsubstituted C6-C11 Hydrocarbon, substituted or unsubstituted C6-C 10 Hydrocarbon, substituted or unsubstituted C7-C 12 Hydrocarbon, substituted or unsubstituted C7-C 11 Hydrocarbon, substituted or unsubstituted C7-C 10 Hydrocarbon, substituted or unsubstituted C8-C 12 Hydrocarbon, substituted or unsubstituted C8-C 11 Hydrocarbon, substituted or unsubstituted C8-C 10 Hydrocarbon, substituted or unsubstituted C9-C 12 Hydrocarbon, substituted or unsubstituted C9-C 11 Hydrocarbon, or substituted or unsubstituted C9-C 10 each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0152] According to an embodiment of the present disclosure, L is selected from substituted or unsubstituted linear or branched C4-C 12 Alkenyl, or substituted or unsubstituted linear or branched C4-C 12 Alkyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0153] According to an embodiment of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkyl or substituted or unsubstituted C4-C 12 Straight-chain alkenyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0154] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkyl, substituted or unsubstituted C4-C 11 Straight chain alkyl, substituted or unsubstituted C4-C 10 Straight chain alkyl, substituted or unsubstituted C5-C 12 Straight chain alkyl, substituted or unsubstituted C5-C 11 Straight chain alkyl, substituted or unsubstituted C5-C 10 Straight chain alkyl, substituted or unsubstituted C6-C 12 Straight chain alkyl, substituted or unsubstituted C6-C 11 Straight chain alkyl, substituted or unsubstituted C6-C 10 Straight chain alkyl, substituted or unsubstituted C7-C 12 Straight chain alkyl, substituted or unsubstituted C7-C 11 Straight chain alkyl, substituted or unsubstituted C7-C 10Straight chain alkyl, substituted or unsubstituted C8-C 12 Straight chain alkyl, substituted or unsubstituted C8-C 11 Straight chain alkyl, substituted or unsubstituted C8-C 10 Straight chain alkyl, substituted or unsubstituted C9-C 12 Straight chain alkyl, substituted or unsubstituted C9-C 11 Straight chain alkyl or substituted or unsubstituted C9-C 10 Straight-chain alkyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0155] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkenyl, substituted or unsubstituted C4-C 11 Straight chain alkenyl, substituted or unsubstituted C4-C 10 Straight chain alkenyl, substituted or unsubstituted C5-C 12 Straight chain alkenyl, substituted or unsubstituted C5-C 11 Straight chain alkenyl, substituted or unsubstituted C5-C 10 Straight chain alkenyl, substituted or unsubstituted C6-C 12 Straight chain alkenyl, substituted or unsubstituted C6-C 11 Straight chain alkenyl, substituted or unsubstituted C6-C 10 Straight chain alkenyl, substituted or unsubstituted C7-C 12 Straight chain alkenyl, substituted or unsubstituted C7-C 11 Straight chain alkenyl, substituted or unsubstituted C7-C 10 Straight chain alkenyl, substituted or unsubstituted C8-C 12 Straight chain alkenyl, substituted or unsubstituted C8-C 11 Straight chain alkenyl, substituted or unsubstituted C8-C 10 Straight chain alkenyl, substituted or unsubstituted C9-C 12 Straight chain alkenyl, substituted or unsubstituted C9-C 11 Straight chain alkenyl, or substituted or unsubstituted C9-C 10 Straight-chain alkenyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0156] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted linear or branched C4-C 12 Alkenyl, or substituted or unsubstituted linear or branched C4-C 12 Alkyl, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy.

[0157] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkyl, or substituted or unsubstituted C4-C 12 In a straight-chain alkenyl group, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0158] In some optional embodiments of the present disclosure, L is selected from C4-C 12 Straight chain alkyl or C4-C 12 Straight chain alkenyl.

[0159] In some optional embodiments of the present disclosure, L is selected from C9-C 12 Straight chain alkyl or C9-C 12 Straight chain alkenyl.

[0160] In some optional embodiments of the present disclosure, L is selected from C9-C 10 Straight chain alkyl or C 12 Straight chain alkenyl.

[0161] According to an embodiment of the present disclosure, L is selected from any of the following structures:

[0162] According to an embodiment of the present disclosure, L is selected from

[0163] According to an embodiment of the present disclosure, L is selected from

[0164] According to an embodiment of the present disclosure, L is selected from

[0165] According to an embodiment of the present disclosure, X is selected from O or -NH-C(=O)-.

[0166] According to an embodiment of the present disclosure, X is selected from O.

[0167] According to an embodiment of the present disclosure, X is selected from -NH-C(=O)-.

[0168] According to an embodiment of the present disclosure, X is selected from O, and L is selected from

[0169] According to an embodiment of the present disclosure, X is selected from -NH-C(=O)-, and L is selected from

[0170] According to an embodiment of the present disclosure, X is selected from -NH-C(=O)-, and L is selected from

[0171] According to an embodiment of the present disclosure, n=1.

[0172] In some optional embodiments of the present disclosure, p and q are each independently selected from 1 or 2.

[0173] According to an embodiment of the present disclosure, p=1 and q=1.

[0174] According to an embodiment of the present disclosure, p=1 and q=2.

[0175] According to an embodiment of the present disclosure, p=2 and q=1.

[0176] According to an embodiment of the present disclosure, p=2 and q=2.

[0177] In the present disclosure, "nucleotide" refers to a compound composed of three substances: a base such as a purine base or a pyrimidine base, ribose or deoxyribose, and phosphate; "nucleoside" refers to a compound composed of two substances: a base such as a purine base or a pyrimidine base, and ribose or deoxyribose; "nucleoside base" refers to the base in a nucleoside, such as purine bases (adenine, guanine) and pyrimidine bases (cytosine, uracil, thymine); "nucleoside base analogs" refer to compounds that have similar chemical structures to nucleoside bases.

[0178] In some optional embodiments of the present disclosure, B is selected from a nucleoside base or a nucleoside base analog, and if an amino group exists in B, the amino group is protected with an amino protecting group.

[0179] In some optional embodiments of the present disclosure, the nucleoside base is selected from cytosine, adenine, guanine, thymine, or uracil.

[0180] In some optional embodiments of the present disclosure, the nucleoside base analog is selected from hypoxanthine 9-yl, purine 9-yl, 2-aminopurine 9-yl, 2,4-difluoro 5-methylphenyl, 5-nitroindole 1-yl, 3-nitropyrrol 1-yl, 4-fluoro 6-methylbenzimidazole 1-yl, or 4-methylbenzimidazole 1-yl.

[0181] In some optional embodiments of the present disclosure, the amino protecting group is selected from an alkoxycarbonyl amino protecting group, an acyl amino protecting group or an alkyl amino protecting group.

[0182] In some optional embodiments of the present disclosure, the alkoxycarbonyl amino protecting groups include but are not limited to: benzyloxycarbonyl (Cbz), tert-butyloxycarbonyl (Boc), methyloxycarbonyl (Fmoc), allyloxycarbonyl (Alloc), trimethylsilylethoxycarbonyl (Teoc), methyl (or ethyl)oxycarbonyl, etc.

[0183] In some optional embodiments of the present disclosure, the acyl amino protecting groups include but are not limited to: phthaloyl (Pht), p-toluenesulfonyl (Tos), trifluoroacetyl (Tfa), o-(or p-)nitrobenzenesulfonyl (Ns), pivaloyl (Piv), acetyl (Ac), benzoyl (Bz), etc.

[0184] In some optional embodiments of the present disclosure, the alkyl amino protecting group includes but is not limited to: trityl (Trt), 2,4-dimethoxybenzyl (Dmb), p-methoxybenzyl (PMB), benzyl (Bn), etc.

[0185] According to an embodiment of the present disclosure, the amino protecting group is selected from the acyl amino protecting group.

[0186] According to an embodiment of the present disclosure, the amino protecting group is selected from benzoyl

[0187] In some optional embodiments of the present disclosure, B is selected from any of the following structures:

[0188] According to an embodiment of the present disclosure, B is selected from

[0189] According to an embodiment of the present disclosure, B is selected from

[0190] According to an embodiment of the present disclosure, B is selected from

[0191] According to an embodiment of the present disclosure, B is selected from

[0192] According to an embodiment of the present disclosure, B is selected from

[0193] In the disclosure, the hydroxyl protecting group can be various hydroxyl protecting groups, and the specific type is not limited as long as it can protect the hydroxyl group. In some embodiments, the hydroxyl protecting group is stable under alkaline conditions, but can be removed under acidic conditions.

[0194] In some optional embodiments of the present disclosure, the hydroxyl protecting groups that can be used in the present disclosure include, but are not limited to, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (Mox), trityl (Tr group), 4-methoxytrityl (MMTr group), 4,4'-dimethoxytrityl (DMTr group) and 4,4',4"-trimethoxytriphenyl (TMTr group).

[0195] In some optional embodiments of the present disclosure, the hydroxyl protecting group is selected from trityl (Tr group), 4-methoxytrityl (MMTr group), 4,4'-dimethoxytrityl (DMTr group) or 4,4',4"-trimethoxytriphenyl (TMTr group).

[0196] According to an embodiment of the present disclosure, R1 is selected from 4,4'-dimethoxytrityl.

[0197] According to an embodiment of the present disclosure, R1 is selected from H.

[0198] In the disclosure, "phosphorus-containing leaving group" refers to a phosphorus-containing group that can react with other compounds to be removed.

[0199] In some optional embodiments of the present disclosure, the phosphorus-containing leaving group is selected from

[0200] In some optional embodiments of the present disclosure, the phosphorus-containing leaving group is selected from

[0201] According to an embodiment of the present disclosure, R2 is selected from

[0202] According to an embodiment of the present disclosure, R2 is selected from H.

[0203] According to an embodiment of the present disclosure, the nucleoside analog is a compound represented by formula (IIa) or a prodrug thereof:

[0204] Wherein, the groups of R1, R2, B, X and L are as shown above.

[0205] According to an embodiment of the present disclosure, the nucleoside analog is a compound represented by formula (IIIa) or a prodrug thereof:

[0206] Wherein, the groups of R1, R2, B and L are as shown above.

[0207] According to an embodiment of the present disclosure, the nucleoside analog is a compound represented by formula (IVa) or a prodrug thereof:

[0208] Wherein, the groups of B, X and L are as shown above.

[0209] According to an embodiment of the present disclosure, the nucleoside analog is a compound having any of the following structures:

[0210] In the second aspect of the present disclosure, the present disclosure provides a nucleoside analogue, which is a compound represented by formula (Ib), formula (Ic) or formula (Id) or a prodrug thereof:

[0211] wherein R1 is selected from H or a hydroxyl protecting group;

[0212] R2 is selected from H or a phosphorus-containing leaving group;

[0213] B' is selected from a substituted or unsubstituted nucleoside base or a substituted or unsubstituted nucleoside base analog; each substituent in B' is independently a halogen, a C1-C3 alkyl group, a C1-C3 alkyloxy group, or a substituted iminoyl group; if an amino group exists in B', the amino group is not protected;

[0214] X is selected from O, S, NH or -NH-C(=O)-;

[0215] L is selected from substituted or unsubstituted C4-C 12 Hydrocarbyl, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0216] p and q are each independently selected from 1, 2, 3 or 4;

[0217] n is selected from 1, 2 or 3.

[0218] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Hydrocarbon, substituted or unsubstituted C4-C 11 Hydrocarbon, substituted or unsubstituted C4-C 10 Hydrocarbon, substituted or unsubstituted C5-C 12 Hydrocarbon, substituted or unsubstituted C5-C 11 Hydrocarbon, substituted or unsubstituted C5-C 10 Hydrocarbon, substituted or unsubstituted C6-C 12 Hydrocarbon, substituted or unsubstituted C6-C 11 Hydrocarbon, substituted or unsubstituted C6-C 10 Hydrocarbon, substituted or unsubstituted C7-C 12 Hydrocarbon, substituted or unsubstituted C7-C 11 Hydrocarbon, substituted or unsubstituted C7-C 10 Hydrocarbon, substituted or unsubstituted C8-C 12 Hydrocarbon, substituted or unsubstituted C8-C 11 Hydrocarbon, substituted or unsubstituted C8-C 10 Hydrocarbon, substituted or unsubstituted C9-C 12 Hydrocarbon, substituted or unsubstituted C9-C 11Hydrocarbon, or substituted or unsubstituted C9-C 10 each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0219] According to an embodiment of the present disclosure, L is selected from substituted or unsubstituted linear or branched C4-C 12 Alkenyl, or substituted or unsubstituted linear or branched C4-C 12 Alkyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0220] According to an embodiment of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkyl or substituted or unsubstituted C4-C 12 Straight-chain alkenyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0221] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkyl, substituted or unsubstituted C4-C 11 Straight chain alkyl, substituted or unsubstituted C4-C 10 Straight chain alkyl, substituted or unsubstituted C5-C 12 Straight chain alkyl, substituted or unsubstituted C5-C 11 Straight chain alkyl, substituted or unsubstituted C5-C 10 Straight chain alkyl, substituted or unsubstituted C6-C 12 Straight chain alkyl, substituted or unsubstituted C6-C 11 Straight chain alkyl, substituted or unsubstituted C6-C 10 Straight chain alkyl, substituted or unsubstituted C7-C 12 Straight chain alkyl, substituted or unsubstituted C7-C 11 Straight chain alkyl, substituted or unsubstituted C7-C 10 Straight chain alkyl, substituted or unsubstituted C8-C 12 Straight chain alkyl, substituted or unsubstituted C8-C 11 Straight chain alkyl, substituted or unsubstituted C8-C 10 Straight chain alkyl, substituted or unsubstituted C9-C 12 Straight chain alkyl, substituted or unsubstituted C9-C 11 Straight chain alkyl or substituted or unsubstituted C9-C 10 Straight-chain alkyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0222] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkenyl, substituted or unsubstituted C4-C 11 Straight chain alkenyl, substituted or unsubstituted C4-C 10 Straight chain alkenyl, substituted or unsubstituted C5-C 12 Straight chain alkenyl, substituted or unsubstituted C5-C 11 Straight chain alkenyl, substituted or unsubstituted C5-C 10 Straight chain alkenyl, substituted or unsubstituted C6-C 12 Straight chain alkenyl, substituted or unsubstituted C6-C 11 Straight chain alkenyl, substituted or unsubstituted C6-C 10 Straight chain alkenyl, substituted or unsubstituted C7-C 12 Straight chain alkenyl, substituted or unsubstituted C7-C 11 Straight chain alkenyl, substituted or unsubstituted C7-C 10 Straight chain alkenyl, substituted or unsubstituted C8-C 12 Straight chain alkenyl, substituted or unsubstituted C8-C 11 Straight chain alkenyl, substituted or unsubstituted C8-C 10 Straight chain alkenyl, substituted or unsubstituted C9-C 12 Straight chain alkenyl, substituted or unsubstituted C9-C 11 Straight chain alkenyl, or substituted or unsubstituted C9-C 10 Straight-chain alkenyl; each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0223] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted linear or branched C4-C 12 Alkenyl, or substituted or unsubstituted linear or branched C4-C 12 Alkyl, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy.

[0224] In some optional embodiments of the present disclosure, L is selected from substituted or unsubstituted C4-C 12 Straight chain alkyl, or substituted or unsubstituted C4-C 12 In a straight-chain alkenyl group, each substituent in L is independently selected from halogen, C1-C3 alkyl or C1-C3 alkyloxy.

[0225] In some optional embodiments of the present disclosure, L is selected from C4-C 12 Straight chain alkyl or C4-C 12 Straight chain alkenyl.

[0226] In some optional embodiments of the present disclosure, L is selected from C9-C12 Straight chain alkyl or C9-C 12 Straight chain alkenyl.

[0227] In some optional embodiments of the present disclosure, L is selected from C9-C 10 Straight chain alkyl or C 12 Straight chain alkenyl.

[0228] According to an embodiment of the present disclosure, L is selected from any of the following structures:

[0229] According to an embodiment of the present disclosure, L is selected from

[0230] According to an embodiment of the present disclosure, L is selected from

[0231] According to an embodiment of the present disclosure, L is selected from

[0232] According to an embodiment of the present disclosure, X is selected from O or -NH-C(=O)-.

[0233] According to an embodiment of the present disclosure, X is selected from O.

[0234] According to an embodiment of the present disclosure, X is selected from -NH-C(=O)-.

[0235] According to an embodiment of the present disclosure, X is selected from O, and L is selected from

[0236] According to an embodiment of the present disclosure, X is selected from -NH-C(=O)-, and L is selected from

[0237] According to an embodiment of the present disclosure, X is selected from -NH-C(=O)-, and L is selected from

[0238] According to an embodiment of the present disclosure, n=1.

[0239] In some optional embodiments of the present disclosure, p and q are each independently selected from 1 or 2.

[0240] According to an embodiment of the present disclosure, p=1 and q=1.

[0241] According to an embodiment of the present disclosure, p=1 and q=2.

[0242] According to an embodiment of the present disclosure, p=2 and q=1.

[0243] According to an embodiment of the present disclosure, p=2 and q=2.

[0244] In some optional embodiments of the present disclosure, B' is selected from a nucleoside base or a nucleoside base analog, and if there is an amino group in B', the amino group is not protected.

[0245] In some optional embodiments of the present disclosure, the nucleoside base is selected from cytosine, adenine, guanine, thymine, or uracil.

[0246] In some optional embodiments of the present disclosure, the nucleoside base analog is selected from hypoxanthine 9-yl, purine 9-yl, 2-aminopurine 9-yl, 2,4-difluoro 5-methylphenyl, 5-nitroindole 1-yl, 3-nitropyrrol 1-yl, 4-fluoro 6-methylbenzimidazole 1-yl, or 4-methylbenzimidazole 1-yl.

[0247] According to an embodiment of the present disclosure, B' is selected from a nucleoside base.

[0248] According to an embodiment of the present disclosure, B' is selected from

[0249] According to an embodiment of the present disclosure, B' is selected from

[0250] According to an embodiment of the present disclosure, B' is selected from

[0251] According to an embodiment of the present disclosure, B' is selected from

[0252] According to an embodiment of the present disclosure, B' is selected from

[0253] According to an embodiment of the present disclosure, B' is selected from

[0254] In some optional embodiments of the present disclosure, the hydroxyl protecting group includes but is not limited to monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (Mox), trityl (Tr group), 4-methoxytrityl (MMTr group), 4,4'-dimethoxytrityl (DMTr group) and 4,4',4"-trimethoxytriphenyl (TMTr group).

[0255] In some optional embodiments of the present disclosure, the hydroxyl protecting group is selected from trityl (Tr group), 4-methoxytrityl (MMTr group), 4,4'-dimethoxytrityl (DMTr group) or 4,4',4"-trimethoxytriphenyl (TMTr group).

[0256] According to an embodiment of the present disclosure, the hydroxyl protecting group is selected from 4,4'-dimethoxytrityl.

[0257] According to an embodiment of the present disclosure, R1 is selected from 4,4'-dimethoxytrityl.

[0258] According to an embodiment of the present disclosure, R1 is selected from H.

[0259] In some optional embodiments of the present disclosure, the phosphorus-containing leaving group is selected from

[0260] In some optional embodiments of the present disclosure, the phosphorus-containing leaving group is selected from

[0261] According to an embodiment of the present disclosure, the phosphorus-containing removing group is selected from

[0262] According to an embodiment of the present disclosure, R2 is selected from

[0263] According to an embodiment of the present disclosure, R2 is selected from H.

[0264] In some optional embodiments of the present disclosure, the nucleoside analog is selected from the compound represented by formula (IIb), formula (IIc) or formula (IId) or a prodrug thereof:

[0265] Wherein, the groups of B', X and L are as shown above.

[0266] In some optional embodiments of the present disclosure, the nucleoside analog is selected from the compound represented by formula (IIIb), formula (IIIc) or formula (IIId) or a prodrug thereof:

[0267] Wherein, the groups of B' and L are as shown above.

[0268] According to an embodiment of the present disclosure, the nucleoside analog is selected from any one of the following structures:

[0269] In the third aspect of the present disclosure, the present disclosure proposes use of the nucleoside analogue described in the first aspect and / or the nucleoside analogue described in the second aspect in preparing oligonucleotides.

[0270] The nucleoside analogs described in the first aspect and the second aspect can be used to replace nucleotides, such as A, U, C, G or T. Furthermore, the B base group of the nucleoside analog of the first aspect or the B' base group of the nucleoside analog of the second aspect can be selected according to the type of nucleotide to be replaced. For example: the nucleotide replaced by the nucleoside analog is A, and accordingly, the B base group of the nucleoside analog of the first aspect is protected or unprotected A, and the B' base group of the nucleoside analog of the second aspect is unprotected A; the nucleotide replaced by the nucleoside analog is U, and accordingly, the B base group of the nucleoside analog of the first aspect is protected or unprotected U, and the B' base group of the nucleoside analog of the second aspect is unprotected U; the nucleotide replaced by the nucleoside analog is C, and accordingly, the B base group of the nucleoside analog of the first aspect is The base group is a protected or unprotected C, and the B' base group of the nucleoside analog in the second aspect is an unprotected C; the nucleotide replaced by the nucleoside analog is G, and accordingly, the B base group of the nucleoside analog in the first aspect is a protected or unprotected G, and the B' base group of the nucleoside analog in the second aspect is an unprotected G; the nucleotide replaced by the nucleoside analog is T, and accordingly, the B base group of the nucleoside analog in the first aspect is a protected or unprotected T, and the B' base group of the nucleoside analog in the second aspect is an unprotected T.

[0271] It should be noted that the aforementioned nucleoside analogs may be compounds that participate in the reaction and, after the reaction, remove the hydroxyl protecting group and / or the phosphorus-containing leaving group and / or the amino protecting group on the B base group (e.g., benzoyl (Bz), acetyl (Ac), isobutyryl, etc.). For example, the nucleoside analogs described in the first aspect, after the reaction, remove the amino protecting group on R1 and / or R2 and / or the B base group; or compounds that are located in an oligonucleotide or double-stranded oligonucleotide and connected to other nucleotides, such as the nucleoside analogs described in the second aspect.

[0272] According to an embodiment of the present disclosure, the oligonucleotide is selected from a single-stranded oligonucleotide or a double-stranded oligonucleotide.

[0273] According to an embodiment of the present disclosure, the single-stranded oligonucleotide is selected from antisense oligonucleotide, nucleic acid aptamer, ribozyme, deoxyribozyme, circular RNA, sense strand of siRNA or antisense strand of siRNA.

[0274] According to an embodiment of the present disclosure, the oligonucleotide is selected from antisense oligonucleotides (ASOs).

[0275] According to an embodiment of the present disclosure, the double-stranded oligonucleotide is selected from small interfering RNA, double-stranded RNA, microRNA, small guide RNA, small activating RNA or short hairpin RNA.

[0276] According to an embodiment of the present disclosure, the oligonucleotide is selected from small interfering RNA (siRNA).

[0277] In the fourth aspect of the present disclosure, the present disclosure provides a double-stranded oligonucleotide, comprising a sense strand and an antisense strand, wherein the antisense strand and the sense strand have a complementary region of at least partial base pairing, and the sense strand and / or the antisense strand contain at least one nucleoside analogue described in the second aspect.

[0278] According to an embodiment of the present disclosure, each nucleotide in the double-stranded oligonucleotide, except for the nucleoside analog, is independently a modified or unmodified nucleotide. It should be noted that in the double-stranded oligonucleotide of the present disclosure, the nucleoside analog described in the second aspect of the present disclosure may be used to replace one or more modified or unmodified nucleotides (A, U, C, G, or T) in the nucleotide sequence of the double-stranded oligonucleotide; that is, the nucleoside base in the double-stranded oligonucleotide replaced by the nucleoside analog described in the second aspect is the same as the B' nucleoside base of the nucleoside analog described in the second aspect. For example: the nucleoside base in the double-stranded oligonucleotide replaced by the nucleoside analog is A, and accordingly, the B' base group of the nucleoside analog in the second aspect is A; the nucleoside base in the double-stranded oligonucleotide replaced by the nucleoside analog is U, and accordingly, the B' base group of the nucleoside analog in the second aspect is U; the nucleoside base in the double-stranded oligonucleotide replaced by the nucleoside analog is C, and accordingly, the B' base group of the nucleoside analog in the second aspect is C; the nucleoside base in the double-stranded oligonucleotide replaced by the nucleoside analog is G, and accordingly, the B' base group of the nucleoside analog in the second aspect is G; the nucleoside base in the double-stranded oligonucleotide replaced by the nucleoside analog is T, and accordingly, the B' base group of the nucleoside analog in the second aspect is T.

[0279] According to an embodiment of the present disclosure, the modification of each nucleotide in the double-stranded oligonucleotide is independently and optionally selected from at least one of the following:

[0280] 2'-deoxy modification, 2'-fluoro modification, 2'-amino modification, 2'-O-allyl modification, 2'-O-methyl modification, 2'-methoxyethyl modification, 2'-allyl modification, abasic modification, tetrahydropyranyl modification, 1,5'-anhydrohexitol modification, cyclohexenyl modification, PEG modification, 5'-phosphoramidate modification, 5'-phosphorothioate modification, 5'-methylphosphonate modification, 5'-phosphate mimetic modification, and 5'-methylated cytosine modification.

[0281] According to an embodiment of the present disclosure, the modification of each nucleotide is independently and optionally selected from at least one of the following: 2'-deoxy modification, 2'-fluoro modification, 2'-O-methyl modification and 2'-O-allyl modification.

[0282] According to an embodiment of the present disclosure, the double-stranded oligonucleotide is selected from small interfering RNA, double-stranded RNA, microRNA, small guide RNA, small activating RNA and short hairpin RNA.

[0283] According to an embodiment of the present disclosure, the double-stranded oligonucleotide is selected from siRNA.

[0284] According to an embodiment of the present disclosure, the length of the sense strand and the antisense strand is independently 15-25 nucleotides, for example, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 16-25, 16-24, 16-23, 16-22, 16-21, 16-20, 16-19, 17- 25, 17-24, 17-23, 17-22, 17-21, 17-20, 17-19, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 18-19, 19-25, 19-24, 19-23, 19-22, 19-21 or 19-20.

[0285] According to an embodiment of the present disclosure, the sense strand and / or the antisense strand comprises one nucleoside analog.

[0286] According to an embodiment of the present disclosure, the structure of the sense strand or the antisense strand is any of the following structures:

[0287] The nucleoside analog is located at the 5' end of the sense strand or the antisense strand, and the structural formula of the sense strand or the antisense strand is:

[0288] or

[0289] The nucleoside analog is located at the 3' end of the sense strand or the antisense strand, and the structural formula of the sense strand or the antisense strand is:

[0290] or

[0291] The nucleoside analog is located at the non-5' end and non-3' end of the sense strand or the antisense strand, and the structural formula of the sense strand or the antisense strand is:

[0292] in, represents the sense strand or at least a portion thereof, or the antisense strand or at least a portion thereof;

[0293] p, q, n, B', X and L are respectively the same as p, q, n, B', X and L defined in the nucleoside analogue of the second aspect.

[0294] According to some embodiments of the present disclosure, the antisense strand does not comprise the nucleoside analog, and the sense strand comprises one nucleoside analog.

[0295] According to an embodiment of the present disclosure, the nucleoside analog is located at positions 1 to 8 of the sense strand starting from the 5' end.

[0296] According to an embodiment of the present disclosure, the nucleoside analog is located at positions 2 to 8 of the sense strand starting from the 5' end.

[0297] According to an embodiment of the present disclosure, the nucleoside analog is located at positions 3 to 7 of the sense strand starting from the 5' end.

[0298] According to some embodiments of the present disclosure, the nucleoside analog is located at position 4-6 of the sense strand starting from the 5' end.

[0299] According to some embodiments of the present disclosure, the nucleoside analog is located at the 4th position of the sense strand starting from the 5' end.

[0300] According to some embodiments of the present disclosure, the nucleoside analog is located at the 5th position of the sense strand starting from the 5' end.

[0301] According to some embodiments of the present disclosure, the nucleoside analog is located at the 6th position of the sense strand starting from the 5' end.

[0302] In a fifth aspect of the present disclosure, a composition is provided. According to an embodiment of the present disclosure, the composition comprises: the double-stranded oligonucleotide described in the fourth aspect.

[0303] According to an embodiment of the present disclosure, the composition further comprises optionally one or more pharmaceutically acceptable carriers or excipients.

[0304] In the sixth aspect of the present disclosure, the present disclosure proposes the use of the nucleoside analogue described in the first aspect, the nucleoside analogue described in the second aspect, the double-stranded oligonucleotide described in the fourth aspect, or the composition described in the fifth aspect in the preparation of a drug for treating and / or preventing pathological conditions or diseases caused by abnormal expression of specific genes in target cells.

[0305] Herein, the term "abnormal expression" refers to a situation where the expression level of a gene in a cell is higher than the normal expression level, such as gene overexpression, or the expression level of a non-existent gene.

[0306] According to an embodiment of the present disclosure, the target cells are selected from nervous system cells.

[0307] In the seventh aspect of the present disclosure, the present disclosure provides a method for inhibiting the expression of a specific gene in a target cell, the method comprising: contacting the double-stranded oligonucleotide described in the fourth aspect or the composition described in the fifth aspect with the target cell.

[0308] In the eighth aspect of the present disclosure, the present disclosure proposes a method for preventing and / or treating pathological conditions or diseases caused by abnormal expression of specific genes in target cells, the method comprising: administering to a subject a pharmaceutically acceptable dose of the double-stranded oligonucleotide described in the fourth aspect or the composition described in the fifth aspect.

[0309] According to an embodiment of the present disclosure, the target cells are selected from cells of the central nervous system (CNS).

[0310] According to an embodiment of the present disclosure, the nervous system cells include neuronal cells and glial cells.

[0311] According to an embodiment of the present disclosure, the specific gene is selected from at least one of APP, ATXN2, HTT, SNCA, FUS, PRNP, SOD1, DMPK and TTR.

[0312] The effective amount of the double-stranded oligonucleotide or composition disclosed herein may vary depending on the mode of administration and the severity of the disease to be treated. The selection of the preferred effective amount can be determined by a person of ordinary skill in the art based on various factors (e.g., through clinical trials). The factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated for the patient, the patient's weight, the patient's immune status, the route of administration, etc. For example, depending on the urgency of the treatment situation, several divided doses may be administered monthly, quarterly, or annually, for example, at a dosage of four times a month, three times a month, twice a month, once a month, once every two months, once every three months, once every six months, or once a year.

[0313] The drug can be administered to a subject by any suitable route known in the art, including but not limited to oral or parenteral routes, including intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, intracerebroventricular administration, intrathecal administration, rectal administration and topical administration (including buccal administration and sublingual administration), preferably intravenous administration.

[0314] It should be noted that the nucleotide sequence of the double-stranded oligonucleotide in this article can be adjusted and designed according to the target gene. As long as it can have a complementary region with at least partial base pairing with the target gene mRNA to ensure that at least one chain of the double-stranded oligonucleotide can complementarily pair with the target gene mRNA, its specific sequence is not limited.

[0315] In the ninth aspect of the present disclosure, the present disclosure provides a nucleotide analog as shown in (100), or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0316] in, represents the covalent bonding site of the nucleotide analog;

[0317] B is selected from unsubstituted or substituted nucleoside bases, or unsubstituted or substituted nucleoside base analogs; if B contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl, C1-C3 alkyloxy, or iminoyl;

[0318] L' is selected from substituted or unsubstituted C 16 -C 24 If the L 'contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0319] p is selected from 1, 2, 3 or 4;

[0320] q is selected from 1, 2, 3 or 4;

[0321] n is selected from 1, 2 or 3;

[0322] Z is selected from hydroxyl or mercapto.

[0323] In some embodiments of the present disclosure, the C 16 -C 24 The hydrocarbon group is selected from saturated or unsaturated C 16 -C 24 The hydrocarbon chain is a straight chain hydrocarbon group or a branched hydrocarbon group, such as a straight chain C 16 -C 24 Alkyl or alkenyl, branched C 16 -C 24 Alkyl or alkenyl.

[0324] In some embodiments of the present disclosure, the nucleotide analog is selected from the structure shown in formula (200), or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0325] In some optional embodiments of the present disclosure, B is selected from the nucleobase A, U, G, C or T, or an analog of the nucleobase.

[0326] In some optional embodiments of the present disclosure, L' is selected from saturated or unsaturated C 18 -C 22 Hydrocarbon group.

[0327] In some optional embodiments of the present disclosure, p is selected from 1 or 2.

[0328] In some optional embodiments of the present disclosure, q is selected from 1 or 2.

[0329] In some optional embodiments of the present disclosure, n is selected from 1 or 2.

[0330] In some optional embodiments of the present disclosure, L' is selected from C 18 -C 22 Alkyl; such as C 18 -C 21 Alkyl, C 18 -C 20 Alkyl, C 19 -C 22 Alkyl, C 19 -C 21 Alkyl, C 19 -C 20 Alkyl or C 20 alkyl.

[0331] In some optional embodiments of the present disclosure, L' is selected from C 18 -C 22 Straight chain alkyl; such as C 18 -C 21 Straight chain alkyl, C 18 -C 20 Straight chain alkyl, C 19 -C 22 Straight chain alkyl, C 19 -C 21 Straight chain alkyl, C 19 -C 20 Straight chain alkyl or C 20 Straight chain alkyl.

[0332] In some optional embodiments of the present disclosure, L' is selected from C 18 Straight chain alkyl or C 20 Straight chain alkyl or C 22 Straight chain alkyl.

[0333] In some optional embodiments of the present disclosure, n is selected from 1.

[0334] In some optional embodiments of the present disclosure, the nucleotide analogue is selected from any of the following structures:

[0335] In the tenth aspect of the present disclosure, the present disclosure provides a double-stranded oligonucleotide, comprising a sense strand and an antisense strand, each strand having 17-25 modified and / or unmodified nucleotides, the antisense strand being complementary to the sense strand to form a duplex region; the sense strand and / or the antisense strand comprising at least one nucleotide analogue according to the ninth aspect of the present disclosure;

[0336] The nucleotide analog is specifically represented by the structure shown in formula (100), or its tautomer, or its stereoisomer, or its pharmaceutically acceptable salt:

[0337] in, represents the covalent bond site between the nucleotide analog and the adjacent nucleotide;

[0338] B is selected from unsubstituted or substituted nucleoside bases, or unsubstituted or substituted nucleoside base analogs; if B contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl, C1-C3 alkyloxy, or iminoyl;

[0339] L' is selected from substituted or unsubstituted C 16 -C 24 If the L 'contains a substituent group, the substituent group is independently selected from halogen, C1-C3 alkyl or C1-C3 alkoxy;

[0340] p is selected from 1, 2, 3 or 4;

[0341] q is selected from 1, 2, 3 or 4;

[0342] n is selected from 1, 2 or 3;

[0343] Z is selected from hydroxyl or mercapto.

[0344] In some optional embodiments of the present disclosure, the sense strand and / or the antisense strand comprises at least one nucleotide analogue as represented by formula (200), or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0345] The definitions of the substituents are the same as those in formula (100).

[0346] In some optional embodiments of the present disclosure, B is selected from the nucleobases A, U, G, C or T, or analogs of the foregoing nucleobases;

[0347] In some optional embodiments of the present disclosure, L' is selected from saturated or unsaturated C 18 -C 22 hydrocarbon group;

[0348] p is selected from 1 or 2;

[0349] q is selected from 1 or 2;

[0350] n is selected from 1 or 2;

[0351] Z is selected from hydroxyl or mercapto.

[0352] In some optional embodiments of the present disclosure, L' is selected from C 18 -C 22 Alkyl; such as C 18 -C 21 Alkyl, C 18 -C 20 Alkyl, C 19 -C 22 Alkyl, C 19 -C 21 Alkyl, C 19 -C 20 Alkyl or C 20 alkyl.

[0353] In some optional embodiments of the present disclosure, L' is selected from C 18 -C 22 Straight chain alkyl; such as C 18 -C 21 Straight chain alkyl, C 18 -C 20 Straight chain alkyl, C 19 -C 22 Straight chain alkyl, C 19 -C 21 Straight chain alkyl, C 19 -C 20 Straight chain alkyl or C 20 Straight chain alkyl.

[0354] In some optional embodiments of the present disclosure, L' is selected from saturated C 18 Straight chain alkyl, C 19 Straight chain alkyl, C 20 Straight chain alkyl, C 21 Straight chain alkyl or C 22 Straight chain alkyl.

[0355] In some optional embodiments of the present disclosure, n is selected from 1.

[0356] In some optional embodiments of the present disclosure, the nucleotide analog is selected from any of the following structures, or tautomers thereof, or pharmaceutically acceptable salts thereof:

[0357] In some embodiments of the present disclosure, the sense strand comprises one or two nucleotide analogs.

[0358] In some embodiments of the present disclosure, the sense strand comprises one nucleotide analog. In some embodiments of the present disclosure, the nucleotide analog can be located at the 5' end of the sense strand, or at the 3' end of the sense strand, or at any position between the 5' end and the 3' end of the sense strand.

[0359] In some embodiments of the present disclosure, the nucleotide analog is located at the 5' end or the 3' end of the sense strand.

[0360] In some embodiments of the present disclosure, the nucleotide analog is located at any one of positions 2 to 19 of the sense strand starting from the 5' end.

[0361] In some embodiments of the present disclosure, the nucleotide analog is located at any one of positions 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the sense strand starting from the 5' end.

[0362] In some embodiments of the present disclosure, the nucleoside analog is located at any one of positions 2 to 8 of the sense strand starting from the 5' end.

[0363] In some embodiments of the present disclosure, the nucleoside analog is located at any one of positions 4 to 6 of the sense strand starting from the 5' end.

[0364] In some embodiments of the present disclosure, the length of the sense strand and the antisense strand are each independently selected from 19-23 nucleotides. In some specific embodiments, the length of the sense strand is selected from 21 nucleotides. In some specific embodiments, the length of the antisense strand is selected from 19 nucleotides.

[0365] In some embodiments of the present disclosure, the antisense strand comprises 1, 2, or 3 phosphorothioate diester bonds at the 5' terminus and 1, 2, or 3 phosphorothioate diester bonds at the 3' terminus; and / or, the sense strand comprises 1, 2, or 3 phosphorothioate diester bonds at the 5' terminus.

[0366] In some embodiments of the present disclosure, the 5' end of the antisense strand comprises a phosphate or a phosphate mimetic. In one example, the phosphate mimetic is selected from 5'-vinylphosphonate (VP).

[0367] In some embodiments of the present disclosure, the 5' end of the antisense strand does not contain 5'-vinylphosphonate (VP).

[0368] In some embodiments of the present disclosure, the antisense strand does not comprise the nucleotide analog, and the antisense strand is substantially reverse complementary, essentially reverse complementary, or completely reverse complementary to a nucleotide sequence in the mRNA expressed by the target gene.

[0369] In some optional embodiments of the present disclosure, the other nucleotides in the double-stranded oligonucleotide except the nucleotides replaced by the nucleotide analogs are modified, and each is independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides and 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides.

[0370] In some embodiments of the present disclosure, in the direction from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are selected from 2'-fluoro-modified nucleotides; and / or, the nucleotides at positions 7 and 9 of the sense strand are selected from 2'-fluoro-modified nucleotides.

[0371] In some embodiments of the present disclosure, in the direction from the 5' end to the 3' end, at least three nucleotides at positions 7 to 10 in the sense strand are selected from 2'-fluoro-modified nucleotides; and / or, at least four nucleotides at positions 2, 6, 9, 12, 14 and 16 of the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotide at position 15 is selected from a 2'-O-methoxyethyl or 2'-O-methyl modified nucleotide.

[0372] In some embodiments of the present disclosure, in the direction from the 5' end to the 3' end, at least three nucleotides at positions 7-10 in the sense strand are selected from 2'-fluoro-modified nucleotides, and one nucleotide at positions 2-8 is selected from the nucleotide analogs; and / or, at least four nucleotides at positions 2, 6, 9, 12, 14 and 16 in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotide at position 15 is selected from a 2'-O-methoxyethyl-modified nucleotide or a 2'-O-methyl-modified nucleotide; and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides.

[0373] In some embodiments of the present disclosure, in the direction from the 5' end to the 3' end, the nucleotides at positions 7 to 10 in the sense strand are selected from 2'-fluoro-modified nucleotides, and one nucleotide at positions 4 to 6 is selected from the nucleotide analogs; and / or, at least five nucleotides at positions 2, 6, 9, 12, 14 and 16 in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotide at position 15 is selected from a 2'-O-methoxyethyl-modified nucleotide; and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides.

[0374] In some embodiments of the present disclosure, the double-stranded oligonucleotide further comprises a targeting ligand that targets a receptor that mediates delivery to a specific CNS tissue.

[0375] In some embodiments of the present disclosure, the double-stranded oligonucleotide comprising a ligand has a structure represented by formula (400), or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0376] in, represents the double-stranded oligonucleotide;

[0377] SS represents the sense strand of the double-stranded oligonucleotide;

[0378] AS represents the antisense strand of the double-stranded oligonucleotide;

[0379] j1 and j2 are each independently selected from 0 or 1;

[0380] Each k is independently selected from 1 or 2;

[0381] Each M is independently selected from a targeting ligand;

[0382] Each L2 is independently selected from a covalent linking group.

[0383] In some embodiments of the present disclosure, the j1 is selected from 0, and the j2 is selected from 0.

[0384] In some embodiments of the present disclosure, said j1 is selected from 1, and said j2 is selected from 0. Conjugation was attached to the 5' end of the sense strand.

[0385] In some embodiments of the present disclosure, said j1 is selected from 0, and said j2 is selected from 1. The conjugate was attached to the 3' end of the sense strand.

[0386] In some embodiments of the present disclosure, the j1 is selected from 1, and the j2 is selected from 1. Conjugated to the 5' and 3' ends of the sense strand, respectively.

[0387] In some embodiments of the present disclosure, each of the M is independently selected from any one of the following structures, or a tautomer thereof, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0388] In some embodiments of the present disclosure, each of the L2 is independently selected from any one of the following structures, or its tautomer, or its stereoisomer, or its pharmaceutically acceptable salt:

[0389] wherein Z' is independently selected from hydroxyl or thiol.

[0390] Wherein, when k is selected from 1, L2 is selected from the following structures, or tautomers thereof, or stereoisomers thereof, or pharmaceutically acceptable salts thereof:

[0391] When k is selected from 2, the L2 is selected from the following structure, or its tautomer, or its stereoisomer, or its pharmaceutically acceptable salt:

[0392] In some embodiments of the present disclosure, each of the Each is independently selected from any of the following structures, or its tautomers, or its stereoisomers, or its pharmaceutically acceptable salts:

[0393] In some embodiments of the present disclosure, the double-stranded oligonucleotide has any of the following structures, or tautomers, or stereoisomers, or pharmaceutically acceptable salts thereof:

[0394] In some embodiments of the present disclosure, the double-stranded oligonucleotide has any of the following structures, or tautomers, or stereoisomers, or pharmaceutically acceptable salts thereof:

[0395] In an optional embodiment, the targeting ligand is selected from the group consisting of: Angiopep-2, lipoprotein receptor-related protein (LRP) ligand, bEnd.3 cell binding ligand, transferrin receptor (TfR) ligand, mannose receptor ligand, glucose transporter and LDL receptor ligand.

[0396] In the eleventh aspect of the present disclosure, the present disclosure provides a composition comprising the double-stranded oligonucleotide according to the tenth aspect of the present disclosure.

[0397] In the twelfth aspect of the present disclosure, the present disclosure provides the use of the nucleotide analogs described in the ninth aspect of the present disclosure, and / or the double-stranded oligonucleotides described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure in the preparation of drugs for treating and / or preventing pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells.

[0398] In the thirteenth aspect of the present disclosure, the present disclosure further provides a pharmaceutical composition comprising the double-stranded oligonucleotide according to the tenth aspect of the present disclosure, and / or the composition according to the eleventh aspect of the present disclosure.

[0399] In some embodiments of the present disclosure, the composition further comprises, optionally, one or more pharmaceutically acceptable carriers or excipients.

[0400] In the fourteenth aspect of the present disclosure, the present disclosure further provides a pharmaceutical composition comprising the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure.

[0401] In the fifteenth aspect of the present disclosure, the present disclosure also provides a method for reducing gene expression in target cells, the method comprising: contacting the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure with the target cells.

[0402] In some embodiments of the present disclosure, the target cell is selected from a nervous system cell.

[0403] In the sixteenth aspect of the present disclosure, the present disclosure also provides a method for reducing the expression of a target gene in a subject, the method comprising: administering to the subject the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure.

[0404] In some embodiments of the present disclosure, the method comprises intrathecal administration.

[0405] In some embodiments of the present disclosure, the method reduces expression of a target gene in brain or spinal tissue.

[0406] In some embodiments of the present disclosure, the brain or spinal tissue includes, but is not limited to, tissue selected from the group consisting of: cortex, cerebellum, cervical spine, lumbar spine, and thoracic spine.

[0407] In some embodiments of the present disclosure, exemplary target genes are selected from APP, ATXN2, C9orf72, TARDBP, MAPT (Tau), HTT, SNCA, FUS, ATXN3, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK or TTR.

[0408] In the seventeenth aspect of the present disclosure, the present disclosure also provides a method for preventing and / or treating pathological conditions or diseases caused by abnormal expression of specific genes in target cells, the method comprising: administering to a subject a pharmaceutically acceptable dose of the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure.

[0409] In some embodiments of the present disclosure, the target cell is selected from a nervous system cell.

[0410] In an eighteenth aspect of the present disclosure, the present disclosure further provides a method for treating a subject suffering from a disease or condition related to a CNS disorder, the method comprising:

[0411] A therapeutically effective amount of the double-stranded oligonucleotide according to the tenth aspect of the present disclosure, and / or the composition according to the eleventh aspect of the present disclosure, and / or the pharmaceutical composition according to the thirteenth aspect of the present disclosure, and / or the drug according to the fourteenth aspect of the present disclosure is administered to the subject, thereby treating the CNS disorder-related disease or condition of the subject.

[0412] In some embodiments of the present disclosure, the CNS disorder is selected from the group consisting of Parkinson's disease, amyotrophic lateral sclerosis (ALS), diffuse Lewy body disease, Parkinson's disease dementia, Huntington's disease, multiple system atrophy, Alzheimer's disease, and other neurodegenerative diseases.

[0413] In some embodiments of the present disclosure, the subject is selected from humans.

[0414] In the nineteenth aspect of the present disclosure, the present disclosure provides a kit comprising the nucleotide analogs described in the ninth aspect of the present disclosure, and / or the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure, and / or the drug described in the fourteenth aspect of the present disclosure.

[0415] In the twentieth aspect of the present disclosure, the present disclosure also provides a method for inhibiting target gene expression in skeletal muscle cells, eye cells, cardiomyocytes or fat cells, the method comprising: administering to the subject a therapeutically effective amount of the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure.

[0416] In the twenty-first aspect of the present disclosure, the present disclosure also provides a method for preventing and / or treating diseases or conditions related to skeletal muscle, myocardium, eye or adipose tissue, the method comprising: administering to the subject a therapeutically effective amount of the double-stranded oligonucleotide described in the tenth aspect of the present disclosure, and / or the composition described in the eleventh aspect of the present disclosure, and / or the pharmaceutical composition described in the thirteenth aspect of the present disclosure.

[0417] In some embodiments of the present disclosure, the subject is a human.

[0418] In some embodiments of the present disclosure, the skeletal muscle-related disease or disorder is muscular dystrophy.

[0419] In some embodiments of the present disclosure, the muscular dystrophy is selected from the group consisting of Duchenne muscular dystrophy, myotonic muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, and Emery-Dreifuss muscular dystrophy, myostatin-related muscle hypertrophy, congenital myasthenic syndrome, and facioscapulohumeral muscular dystrophy (FSHD).

[0420] In some embodiments of the present disclosure, the myocardial-related disease or disorder is selected from the group consisting of obstructive hypertrophic cardiomyopathy (HOCM); familial hypertrophic cardiomyopathy (FHC); heart failure with preserved ejection fraction (HFPEF); atrial fibrillation (AFIB); ventricular fibrillation (VFIB); angina pectoris; myocardial infarction (MI); heart failure or heart failure with reduced ejection fraction (HFREF); supraventricular tachycardia (SVT); hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), arrhythmias and congestive heart failure (CHF).

[0421] In some embodiments of the present disclosure, the adipose tissue-related disease or disorder is a metabolic disease.

[0422] In some embodiments of the present disclosure, the metabolic disease is selected from the group consisting of a lipid metabolism disorder, hypertension, cardiovascular disease, or an excess weight-related disorder.

[0423] In some embodiments of the present disclosure, the eye-related disease or condition is selected from the group consisting of: glaucoma (including but not limited to primary open-angle glaucoma, secondary glaucoma, pigmentary glaucoma, pseudoexfoliation glaucoma, traumatic glaucoma, neovascular glaucoma, uveitic glaucoma, eye conditions of angle-closure glaucoma, normal-tension glaucoma, juvenile open-angle glaucoma, primary open-angle glaucoma), iridocorneal endothelial syndrome, macular degeneration, cataract, diabetic retinopathy, dry eyes, night blindness, strabismus, nystagmus, color blindness, uveitis, eye inflammation, presbyopia, retinal diseases, corneal diseases, diabetic macular edema, ocular hypertension, astigmatism, diabetic eye disease, hyperopia, myopia, macular edema.

[0424] In some embodiments of the present disclosure, the double-stranded oligonucleotide agent is administered to a subject, wherein the administration is selected from the group consisting of: subcutaneous administration, intramuscular administration, intravenous administration, intraperitoneal administration, or intravitreal administration.

[0425] In some embodiments of the present disclosure, administration of the double-stranded oligonucleotide agent results in target gene expression of no more than 40%, no more than 50%, no more than 60%, or no more than 70% of that without administration.

[0426] The scheme of the present disclosure will be explained below in conjunction with the examples. Those skilled in the art will understand that the following examples are only used to illustrate the present disclosure and should not be considered to limit the scope of the present disclosure. Where specific techniques or conditions are not specified in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0427] The reagents used in the preparation examples of the present invention, such as 1-[(2R,3R,4S,5R)-5-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-3,4-dihydroxyoxacyclopent-2-yl]-3H-pyrimidine-2,4-dione, sodium periodate, sodium borohydride, lipase TLIM, benzoyl chloride, tert-butyldimethylsilyl chloride, hexadecane bromide, tetrabutylammonium fluoride, 3-{[bis(diisopropylamino)phosphoryl]oxy}propionitrile and 1H-imidazole-4,5-dicarbonitrile, were all purchased from Beijing Coupling Technology Co., Ltd.

[0428] Unless otherwise specified, the base composition and modification meanings used in this disclosure are as follows: capital letters A, U, G, C, and T represent the base composition of nucleotides, lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a 2'-O-methyl modified (also known as: 2'-methoxy modified) nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a 2'-fluoro modified nucleotide; (moe) represents that the nucleotide adjacent to the left of the combination mark (moe) is a 2'-O-methoxyethyl (i.e., 2'-O-MOE) modified nucleotide; lowercase letter s represents that the two adjacent nucleotides on the left and right sides of the letter s are connected by a thiophosphate diester bond. In the context of this disclosure, unless otherwise specified, the siRNA sequences used in this disclosure were all commissioned to Suzhou Beixin Biotechnology Co., Ltd. for synthesis; the synthesis of PCR primers used in this disclosure was commissioned to Beijing Qingke Biotechnology Co., Ltd.; the experimental animals C57BL / 6J mice used in this disclosure were all purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.

[0429] In the context of this disclosure, unless otherwise stated, the real-time PCR detection data of the in vivo activity experiments involved in this disclosure all use the ΔΔCt method to perform relative quantitative calculation of the target gene mRNA in each test group. The calculation method is summarized as follows:

[0430] ΔCt(test group) = Ct(test group target gene) - Ct(test group reference gene)

[0431] ΔCt(control group) = Ct(control group target gene) - Ct(control group internal reference gene)

[0432] ΔΔCt(test group)=ΔCt(test group)-ΔCt(control group average)

[0433] ΔΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0434] The mRNA expression level of the target gene in the test group was normalized with the control group as the benchmark, and the remaining expression level of the target gene mRNA in the control group was defined as 100%.

[0435] Relative residual expression level of target gene mRNA in the test group = 2 -ΔΔCt (Test group) × 100%

[0436] Test group target gene mRNA inhibition rate = 100% - test group target gene mRNA relative expression level

[0437] In the context of this disclosure, unless otherwise stated, in vivo activity experimental data are presented as or The experimental data were plotted and analyzed using GraphPad prism 8.0 software.

[0438] In the context of the present disclosure, unless otherwise stated, the ratios of reagents described in the examples of the present disclosure are calculated on a volume basis (v / v).

[0439] Preparation Example 1: Synthesis of Compound NM031

[0440] The synthesis process of compound NM031 is as follows:

[0441] (1-1) Synthesis of Compound NM031-2 (1-[(1R)-1-{[(2S)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-hydroxypropan-2-yl]oxy}-2-hydroxyethyl]-3H-pyrimidine-2,4-dione)

[0442] Compound NM031-1 (1-[(2R,3R,4S,5R)-5-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-3,4-dihydroxyoxolan-2-yl]-3H-pyrimidine-2,4-dione, 20 g, 36.592 mmol) was dissolved in a mixed solution of dioxane (160 mL) and water (40 mL), and sodium periodate (7.82 g, 36.592 mmol) was added. Under an argon atmosphere, the reaction solution was stirred at 25°C for 2 hours. After the reaction, the reaction solution was concentrated to remove the solvent, diluted with water (300 mL), and extracted with dichloromethane five times (5×200 mL). The organic phases were combined, washed twice with saturated sodium bicarbonate aqueous solution (2×100 mL) and twice with saturated brine (2×100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a white solid (16.2 g).

[0443] At 25°C, the white solid (16.2 g) was dissolved in dioxane (160 mL), and sodium borohydride (2.08 g, 54.888 mmol) was added portionwise. Under an argon atmosphere, the reaction solution was stirred at 25°C for 2 hours and quenched by adding saturated aqueous ammonium chloride (120 mL). After completion of the reaction, the reaction solution was extracted four times with dichloromethane (4 × 150 mL). The organic phases were combined, washed twice with saturated brine (2 × 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain compound NM031-2 (13.5 g, yield 67.5%) as a white solid.

[0444] MS ESI (m / z) = 547.15 [MH] - .

[0445] 1H NMR(400MHz,DMSO-d6)δ11.34(br s,1H),7.64(d,J=8.0Hz,1H),7.40-7.24(m,5H),7.23-7.11(m,5H),6.89-6.82(m,4H),5.81(t,J=5.6Hz,1H),5.52(dd,J=8.0,2. 0Hz,1H),5.13(t,J=6.4Hz,1H),4.74(t,J=5.2Hz,1H),3.73(s,6H),3.71-3.60(m,2H),3.40(t,J=5.2Hz,2H),3.07-2.88(m,2H).

[0446] (1-2) Synthesis of Compound NM031-3 (Ethyl (2R)-2-{[(2S)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-hydroxypropan-2-yl]oxy}-2-(2,4-dioxo-3H-pyrimidin-1-yl)benzoate)

[0447] Compound NM031-2 (13 g, 23.696 mmol) was dissolved in toluene (120 mL) at 25°C, and lipase TLIM (0.5 g) and benzoyl chloride (3.33 g, 23.696 mmol) were added. The reaction mixture was stirred at 25°C under a nitrogen atmosphere for 6 hours and quenched by the addition of saturated aqueous ammonium chloride (150 mL). After completion of the reaction, the mixture was extracted with dichloromethane (3 × 120 mL). The organic phases were combined, washed with saturated aqueous sodium bicarbonate (2 × 200 mL) and saturated brine (2 × 100 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by reverse-phase chromatography (column: C18 silica gel, elution gradient: acetonitrile / water = 5 / 95, v / v) to obtain compound NM031-3 (10.2 g, yield 65.9%) as a yellow solid.

[0448] MS ESI (m / z) = 651.20 [MH] - .

[0449] 1 H NMR(400MHz,Chloroform-d)δ8.00-7.91(m,2H),7.63-7.53(m,1H),7.50-7.37(m,3H),7.30-7.09(m,12H),6.88-6. 74(m,4H),6.30-6.07(m,1H),5.61(dd,J=8.0,2.0Hz,1H),4.62-4.43(m,2H),3.84-3.61(m,8H),3.22-3.20(m,2H).

[0450] (1-3) Synthesis of Compound NM031-4 (Ethyl (2R)-2-{[(2R)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-[(tert-butyldimethylsilyl)oxy]prop-2-yl]oxy}-2-(2,4-dioxo-3H-pyrimidin-1-yl)benzoate)

[0451] At 25°C, compound NM031-3 (10.1 g, 15.474 mmol) was dissolved in pyridine (100 mL), and tert-butyldimethylsilyl chloride (2.80 g, 18.569 mmol) was added. The reaction solution was stirred at 25°C for 16 hours under a nitrogen atmosphere. After the reaction, the reaction solution was spin-dried to remove the solvent, diluted with water (400 mL), and extracted with dichloromethane (4×150 mL). The organic phases were combined, washed with saturated sodium bicarbonate aqueous solution (2×80 mL) and saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by reverse phase chromatography (chromatographic column: C18 silica gel, elution gradient: acetonitrile / water = 5 / 95, v / v) to obtain compound NM031-4 (8.5 g, yield 71.6%) as a yellow solid.

[0452] MS ESI (m / z) = 765.30 [MH] - .

[0453] 1 H NMR(400MHz,Chloroform-d)δ7.96(d,J=8.4Hz,2H),7.60-7.51(m,2H),7.45-7.33(m,4H),7.29-7.19(m,8H),6.84-6.73(m,4H),6.36(t,J=5.2H z,1H),5.58(dd,J=8.0,2.0Hz,1H),4.59-4.33(m,2H),3.77(s,6H),3.7 2-3.58(m,3H),3.17(d,J=4.0Hz,2H),0.84(s,9H),-0.01~-0.03(m,6H).

[0454] (1-4) Synthesis of Compound NM031-5 (1-((6R,8R)-6-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-2,2,3,3-tetramethyl-4,7,10-trioxa-3-silahexadecane-8-yl)pyrimidine-2,4(1H,3H)-dione)

[0455] At 25 ° C, compound NM031-4 (7.5 g, 9.779 mmol) was dissolved in a mixed solution of pyridine (20 mL) and methanol (20 mL), the temperature was lowered to 0 ° C in an ice bath, sodium hydroxide (0.23 g, 5.867 mmol) was added, and the reaction solution was stirred at 0 ° C for 6 hours under a nitrogen atmosphere. After the reaction was completed, the reaction solution was spin-dried to remove the solvent, water (150 mL) was added for dilution, and dichloromethane (3 × 200 mL) was added for extraction. The organic phases were combined, washed with saturated ammonium chloride aqueous solution (2 × 100 mL) and saturated brine (2 × 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a white solid (3.84 g), which was used directly in the next step.

[0456] The white solid (3.84 g) was dissolved in N,N-dimethylformamide (50 mL), cooled to 0°C in an ice bath, and sodium hydride (0.70 g, 60%, 29.337 mmol) was added. The reaction mixture was stirred at 0°C under a nitrogen atmosphere for 20 minutes. Hexadecane bromide (4.48 g, 14.668 mmol) was added, and the reaction mixture was slowly warmed to 25°C and stirred at 25°C for 16 hours. The mixture was quenched by the addition of saturated aqueous ammonium chloride (150 mL). After completion of the reaction, the mixture was extracted with dichloromethane (3 × 150 mL). The organic phases were combined, washed with saturated aqueous sodium bicarbonate (2 × 80 mL) and saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (elution gradient: petroleum ether / ethyl acetate = 1 / 1, v / v) to afford compound NM031-5 (1.82 g, 21.6% yield) as a yellow solid.

[0457] MS ESI (m / z) = 885.50 [MH] - .

[0458] (1-5) Synthesis of Compound NM031-6 (1-[(1R)-1-{[(2S)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-hydroxypropan-2-yl]oxy}-2-(pentadecyloxy)ethyl]-3H-pyrimidine-2,4-dione)

[0459] Compound NM031-5 (1.8 g, 2.029 mmol) was cooled to 0°C in an ice bath at 25°C, and tetrabutylammonium fluoride (0.79 g, 3.044 mmol) was added dropwise. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 4 hours. After the reaction, water (50 mL) was added to the reaction solution for dilution, and the solution was extracted with dichloromethane (3×50 mL). The organic phases were combined, washed with saturated sodium bicarbonate aqueous solution (2×30 mL) and saturated brine (40 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal flow column chromatography (elution gradient: petroleum ether / ethyl acetate = 3 / 7, v / v) to obtain compound NM031-6 (1.05 g, yield 67.3%) as a yellow solid.

[0460] MS ESI (m / z) = 771.45 [MH] - .

[0461] 1 H NMR (300MHz, DMSO-d6) δ11.38(d,J=2.1Hz,1H),7.67(d,J=8.1Hz,1H),7.38-7. 10(m,9H),6.86(d,J=9.0,2.1Hz,4H),5.98(t,J=6.0Hz,1H),5.53(dd,J=8.1,2. 1Hz,1H),4.87-4.67(m,1H),3.73(s,6H),3.66(d,J=6.0Hz,2H),3.43(d,J=5.7 Hz,2H),3.10-2.82(m,2H),1.43(s,2H),1.23-1.20(m,30H),0.87-0.83(m,3H).

[0462] (1-6) Synthesis of Compound NM031 ((8R,10R)-8-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-5-(diisopropylamino)-10-(2,4-dioxo-3H-pyrimidin-1-yl)-4,6,9,12-tetraoxo-5-phosphacyclooctanonitrile)

[0463] Compound NM031-6 (1 g, 1.294 mmol) was repeatedly dried with acetonitrile (3 × 20 mL) and dissolved in dichloromethane (15 mL). A solution of 3-{[bis(diisopropylamino)phosphoryl]oxy}propionitrile (584.88 mg, 1.941 mmol) in dichloromethane (15 mL) dried with acetonitrile (3 × 0 mL) was added, and 1H-imidazole-4,5-dicarbonitrile (106.94 mg, 0.906 mmol) was added. The atmosphere was replaced with argon three times, and the reaction solution was stirred at 25 ° C for 1 hour under an argon atmosphere. After completion of the reaction, saturated aqueous sodium bicarbonate solution (100 mL) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3×100 mL). The organic phases were combined, washed with saturated brine (2×50 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by reverse phase chromatography (chromatographic column: C18 silica gel, elution gradient: acetonitrile / water = 30 / 70, v / v) to give compound NM031 (605 mg, yield 47.6%) as a yellow oil.

[0464] MS ESI (m / z) = 971.50 [MH] - .

[0465] 1 H NMR(400MHz, Acetonitrile-d3)δ9.00(s,1H),7.38(dd,J=8.0,3.2Hz,1H),7.32-7.24(m,2H), 7.22-7.09(m,7H),6.79-6.69(m,4H),5.96-5.83(m,1H),5.39(dd,J=8.0,1.2Hz,1H),3.70-3.5 8(m,10H),3.58-3.41(m,5H),3.33(dd,J=6.4,4.0Hz,2H),3.12-2.89(m,2H),2.50(d,J=7.6Hz, 2H),1.37(q,J=6.4Hz,2H),1.16(d,J=10.4Hz,26H),1.08-0.94(m,12H),0.78(t,J=6.8Hz,3H).

[0466] Preparation Example 2: Synthesis of Compound NM058

[0467] The synthesis process of compound NM058 is as follows:

[0468] (2-1) Synthesis of Compound NM058-2 (N-(9-[(S)-1-{[(S)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-hydroxypropan-2-yl]oxy}-2-hydroxyethyl]-9-hydrogen-purin-6-yl)benzamide)

[0469] The compound NM058-1 (1N-(9-[(2S, 5R)-5-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-3,4-dihydroxytetrahydrofuran-2-yl]-9hydrogen-purin-6-yl)benzamide, 22.6 g, 33.56 mmol) was dissolved in a mixed solution of dioxane (345 mL) and water (115 mL), and sodium periodate (8.04 g, 36.92 mmol) was added. Under an argon atmosphere, the reaction solution was stirred at 25 ° C for 2 hours. After the reaction, the reaction solution was concentrated to remove the solvent, diluted with water (300 mL), extracted with dichloromethane five times (5×200 mL), and the organic phases were combined, washed twice with saturated sodium bicarbonate aqueous solution (2×100 mL) and saturated brine (2×100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a white solid (22.6 g), which was used directly in the next step.

[0470] At 25°C, the white solid (22.6 g) was dissolved in dioxane (350 mL), and sodium borohydride (1.4 g, 36.92 mmol) was added in batches. Under an argon atmosphere, the reaction solution was stirred at 25°C for 2 hours and quenched by adding a saturated aqueous ammonium chloride solution (120 mL). After the reaction was completed, the reaction solution was extracted four times with dichloromethane (4×150 mL), the organic phases were combined, washed twice with saturated brine (2×100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain the compound as a white solid.

[0471] NM058-2 (20.4 g, yield 98.7%).

[0472] MS ESI (m / z) = 676.27 [M+H] - .

[0473] (2-2) Synthesis of Compound NM058-3 ((S)-2-(6-Benzamido-9-hydrogen-purin-9-yl)-2-{[(S)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-hydroxypropyl-2-yl]oxy}benzoic acid ethyl ester)

[0474] Compound NM058-2 (20 g, 31.079 mmol) was dissolved in dichloromethane (200 mL) at 25°C, and 1,8-diazabicyclo[5.4.0]undec-7-ene (9.456 g, 62.158 mmol) was added. The atmosphere was replaced with nitrogen three times, and the reaction solution was cooled to -78°C under a nitrogen atmosphere. Benzoyl chloride (4.805 g, 34.187 mmol) was added dropwise at -78°C. The reaction solution was stirred at -78°C for 1 hour and quenched with saturated aqueous ammonium chloride (150 mL). After completion of the reaction, the mixture was extracted three times with dichloromethane (3 × 120 mL). The organic phases were combined, washed twice with saturated aqueous sodium bicarbonate (2 × 200 mL), twice with saturated brine (2 × 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a crude yellow solid compound NM058-3 (25 g).

[0475] MS ESI (m / z) = 780.30 [M+H] - .

[0476] (2-3) Synthesis of Compound NM058-4 ((S)-2-(6-benzamido-9-hydrogen-purin-9-yl)-2-{[(R)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-[(tert-butyldimethylsilyl)oxy]prop-2-yl]oxy}benzoic acid ethyl ester)

[0477] At 25 ° C, compound NM058-3 (24.7 g, 31.695 mmol) was dissolved in dichloromethane (250 mL), and imidazole (3.23 g, 47.543 mmol) and tert-butyldimethylsilyl chloride (6.21 g, 41.203 mmol) were added. Under a nitrogen atmosphere, the reaction solution was stirred at 25 ° C for 16 hours. After the reaction, the solvent was removed by spin drying, water (400 mL) was added for dilution, and the mixture was extracted with dichloromethane four times (4×150 mL). The organic phases were combined, washed twice with saturated sodium bicarbonate aqueous solution (2×80 mL), washed once with saturated brine (1×100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a crude yellow solid compound NM058-4 (28.6 g).

[0478] MS ESI (m / z) = 894.38 [M+H] - .

[0479] (2-4) Synthesis of Compound NM058-5 (N-(9-[(S)-1-{[(R)-1-[bis(4-methoxyphenyl)(phenyl)methoxy]-3-[(tert-butyldimethylsilyl)oxy]prop-2-yl]oxy}-2-hydroxyethyl]-9-hydrogen-purin-6-yl)benzamide)

[0480] At 25°C, compound NM058-4 (28.3 g, 31.689 mmol) was dissolved in a mixed solution of pyrimidine (170 mL) and methanol (68 mL). The temperature was lowered to 0°C in an ice bath, and aqueous sodium hydroxide solution (31.6 mL, 1 M) was added. Under a nitrogen atmosphere, the reaction solution was stirred at 0°C for 0.5 hours. After the reaction, the reaction solution was spin-dried to remove the solvent, diluted with water (150 mL), and extracted three times with dichloromethane (3×200 mL). The organic phases were combined, washed twice with saturated aqueous ammonium chloride solution (2×100 mL) and twice with saturated brine (2×100 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal flow column chromatography (elution gradient: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM058-5 (16.21 g, yield 64.8%) as a white solid.

[0481] MS ESI (m / z) = 790.36 [M+H] - .

[0482] (2-5) Synthesis of Compound NM058-6 (N-(9-[(6R,8S)-6-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-2,2,3,3-tetramethyl-4,7,10-trioxa-3-silahexacan-8-yl]-9hydrogen-purin-6-yl)benzamide)

[0483] Under an ice bath, N,N-dimethylformamide (30 mL) was cooled to 0°C. Sodium hydride (501.7 mg, 11.4 mmol) was added first, followed by compound NM058-5 (3 g, 3.8 mmol). Under a nitrogen atmosphere, the reaction solution was stirred at 0°C for 30 minutes. Hexadecane bromide (1.74 g, 5.7 mmol) and potassium iodide (946.33 mg, 5.7 mmol) were added, and the reaction solution was slowly warmed to 25°C and stirred at 25°C for 16 hours. Saturated aqueous ammonium chloride (150 mL) was added to quench the reaction. After completion of the reaction, the reaction solution was extracted three times with ethyl acetate (3 × 150 mL). The organic phases were combined, washed twice with saturated aqueous sodium bicarbonate (2 × 80 mL), once with saturated brine (1 × 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain crude compound NM058-6 (3.9 g) as a yellow solid.

[0484] MS ESI (m / z) = 1014.61 [M+H] - .

[0485] (2-6) NM058-7 (N-(9-[(S)-1-{[(S)-1-[bis((4-methoxyphenyl)(phenyl)methoxy]-3-hydroxypropan-2-yl]oxy}-2-(hexadecyloxy)ethyl]-9-hydrogen-purin-6-yl)benzamide)

[0486] Compound NM058-6 (3.9 g, 3.847 mmol) was dissolved in methanol (24 mL) at 25°C, and ammonium fluoride (984.28 mg, 26.933 mmol) and triethylamine (767.66 mg, 7.694 mmol) were added. The reaction mixture was stirred at 40°C under a nitrogen atmosphere for 3 hours. After the reaction, the reaction mixture was directly concentrated and purified by normal flow chromatography (elution gradient: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM058-7 (1.34 g, yield 39.2%) as a white solid.

[0487] MS ESI (m / z) = 900.52 [M+H] - .

[0488] (2-7) Synthesis of Compound NM058 ((R)-2-[(R)-1-(6-benzamido-9-hydrogen-purin-9-yl)-2-(hexadecyloxy)ethoxy]-3-[bis(4-methoxyphenyl)(phenyl)methoxy]propyl(2-cyanoethyl)diisopropylphosphoramidite)

[0489] Compound NM058-7 (1 g, 1.11 mmol) was first dried with acetonitrile three times (3×20 mL), then dissolved in dichloromethane (15 mL), and a dichloromethane (15 mL) solution of 3-{[bis(diisopropylamino)phosphoryl]oxy}propionitrile (402.8 mg, 1.332 mmol) was added (3-{[bis(diisopropylamino)phosphoryl]oxy}propionitrile was first dried with acetonitrile three times (3×10 mL), then dissolved in dichloromethane), and then 1H-imidazole-4,5-dicarbonitrile (104.92 mg, 0.888 mmol) was added. The atmosphere was replaced with nitrogen three times, and the reaction solution was stirred at 25°C under a nitrogen atmosphere for 1 hour. After the reaction, saturated aqueous sodium bicarbonate solution (30 mL) was added for dilution, and the mixture was extracted with dichloromethane three times (3×20 mL). The organic phases were combined, washed twice with saturated brine (2×30 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by forward chromatography (elution gradient: petroleum ether / ethyl acetate = 2 / 1, v / v) to give compound NM058 (750 mg, yield 61.4%) as a white solid.

[0490] MS ESI (m / z) = 1100.63 [M+H] - .

[0491] 1 H NMR(400MHz,DMSO-d6)δ8.71(d,J=17.9Hz,2H),8.06(d,J=7.5Hz,2H),7.55 (t,J=7.6Hz,2H),7.24-7.03(m,5H),7.01-6.91(m,4H),6.80-6.74(m,4H),4 .00(dd,J=10.6,4.9Hz,2H),3.68(s,9H),3.49(ddt,J=30.2,14.3,7.1Hz,4 H),2.74(dt,J=11.8,5.9Hz,2H),1.35-0.88(m,39H),0.85(t,J=6.7Hz,3H).

[0492] Preparation Example 3: Synthesis of Compound NM073

[0493] In this preparation example, the synthetic route of compound NM073 is as follows:

[0494] (3-1) Synthesis of Compound 5

[0495] Compound 4 (17.1 g, 22.3 mmol, 1 eq) was dissolved in a mixture of pyrimidine (102 ml) and methanol (41 ml) at 25°C. The reaction system was cooled to 0°C using an ice bath. Aqueous sodium hydroxide (16.7 mL, 1 M, 1.2 eq) was added at 0°C, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 1 hour. After completion of the reaction, the solvent was removed by spin drying, and the mixture was diluted with water (150 ml). The mixture was extracted with dichloromethane (3 × 200 ml). The organic phases were combined and washed with saturated aqueous ammonium chloride (2 × 100 mL) and saturated aqueous sodium chloride (2 × 100 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to afford compound 5 (13.1 g, 88.6% yield) as a white solid. MS ESI (m / z) = 663.3 [M+H] + .

[0496] (3-2) Synthesis of Compound NM073-1

[0497] Compound 5 (4 g, 6.04 mmol, 1 eq) was dissolved in N,N-dimethylformamide (40 ml), and the temperature of the reaction system was lowered to 0°C with an ice bath. A 60% mass percent concentration of sodium hydride (0.72 g, 18.11 mmol, 3 eq) in N,N-dimethylformamide was added at 0°C, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 30 minutes. Octadecane bromide (3.02 g, 9.06 mmol, 1.5 eq, CAS No.: 112-89-0) was added, and the reaction solution was slowly heated to 25°C and stirred at 25°C for 16 hours. After the reaction was completed, saturated aqueous ammonium chloride (200 ml) was added to the reaction solution for quenching, and the mixture was extracted with ethyl acetate (3×100 ml). The organic phases were combined; the organic phases were washed with saturated aqueous sodium bicarbonate (2×80 ml) and saturated aqueous sodium chloride (100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1, v / v) to obtain compound NM073-1 (1.97 g, yield 35.7%) as a yellow solid. MS ESI (m / z) = 915.50 [M+H] + .

[0498] (3-3) Synthesis of Compound NM073-2

[0499] Compound NM073-1 (1.97 g, 2.15 mmol, 1 eq) was dissolved in tetrahydrofuran (20 ml) at 25°C, and a solution of tetrabutylammonium fluoride in tetrahydrofuran (4.3 mL, 1 M, 2 eq) was added dropwise. The atmosphere was purged with nitrogen three times, and the reaction mixture was stirred at 0°C under a nitrogen atmosphere for 4 hours. After completion of the reaction, the reaction mixture was directly concentrated to remove the solvent and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM073-2 (930 mg, yield 53.9%) as a colorless oil. MS ESI (m / z) = 801.45 [M+H] + .

[0500] (3-4) Synthesis of Compound NM073

[0501] Compound NM073-2 (930 mg, 1.16 mmol, 1 eq) dried with acetonitrile (3 × 10 ml) was dissolved in dichloromethane (10 ml), and a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (526.3 mg, 1.74 mmol, 1.5 eq) in dichloromethane (10 ml) dried with acetonitrile (3 × 10 mL) was added, and 1H-imidazole-4,5-dicarbonitrile (109.67 mg, 0.93 mmol, 0.8 eq, CAS No.: 1122-28-7, abbreviated as DCI) was added. The atmosphere was replaced with argon three times, and the reaction solution was stirred at 25 ° C under argon atmosphere for 1 hour. After the reaction was completed, saturated aqueous sodium bicarbonate (50 ml) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3 × 20 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 × 50 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1, v / v) to obtain compound NM073 (1 g, yield 86.0%) as a colorless oil. MS ESI (m / z) = 1001.50 [M+H] + .

[0502] 1 H NMR (400MHz, DMSO-d6) δ11.37(s,1H),7.65(d,J=8.1Hz,1H),7.34-7.24(m,4H),7.18(ddd,J=8.9,4.0,2 .4Hz,5H),6.93-6.74(m,4H),5.96(q,J=5.9Hz,1H),5.53(d,J=8.0Hz,1H),3.73(s,7H),3.65(dd,J=8.4, 5.3Hz,5H),3.60-3.35(m,5H),3.10-2.93(m,2H),2.70(dt,J=11.8,5.9Hz,2H),1.42(q,J=6.5Hz,2H),1 .22(d,J=10.5Hz,30H),1.10(dd,J=6.8,3.1Hz,6H),1.04(dd,J=12.1,6.7Hz,6H),0.85(t,J=6.7Hz,3H).

[0503] Preparation Example 4: Synthesis of Compound NM074

[0504] In this preparation example, the synthetic route of compound NM074 is as follows:

[0505] (4-1) Synthesis of Compound NM074-1

[0506] Compound 5 (4 g, 6.04 mmol, 1 eq) was dissolved in N,N-dimethylformamide (40 ml), and the temperature of the reaction system was lowered to 0°C with an ice bath. A 60% mass percentage solution of sodium hydride (0.72 g, 18.11 mmol, 3 eq) in N,N-dimethylformamide was added at 0°C, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 30 minutes; bromoeicosane (3.27 g, 9.06 mmol, 1.5 eq, CAS number: 4276-49-7) was added, and the reaction solution was slowly heated to 25°C and stirred at 25°C for 16 hours. After completion of the reaction, saturated aqueous ammonium chloride (200 ml) was added to the reaction solution for quenching, and the mixture was extracted with ethyl acetate (3 × 100 ml). The organic phases were combined and washed with saturated aqueous sodium bicarbonate (2 × 80 ml) and saturated aqueous sodium chloride (100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1, v / v) to obtain compound NM074-1 (2.08 g, yield 36.6%) as a yellow solid. MS ESI (m / z) = 943.60 [M+H] + .

[0507] (4-2) Synthesis of Compound NM074-2

[0508] Compound NM074-1 (2.08 g, 2.21 mmol, 1 eq) was dissolved in tetrahydrofuran (20 ml) at 25°C, and a solution of tetrabutylammonium fluoride (4.4 mL, 1 M, 2 eq) in tetrahydrofuran was added dropwise. The atmosphere was purged with nitrogen three times, and the reaction mixture was stirred at 0°C for 4 hours under a nitrogen atmosphere. After completion of the reaction, the reaction mixture was directly concentrated to remove the solvent and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM074-2 (970 mg, 53% yield) as a colorless oil. MS ESI (m / z) = 829.55 [M+H] + .

[0509] (4-3) Synthesis of Compound NM074

[0510] Compound NM074-2 (970 mg, 1.17 mmol, 1 eq) dried with acetonitrile (3 × 10 mL) was dissolved in dichloromethane (10 ml), and a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (530.3 mg, 1.76 mmol, 1.5 eq) in dichloromethane (10 ml) dried with acetonitrile (3 × 10 mL) was added, and 1H-imidazole-4,5-dicarbonitrile (110.5 mg, 0.94 mmol, 0.8 eq, CAS No.: 1122-28-7, abbreviated as DCI) was added. The atmosphere was replaced with argon three times, and the reaction solution was stirred at 25 ° C under argon atmosphere for 1 hour. After completion of the reaction, saturated aqueous sodium bicarbonate (50 ml) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3 × 20 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 × 50 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1, v / v) to obtain compound NM074 (1 g, yield 83.0%) as a colorless oil. MS ESI (m / z) = 1029.64 [M+H] + .

[0511] 1 H NMR (400MHz, DMSO-d6) δ11.37(s,1H),7.65(d,J=8.1Hz,1H),7.34-7.23(m,4H),7.18(ddd,J=8 .9,4.1,2.5Hz,5H),6.89-6.80(m,4H),5.96(q,J=5.8Hz,1H),5.53(d,J=8.0Hz,1H),3.73(s,7H ),3.71-3.36(m,10H),3.12-2.92(m,2H),2.70(dt,J=11.7,5.9Hz,2H),1.43(s,2H),1.22(d,J= 10.4Hz, 34H), 1.10 (dd, J=6.8, 3.0Hz, 6H), 1.04 (dd, J=12.1, 6.7Hz, 6H), 0.85 (t, J=6.6Hz, 3H).

[0512] Preparation Example 5: Synthesis of Compound NM201

[0513] In this preparation example, the synthetic route of compound NM201 is as follows:

[0514] (5-1) Synthesis of Compound NM201-1

[0515] Compound 5 (12.4 g, 18.7 mmol, 1 eq) was dissolved in N,N-dimethylformamide (120 ml), and the temperature of the reaction system was lowered to 0°C with an ice bath. A 60% mass percent concentration of sodium hydride (2.25 g, 60%, 56.1 mmol, 3 eq) in N,N-dimethylformamide was added, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 30 minutes. Bromodocosane (10.9 g, 28.1 mmol, 1.5 eq, CAS No.: 6938-66-5) was added, and the reaction solution was slowly heated to 25°C and stirred at 25°C for 16 hours. After completion of the reaction, saturated aqueous ammonium chloride (600 ml) was added to the reaction solution for quenching, followed by extraction with ethyl acetate (3 × 200 ml). The organic phases were combined and washed with saturated aqueous sodium bicarbonate (2 × 100 ml) and saturated aqueous sodium chloride (100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1, v / v) to afford compound NM201-1 (8.2 g, 45.1% yield) as a yellow solid. MS ESI (m / z) = 971.66 [M+H] + .

[0516] (5-2) Synthesis of Compound NM201-2

[0517] Compound NM201-1 (8.2 g, 8.44 mmol, 1 eq) was dissolved in tetrahydrofuran (80 ml) at 25°C, and a solution of tetrabutylammonium fluoride in tetrahydrofuran (12.7 ml, 1 M, 1.5 eq) was added dropwise. The atmosphere was purged with nitrogen three times, and the reaction mixture was stirred at 0°C under a nitrogen atmosphere for 4 hours. After completion of the reaction, the reaction mixture was directly concentrated to remove the solvent and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM201-2 (3.21 g, yield 44.4%) as a colorless oil. MS ESI (m / z) = 857.55 [M+H] + .

[0518] (5-3) Synthesis of Compound NM201

[0519] Compound NM201-2 (3 g, 3.50 mmol, 1 eq) dried with acetonitrile (3 × 10 ml) was dissolved in dichloromethane (30 ml), and a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.59 g, 5.25 mmol, 1.5 eq) dried with acetonitrile (3 × 10 ml) in dichloromethane (10 ml) was added. 1H-imidazole-4,5-dicarbonitrile (330.6 mg, 2.80 mmol, 0.8 eq) was added, and the atmosphere was replaced with argon three times. The reaction solution was stirred at 25 ° C under argon atmosphere for 1 hour. After completion of the reaction, saturated aqueous sodium bicarbonate (50 ml) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3 × 30 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 × 50 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1, v / v) to obtain compound NM201 (2.83 g, yield 76.5%) as a colorless oil. MS ESI (m / z) = 1056.56 [M+H] + .

[0520] 1 H NMR(400MHz,Chloroform-d)δ7.64(d,J=8.2Hz,1H),7.29(s,4H),7.18(d,J=9.4Hz,5H),6 .84(d,J=8.4Hz,4H),5.96(s,1H),5.56-5.49(m,1H),3.72(d,J=2.6Hz,7H),3.64(s,6H), 3.48(s,2H),3.40(d,J=6.3Hz,2H),3.01(d,J=28.8Hz,2H),2.68(d,J=6.2Hz,2H),1.34-1 .14(m,40H),1.10(dt,J=6.5,2.8Hz,5H),1.07-1.00(m,5H),0.84(dd,J=7.4,4.8Hz,3H).

[0521] Preparation Example 6: Synthesis of Compound NM087

[0522] In this preparation example, the synthetic route of compound NM087 is as follows:

[0523] (6-1) Synthesis of Compound NM087-1

[0524] At 25°C, compound 5 (5.92 g, 8.94 mmol, 1 eq) was dissolved in N,N-dimethylformamide (60 mL). The temperature of the reaction system was lowered to 0°C with an ice bath. A 60 wt% solution of sodium hydride (893.9 mg, 22.35 mmol, 2.5 eq) in N,N-dimethylformamide was added at 0°C. The atmosphere was replaced with nitrogen three times, and the reaction system was stirred at 0°C for 30 minutes under a nitrogen atmosphere. Nonadecane bromide (4.658 g, 13.41 mmol, 1.5 eq, CAS No. 4434-66-6) was added, and the reaction solution was slowly heated to 25°C and stirred at 25°C for 16 hours. After completion of the reaction, saturated aqueous ammonium chloride (200 mL) was added to the reaction solution for quenching, and the mixture was extracted with ethyl acetate (3 × 100 mL). The organic phases were combined; the organic phases were washed with saturated aqueous sodium bicarbonate (2 × 50 mL) and saturated aqueous sodium chloride (100 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase column chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1, v / v) to obtain compound NM087-1 (2.386 g, yield 34.46%) as a yellow solid. MS ESI (m / z) = 929.54 [M+H] + .

[0525] (6-2) Synthesis of Compound NM087-2

[0526] Compound NM087-1 (2.386 g, 2.57 mmol, 1 eq) was dissolved in tetrahydrofuran (30 mL) at 25°C, and a solution of tetrabutylammonium fluoride (5.2 mL, 1 M, 2 eq) in tetrahydrofuran was added dropwise. The atmosphere was purged with nitrogen three times, and the reaction system was stirred at 25°C under a nitrogen atmosphere for 16 hours. After completion of the reaction, the reaction solution was concentrated to remove the solvent and purified by normal phase column chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1, v / v) to obtain compound NM087-2 (690 mg, yield 32.97%) as a colorless oil. MS ESI (m / z) = 816.62 [M+H] + .

[0527] (6-3) Synthesis of Compound NM087

[0528] At 25 ° C, compound NM087-2 (690 mg, 0.847 mmol, 1 eq) dried three times with acetonitrile (3 × 5 mL) was dissolved in dichloromethane (10 mL), and a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (383.76 g, 1.27 mmol, 1.5 eq) in dichloromethane (10 mL) dried three times with acetonitrile (3 × 5 mL) was added, and 1H-imidazole-4,5-dicarbonitrile (79.97 mg, 0.678 mmol, 0.8 eq) was added. The atmosphere was replaced with argon three times, and the reaction system was stirred at 25 ° C for 1 hour under argon atmosphere. After the reaction was completed, saturated aqueous sodium bicarbonate (30 mL) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3×20 mL). The organic phases were combined, washed with saturated aqueous sodium chloride (2×20 mL), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase column chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1, v / v) to obtain compound NM087 (530 mg, yield 76.5%) as a colorless oil. MS ESI (m / z) = 1015.43 [M+H] + .

[0529] 1 H NMR (400MHz, DMSO-d6) δ11.40(s,1H),7.67(d,J=8.0Hz,1H),7.35-7.26(m,4H),7.20(ddd,J=9.0,4.2 ,2.6Hz,5H),6.87(dd,J=8.7,1.8Hz,4H),5.99(t,J=5.7Hz,1H),5.59-5.52(m,1H),3.75(s,6H),3.67( d,J=5.9Hz,4H),3.56-3.39(m,4H),3.13-2.92(m,2H),2.73(dd,J=11.9,5.9Hz,2H),1.45(s,3H),1.2 4(d,J=10.6Hz,36H),1.12(dd,J=6.8,3.0Hz,5H),1.06(dd,J=12.2,6.8Hz,5H),0.87(t,J=6.7Hz,3H).

[0530] Preparation Example 7: Synthesis of Reference Compound NM200

[0531] In this preparation example, the synthetic route of the reference compound NM200 is as follows:

[0532] (7-1) Synthesis of Compound NM200-2

[0533] Compound NM200-1 (10 g, 44.24 mmol, 1 eq, CAS number: 3736-77-4) was dissolved in N,N-dimethylformamide (100 ml, also known as DMF), and imidazole (6.02 g, 88.48 mmol, 2 eq, CAS number 288-32-4, also known as IM) and tert-butyldiphenylsilyl chloride (13.38 g, 48.66 mmol, 1.1 eq, CAS number 58479-61-1, also known as TBDPSCl) were added, and the mixture was stirred at 25 ° C for 16 hours. After completion of the reaction, saturated aqueous ammonium chloride (300 ml) was added to the reaction system, and the mixture was extracted with ethyl acetate (3 x 200 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 x 100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: dichloromethane / methanol = 20 / 1, v / v) to obtain compound NM200-2 (17.08 g, yield 83.2%) as a white solid. MS ESI (m / z) = 465.2 [M+H] + .

[0534] (7-2) Synthesis of Compound NM200-3

[0535] At 25°C, 1-docosanol (90.16 g, 275.96 mmol, 7.5 eq, CAS No. 661-19-8) was dissolved in diethylene glycol dimethyl ether (170 ml, CAS No. 111-96-6), and the atmosphere was replaced with nitrogen three times. A solution of trimethylaluminum (46 mL, 91.99 mmol, 2.5 eq, CAS No. 75-24-1) in diethylene glycol dimethyl ether was added under a nitrogen atmosphere. The temperature was raised to 100°C and stirred at 100°C for 30 minutes. The temperature was then lowered to 60°C and compound NM200-2 (17.08 g, 36.79 mmol, 1 eq) was added at 60°C. The reaction system was stirred at 145°C under a nitrogen atmosphere for 16 hours. After completion of the reaction, saturated aqueous ammonium chloride (300 ml) was added to the reaction system, and the mixture was extracted with ethyl acetate (3 x 200 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 x 100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM200-3 (10.8 g, yield 63.46%) as a white solid. MS ESI (m / z) = 791.6 [M+H] + .

[0536] (7-3) Synthesis of Compound NM200-4

[0537] Compound NM200-3 (10.8 g, 13.66 mmol, 1 eq) was dissolved in tetrahydrofuran (100 ml) at 25°C. A solution of tetrabutylammonium fluoride in tetrahydrofuran (20.5 mL, 1 M, 20.49 mmol, 1.5 eq) was added, and the reaction mixture was stirred at 25°C for 3 hours. After completion of the reaction, the solvent was removed by spin drying and the mixture was purified by reverse phase chromatography (eluent: water / acetonitrile = 5 / 95, v / v) to obtain compound NM200-4 (3.74 g, yield 49.56%) as a white solid. MS ESI (m / z) = 553.4 [M+H] + .

[0538] (7-4) Synthesis of Compound NM200-5

[0539] At 25°C, compound NM200-4 (3.26 g, 5.9 mmol, 1 eq) was dissolved in pyridine (30 ml), and triethylamine (1.19 g, 9.8 mmol, 2 eq) was added. The reaction system was cooled to 0°C with an ice bath. 4,4'-Dimethoxytriphenylmethane (4 g, 9.8 mmol, 2 eq, CAS No. 40615-36-9, also known as DMTrCl) was added portionwise at 0°C, and the reaction system was stirred at 25°C for 16 hours. After the reaction was complete, methanol was added to the reaction solution to quench the reaction, the solvent was removed by spin drying, and ethyl acetate (100 ml) was added to dilute the solution. The solution was washed with saturated aqueous ammonium chloride (2×50 ml) and saturated aqueous sodium chloride (2×30 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1, v / v) to obtain compound NM200-5 (5 g, yield 99.2%) as a yellow solid. MS ESI (m / z) = 855.4 [M+H] + .

[0540] (7-5) Synthesis of Compound NM200

[0541] Compound NM200-5 (4.73 g, 5.54 mmol, 1 eq) dried with acetonitrile (3 × 30 ml) was dissolved in dichloromethane (25 ml), and a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.515 g, 8.30 mmol, 1.5 eq) in dichloromethane (25 ml) dried with acetonitrile (3 × 10 ml) was added. 1H-imidazole-4,5-dicarbonitrile (524.2 mg, 4.43 mmol, 0.8 eq) was added, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 25 ° C under a nitrogen atmosphere for 1 hour. After the reaction was completed, saturated aqueous sodium bicarbonate (50 ml) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3 × 30 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 × 30 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1, v / v) to obtain compound NM-200 (4.87 g, yield 83.43%) as a white solid. MS ESI (m / z) = 1055.3 [M+H] + .

[0542] 1 H NMR(400MHz,Chloroform-d)δ7.78(dd,J=13.2,8.1Hz,1H),7.43-7.15(m,9H),6.89(ddd,J=8.6,6.2,2.1Hz,4H),5 .80(t,J=3.5Hz,1H),5.26(ddd,J=14.2,8.1,1.8Hz,1H),4.37(ddt,J=24.1,10.7,5.5Hz,1H),4.18-3.99(m,2H),3. 74(d,J=2.5Hz,8H),3.56(tdd,J=13.1,10.2,5.2Hz,5H),3.39-3.33(m,1H),2.80-2.73(m,1H),2.61(td,J=6.0,3.5 Hz,1H),1.63-1.43(m,3H),1.22(d,J=3.3Hz,40H),1.16-1.01(m,8H),0.98(d,J=6.7Hz,2H),0.84(t,J=6.6Hz,3H).

[0543] Preparation Example 8: Synthesis of Compound NM202

[0544] In this preparation example, the synthetic route of compound NM202 is as follows:

[0545] (8-1) Synthesis of Compound 7

[0546] Compound 6 (22.6 g, 33.56 mmol, 1 eq, CAS number: 81246-82-4) was dissolved in a mixture of 1,4-dioxane (345 ml) and water (115 ml). Sodium periodate (8.04 g, 36.92 mmol, 1.1 eq) was added, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 25°C under a nitrogen atmosphere for 2 hours. After completion of the reaction, the reaction solution was concentrated to remove the solvent, diluted with water (300 ml), and extracted with dichloromethane (5 × 200 ml). The organic phases were combined and washed with saturated aqueous sodium bicarbonate (2 × 100 ml) and saturated aqueous sodium chloride (2 × 100 ml), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a white solid (22.6 g), which was used directly in the next step without purification.

[0547] The white solid (22.6 g) from this step was dissolved in 1,4-dioxane (350 ml) at 25°C. Sodium borohydride (1.4 g, 36.92 mmol, 1.1 eq, CAS No. 16940-66-2) was added portionwise. The atmosphere was replaced with argon three times, and the reaction mixture was stirred at 25°C for 2 hours. After completion of the reaction, saturated aqueous ammonium chloride (120 ml) was added to the reaction mixture for quenching. The mixture was extracted with dichloromethane (4 x 150 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 x 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to afford compound 7 (20.4 g, 98.7% yield) as a white solid. MS ESI (m / z) = 676.27 [M+H] + .

[0548] (8-2) Synthesis of Compound 8

[0549] At 25°C, compound 7 (20 g, 31.079 mmol, 1 eq) was dissolved in dichloromethane (200 ml), and 1,8-diazabicyclo[5.4.0]undec-7-ene (9.456 g, 62.158 mmol, 2 eq, CAS No.: 6674-22-2) was added. The atmosphere was replaced with nitrogen three times. The reaction solution was cooled to -78°C under a nitrogen atmosphere and benzoyl chloride (4.805 g, 34.187 mmol, 1.1 eq, CAS No.: 98-88-4) was added dropwise at -78°C. After the addition was complete, the reaction solution was stirred at -78°C for 1 hour. After the reaction was completed, saturated aqueous ammonium chloride (150 ml) was added to the reaction solution for quenching, and the mixture was extracted with dichloromethane (3 × 120 ml). The organic phases were combined and washed with saturated aqueous sodium bicarbonate (2 × 200 ml) and saturated aqueous sodium chloride (2 × 100 ml), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain compound 8 (25 g) as a yellow solid. MS ESI (m / z) = 780.30 [M+H]+ .

[0550] (8-3) Synthesis of Compound 9

[0551] Compound 8 (24.7 g, 31.695 mmol, 1 eq) was dissolved in dichloromethane (250 ml) at 25°C. Imidazole (3.23 g, 47.543 mmol, 1.5 eq, CAS No. 288-32-4) and tert-butyldimethylsilyl chloride (6.21 g, 41.203 mmol, 1.3 eq, CAS No. 18162-48-6) were added. The atmosphere was purged with nitrogen three times, and the reaction mixture was stirred at 25°C for 16 hours. After completion of the reaction, the solvent was removed by spin drying, and the mixture was diluted with water (400 ml). The mixture was extracted with dichloromethane (4 × 150 ml). The organic phases were combined and washed with saturated aqueous sodium bicarbonate (2 × 80 ml) and saturated aqueous sodium chloride (100 ml), dried over anhydrous sodium sulfate, filtered, and concentrated to afford compound 9 (28.6 g) as a yellow solid, which was used directly in the next step without purification. MS ESI (m / z) = 894.38 [M+H] + .

[0552] (8-4) Synthesis of Compound 10

[0553] Compound 9 (28.3 g, 31.689 mmol, 1 eq) was dissolved in a mixture of pyrimidine (170 ml) and methanol (68 ml) at 25°C. The reaction system was cooled to 0°C using an ice bath. Aqueous sodium hydroxide (31.6 mL, 1 M, 1 eq) was added at 0°C, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 0.5 hours. After completion of the reaction, the solvent was removed by spin drying, and the mixture was diluted with water (150 ml). The mixture was extracted with dichloromethane (3 × 200 ml). The organic phases were combined and washed with saturated aqueous ammonium chloride (2 × 100 ml) and saturated aqueous sodium chloride (2 × 100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to afford compound 10 (16.21 g, 64.8% yield) as a white solid. MS ESI (m / z) = 790.36 [M+H] + .

[0554] (8-5) Synthesis of Compound NM202-1

[0555] N,N-dimethylformamide (30 ml) was cooled to 0°C using an ice bath, sodium hydride (668.8 mg, 16.7 mmol, 3.3 eq) was added, compound 10 (4 g, 5.1 mmol, 1 eq) was added, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 0°C under a nitrogen atmosphere for 30 minutes; bromodocosane (2.96 g, 7.7 mmol, 1.5 eq, CAS number: 6938-66-5) and potassium iodide (1.26 g, 7.7 mmol, 1.5 eq) were added, and the reaction solution was slowly heated to 25°C and stirred at 25°C for 16 hours. After completion of the reaction, saturated aqueous ammonium chloride (150 ml) was added to the reaction mixture for quenching, followed by extraction with ethyl acetate (3 x 150 ml). The organic phases were combined and washed with saturated aqueous sodium bicarbonate (2 x 80 ml) and saturated aqueous sodium chloride (100 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 3 / 1) to afford compound NM202-1 (3.65 g, yield 65.6%) as a yellow solid. MS ESI (m / z) = 1098.61 [M+H] + .

[0556] (8-6) Synthesis of Compound NM202-2

[0557] Compound NM202-1 (3.65 g, 3.3 mmol, 1 eq) was dissolved in tetrahydrofuran (40 ml) at 25°C. A solution of tetrabutylammonium fluoride in tetrahydrofuran (5 ml, 1 M, 5 mmol, 1.5 eq) was added. The atmosphere was purged with nitrogen three times, and the reaction mixture was stirred at 25°C for 3 hours under a nitrogen atmosphere. After completion of the reaction, the reaction mixture was directly concentrated and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 1 / 1, v / v) to obtain compound NM202-2 (1.3 g, yield 39.8%) as a white solid. MS ESI (m / z) = 984.52 [M+H] + .

[0558] (8-7) Synthesis of Compound NM202

[0559] Compound NM202-7 (1.3 g, 1.32 mmol) dried with acetonitrile (3 × 20 ml) was dissolved in dichloromethane (15 ml), and a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (598.9 mg, 1.98 mmol, 1.5 eq) in dichloromethane (15 ml) dried with acetonitrile (3 × 10 ml) was added. 1H-imidazole-4,5-dicarbonitrile (124.8 mg, 1.06 mmol, 0.8 eq) was added, and the atmosphere was replaced with nitrogen three times. The reaction solution was stirred at 25 ° C under a nitrogen atmosphere for 1 hour. After completion of the reaction, saturated aqueous sodium bicarbonate (30 ml) was added to the reaction solution for dilution, and the mixture was extracted with dichloromethane (3 × 20 ml). The organic phases were combined and washed with saturated aqueous sodium chloride (2 × 30 ml), dried over anhydrous sodium sulfate, filtered, concentrated, and purified by normal phase chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1, v / v) to obtain compound NM202 (1 g, yield 58.9%) as a white solid. MS ESI (m / z) = 1100.63 [M+H] + .

[0560] 1 H NMR (400MHz, DMSO-d6) δ8.73(s,1H),8.68(d,J=1.6Hz,1H),8.06(d,J=7.6Hz,2H),7.64(t,J=7.4H z,1H),7.55(t,J=7.6Hz,2H),7.22-7.03(m,5H),7.01-6.91(m,4H),6.81-6.74(m,4H),6.21(s,1H ),4.09-3.91(m,2H),3.69(d,J=1.7Hz,9H),3.61-3.40(m,4H),3.03-2.89(m,1H),2.86-2.79(m,1 H),2.73(dt,J=11.8,5.9Hz,2H),1.39(t,J=6.7Hz,2H),1.30-1.10(m,52H),0.85(d,J=6.4Hz,3H).

[0561] Reference compound Uhd

[0562] The structural formula of compound Uhd is: Purchased from Shanghai Zhaowei Technology Development Co., Ltd.

[0563] Example 1: Synthesis of double-stranded oligonucleotide siRNA

[0564] (1) Synthesis of sense strand (SS) and antisense strand (AS)

[0565] According to the standard oligonucleotide solid phase synthesis protocol, the solid phase carrier CPG was used to start the cycle, and the nucleoside monomers or carriers (i.e., the nucleoside analog carrier prepared in the preparation example or the carrier Uhd purchased from Shanghai Zhaowei Technology Development Co., Ltd.) were connected one by one in the 3'-5' direction of the nucleotide sequence in Table 1.

[0566] Each linking of a nucleoside monomer involves four steps: deprotection, coupling, capping, and oxidation or sulfurization. The synthesis conditions are given below:

[0567] The nucleoside monomer was prepared into an acetonitrile solution with a concentration of 0.1 M.

[0568] The deprotection reaction conditions for each step were identical: 25°C, 70 seconds, a 3% vol. dichloroacetic acid solution in dichloromethane as the deprotection reagent, and a 5:1 molar ratio of dichloroacetic acid to the 4,4'-dimethoxytrityl protecting group on the solid support.

[0569] The conditions for each coupling reaction were the same. The coupling reaction conditions were: temperature 25°C, a molar ratio of the nucleic acid sequence attached to the solid support to the nucleoside monomer of 1:10, a molar ratio of the nucleic acid sequence attached to the solid support to the coupling reagent of 1:65, a reaction time of 600 seconds, a 0.5 M solution of 5-ethylthio-1H-tetrazole in acetonitrile as the coupling reagent, and a 0.2 M solution of hydrogenated xanthan gum in acetonitrile / pyridine (a 1:1 volume ratio of acetonitrile to pyridine) as the thiolation reagent.

[0570] The capping reaction conditions were identical for each step. The capping reaction conditions were: 25°C; 2 minutes; a 1:1 molar ratio of Cap1 and Cap2; Cap1: a 20% by volume N-methylimidazole solution in pyridine / acetonitrile (3:5 volume ratio of pyridine to acetonitrile); and Cap2: a 20% by volume solution of acetic anhydride in acetonitrile. The molar ratio of the N-methylimidazole in Cap1 to the acetic anhydride in Cap2 to the nucleic acid sequence attached to the solid support was 1:1:1.

[0571] The oxidation reaction conditions were identical for each step. The oxidation reaction conditions were: temperature, 25°C; reaction time, 3 seconds; oxidizing agent concentration, 0.05 M iodine solution; a molar ratio of iodine to the nucleic acid sequence attached to the solid support during the coupling reaction, 30:1; and the oxidation reaction was performed in a water / pyridine mixture (1:9 by volume). The sulfidation reaction conditions were: temperature, 25°C; reaction time, 360 seconds; thiolation agent concentration, 0.2 M hydrogenated xanthan gum in pyridine solution; a molar ratio of thiolation agent to the nucleic acid sequence attached to the solid support during the coupling reaction, 4:1; and the sulfidation reaction was performed in a water / pyridine mixture (1:9 by volume).

[0572] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase support is cut, deprotected, purified, desalted, and then freeze-dried to obtain the positive chain, wherein:

[0573] The cleavage and deprotection conditions are as follows: the synthesized nucleotide sequence connected to the solid phase support is added to 0.5 ml / μmol of ammonia water at a concentration of 25% by mass, the amount of ammonia water is 25 ° C, the reaction is carried out at 55 ° C for 16 hours, the solvent is removed, and the product is concentrated to dryness in vacuo. After the ammonia treatment, the product is dissolved in 0.4 ml / μmol N-methylpyrrolidone relative to the amount of single-stranded nucleic acid, and then 0.3 ml / μmol triethylamine and 0.6 ml / μmol triethylamine trihydrofluoride are added to remove the 2'-O-TBDMS protection on the ribose. Purification and desalting conditions: The nucleic acid is purified by gradient elution with NaCl using a preparative ion chromatography purification column (Source 15Q). Specifically, eluent 1 was 20 mM sodium phosphate (pH = 8.1), and the solvent was a water / acetonitrile mixed solution (the volume ratio of water to acetonitrile was 9:1); eluent 2 was 1.5 M sodium chloride, 20 mM sodium phosphate (pH = 8.1), and the solvent was a water / acetonitrile mixed solution (the volume ratio of water to acetonitrile was 9:1); the elution gradient was eluent 1:eluent 2 = (100:0) - (50:50). The product eluates were collected and combined, and desalted using a reversed-phase chromatography purification column. The desalting conditions included using a Sephadex column with Sephadex G25 as the filler and eluting with deionized water.

[0574] Purity was determined using ion exchange chromatography (IEX-HPLC). Liquid chromatography-mass spectrometry (LC-MS) was used to determine the molecular weight of the antisense strand or antisense strand. The measured molecular weight was compared with the theoretical value. If the measured value ≈ the theoretical value, the antisense strand or antisense strand of the siRNA was obtained. The results are shown in Table 2.

[0575] (2) Synthetic siRNA

[0576] The sense chain and antisense chain synthesized in step (1) were mixed in an equimolar ratio, dissolved in water for injection and heated to 95°C, slowly cooled to 25°C and maintained at 25°C for 10 minutes, so that the sense chain and antisense chain formed a double-stranded structure through hydrogen bonds, thereby obtaining siRNA having the sense chain and antisense chain shown in Table 1.

[0577] The siRNAs prepared in the specific embodiments of the present disclosure are all obtained by nucleotide substitution and / or modification of the following nucleotide sequences:

[0578] Sense strand (5'-3'): UUUUAAUCCUCACUCUAAA (SEQ ID NO: 11)

[0579] Antisense strand (5'-3'): UUUAGAGUGAGGAUUAAAAUG (SEQ ID NO: 12)

[0580] The modified nucleotide sequence information of the siRNA prepared in the specific examples of the present disclosure is shown in the following table:

[0581] Table 1: Sense and antisense strand information of each siRNA

[0582] Unless otherwise specified, the base composition and modification meanings used in the present disclosure are as follows: capital letters A, U, G, C, and T represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a 2'-O-methyl-modified (also known as: 2'-methoxy-modified) nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluoro-modified nucleotide; (moe) indicates that the nucleotide adjacent to the left of the combination mark (moe) is a 2'-O-methoxyethyl (i.e., 2'-O-MOE)-modified nucleotide; the lowercase letter s indicates that the two adjacent nucleotides on the left and right sides of the letter s are connected by a phosphorothioate diester bond.

[0583] Detection: Liquid chromatography-mass spectrometry (LC-MS) was used to determine the molecular weight of the siRNA. The measured molecular weight was compared with the theoretical value. If the measured value ≈ the theoretical value, the siRNA was obtained. The results are shown in Table 2.

[0584] Table 2: Detection results of the sense and antisense strands of each siRNA

[0585] As can be seen from the data in Table 2, a double-helix structure siRNA consisting of a sense strand and an antisense strand was obtained, and the siRNA had a high purity.

[0586] The structural formula of compound NM031 and compound Uhd after linking nucleotides is shown below:

[0587] Among them, A1 is UmsUmsUm, and A1' is AmAmUfCfCfUmCmAmCmUmCmUmAmAmAm or AmAmUfCfCfUfCmAmCmUmCmUmAmAmAm.

[0588] The structural formula of compound NM058 after linking nucleotides is shown below:

[0589] Among them, A2 is UmsUmsUmUm, A2' is AmUfCfCfUmCmAmCmUmCmUmAmAmAm;

[0590] or,

[0591] Among them, A3 is UmsUmsUmUmAm, and A3' is UfCfCfUmCmAmCmUmCmUmAmAmAm.

[0592] (Uhd) indicates that the nucleotide at this site is replaced by a nucleotide analogue (Uhd); (NM031) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM031); (NM058) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM058); (NM073) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM073); (NM074) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM074); (NM087) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM087); (NM200) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM200); (NM201) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM201); (NM202) indicates that the nucleotide at this site is replaced by a nucleotide analogue (NM202);

[0593] The structural formula of 2'-O-methyl modified nucleotides is

[0594] The structural formula of 2'-fluoro modified nucleotide is

[0595] The structural formula of 2'-O-MOE modified nucleotide is

[0596] The structural formula of nucleotide analog (Uhd) is It is formed by the participation of nucleoside analogs Uhd in siRNA synthesis. The structural formula of nucleoside analogs Uhd is

[0597] The structural formula of the nucleotide analog (NM031) is It is formed by the participation of the nucleoside analog NM031 in siRNA synthesis.

[0598] The structural formula of the nucleotide analog (NM058) is It is formed by the participation of nucleoside analog NM058 in siRNA synthesis. The structural formula of nucleoside analog NM058 is

[0599] The structural formula of the nucleotide analog (NM073) is It is formed by the participation of the nucleoside analog NM073 in siRNA synthesis.

[0600] The structural formula of the nucleotide analog (NM074) is It is formed by the participation of the nucleoside analog NM074 in siRNA synthesis.

[0601] The structural formula of the nucleotide analog (NM200) is It is formed by the participation of the nucleoside analog NM200 in siRNA synthesis.

[0602] The structural formula of the nucleotide analog (NM201) is It is formed by the participation of the nucleoside analog NM201 in siRNA synthesis.

[0603] The structural formula of the nucleotide analog (NM202) is It is formed by the participation of the nucleoside analog NM202 in siRNA synthesis.

[0604] The structural formula of the nucleotide analog (NM087) is It is formed by the participation of the nucleoside analog NM087 in siRNA synthesis.

[0605] Here, Base represents the base of a nucleotide, such as uracil U, thymine T, cytosine C, adenine A or guanine G.

[0606] Biological detection experiments

[0607] Unless otherwise specified, the experimental animals C57BL / 6J mice and SD rats used in the present disclosure were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.

[0608] Unless otherwise stated, the synthesis of PCR primers used in this disclosure was commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0609] Unless otherwise specified, all reagents, consumables, and instruments used in this disclosure are commercially available. The main reagent consumables are shown in Table 3, and the main instruments are shown in Table 4.

[0610] Table 3 Main reagents and consumables

[0611] Table 4 Main instruments and equipment

[0612] siRNA activity evaluation test after intracerebroventricular administration in mice

[0613] 6-8 week-old C57BL / 6j mice were randomly divided into groups based on body weight. SiRNA was administered intracerebroventricularly in each group, with the dose determined based on the specific experiment. Using the Bregma as the zero point, the coordinates of the right ventricle were determined using a stereotaxic instrument and marked on the skull surface (AP (anteroposterior): -0.58 mm, ML (mediolateral): -1.2 mm, DV (dorsoventral): -2.2 mm). A dental drill was used to drill a hole in the skull above the target location. The drug was then injected into the lateral ventricle using a microinjection pump. The total injection volume was 5 μL over 10 minutes. The needle was left in place for 5 minutes after injection, then slowly withdrawn. The needle hole was then sealed with biological glue and the skin of the head was sealed. After the animals woke up, they were returned to the animal house for continued care. A PBS control group received the same volume of PBS solution without siRNA. The day of administration was designated as day 0 (D0), and mice were sacrificed at the observation point after administration. Different parts of the brain were collected and stored in RNAlater.

[0614] Activity evaluation test of siRNA conjugates by intrathecal administration in rats

[0615] 6-8 week old SD rats were randomly divided into groups according to body weight. Each group of rats was given siRNA by intrathecal administration, with each rat receiving a dose of 900 μg. The needle was inserted into the rat spinal cord L5-L6, and the administration volume was 40 μL. After the injection, the needle was retained for 2 minutes and then slowly removed. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as day 0 (D0), and the rats were killed at the observation point after administration. Different segments of the spinal cord and different areas of the brain were collected and stored in RNAlater.

[0616] RNA extraction and detection

[0617] RNA extraction: The above tissue samples were removed from RNAlater and disrupted in a Tissuelyser II fully automatic tissue homogenizer for 60 seconds. Total RNA was extracted from each tissue sample using a fully automatic nucleic acid extractor and nucleic acid extraction kit from Zhejiang Hanwei Technology Co., Ltd. according to the instructions.

[0618] Reverse transcription reaction: 1 μg of total RNA from each tissue sample was extracted and reverse transcription was performed using the Promega Reverse Transcription System (A3500) and Oligo(dT) 15 Prepare 20 μL of reverse transcription system according to the kit instructions for reverse transcription primers and complete the reverse transcription reaction. After the reaction is complete, add 80 μL of RNase-free water to the reverse transcription system to obtain the cDNA solution for real-time PCR detection.

[0619] Real-time PCR detection: using ABI SYBR TM Select Master Mix (Catalog number: 4472908) reagent, and prepare 20 μL Real-time PCR reaction system per PCR detection well according to the method described in the kit instructions. Each detection system contains 5 μL of cDNA template obtained by the above reverse transcription reaction, 10 μL SYBR TM Select Master Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, and 4 μL of RNase-free H2O. The prepared reaction system was placed on an ABI StepOnePlus thermal cycler and amplified using a three-step real-time PCR protocol: pre-denaturation at 95°C for 10 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. This denaturation, annealing, and extension process was repeated for 40 cycles. Gene expression differences were calculated using the ΔΔCt method.

[0620] In this real-time fluorescence quantitative PCR method, the ΔΔCt method was used to perform relative quantitative calculation of the relative residual expression level and inhibition rate of the target gene mRNA in each test group. The calculation method is as follows:

[0621] ΔCt(test group) = Ct(test group target gene) - Ct(test group reference gene)

[0622] ΔCt(control group) = Ct(control group target gene) - Ct(control group internal reference gene)

[0623] ΔΔCt(test group)=ΔCt(test group)-ΔCt(control group average)

[0624] ΔΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0625] Wherein, ΔCt (control group average) is the arithmetic mean of the ΔCt (control group) of the animals sacrificed at the same time point in the control group. Therefore, each animal in the test group and the control group corresponds to a ΔΔCt value.

[0626] Relative residual expression level of target gene mRNA in control group = 2-ΔΔCt (control group) × 100%

[0627] Relative residual expression level of target gene mRNA in the test group = 2-ΔΔCt (test group) × 100%

[0628] The relative residual expression level of the target gene mRNA in the test group was normalized based on the average relative residual expression level of the target gene mRNA in the control group, and the average relative residual expression level of the target gene mRNA in the control group was defined as 100%.

[0629] Test group target gene mRNA expression inhibition rate = (1-test group target gene mRNA relative remaining expression level) × 100%

[0630] Unless otherwise stated, the in vivo activity data are based on The experimental data were plotted and analyzed using GraphPad prism 8.0 software.

[0631] Test Example 1

[0632] Evaluation of the inhibitory activity of NM031-conjugated siRNA on the target gene superoxide dismutase 1 (SOD1) by intracerebroventricular administration in mice

[0633] (1) Animal grouping, drug administration, and tissue sample collection

[0634] 6-8 week old C57BL / 6j mice were randomly divided into two groups according to body weight, 5 mice per group, namely a PBS group (administered with siRNA-free PBS solution) and an RZ899008 group (administered with siRNA RZ899008 (sense strand conjugated to position 4 of NM031) prepared in Example 1). Each group of mice was anesthetized with an intraperitoneal injection of 5% chloral hydrate. After anesthesia, the mice were immobilized using a stereotaxic apparatus. The skin of the head was incised, and the coordinates of the right lateral ventricle were located using a stereotaxic apparatus and marked on the skull surface. The coordinates of the lateral ventricle were as follows: ML (mediolateral, left and right of the ventricle, i.e., X-axis) = 1.2 mm, AP (anteroposterior, anteroposterior of the ventricle, i.e., Y-axis) = -0.58 mm, and DV (dorsoventral, downward from the plane of the skull (dura mater), i.e., Z-axis) = 2.2 mm, with the bregma as the origin. A dental drill was used to drill a hole in the skull above the target site, and then the drug was injected into the lateral ventricle using a microdosing pump. The dose of each mouse in the RZ899008 group was 200 μg (dosage was calculated as siRNA, the concentration of siRNA was 20 μg / μL, and the solvent was PBS buffer solution), and the total injection volume was 10 μL. The PBS group was given the same volume of PBS solution without siRNA. The injection time was 10 minutes. After the injection, the needle was left in place for 5 minutes and then slowly removed (about 2 minutes). The needle hole was then sealed with biological glue and the skin of the head was glued. After the animal woke up, the animal was returned to the animal breeding room for continued breeding. The day of administration was recorded as the first day (D1), and the mice were sacrificed on the fifth day (D5) after administration. The cerebellum, hippocampus on the administration side, and parietal cortex on the administration side were respectively obtained and stored in RNAlater.

[0635] (2) Detection of inhibitory activity of target genes in various tissue samples

[0636] RNA extraction: Appropriate amounts of cerebellum, lateral hippocampus, and lateral parietal cortex samples were removed from RNAlater and disrupted in a Tissuelyser II fully automatic tissue homogenizer for 60 seconds. Total RNA was extracted from each tissue sample using a fully automatic nucleic acid extraction instrument and nucleic acid extraction kit from Zhejiang Hanwei Technology Co., Ltd. according to the instructions.

[0637] Reverse transcription reaction: 1 μg of total RNA was extracted from each tissue sample and reverse transcription was performed using the Promega Reverse Transcription System (A3500) and Oligo(dT) 15Prepare 20 μL of reverse transcription system according to the kit instructions for reverse transcription primers and complete the reverse transcription reaction. After the reaction is complete, add 80 μL of RNase-free water to the reverse transcription system to obtain the cDNA solution for real-time PCR detection.

[0638] Real-time PCR detection: using ABI SYBR TM Select Master Mix (Catalog number: 4472908) reagent, and prepare 20 μL Real-time PCR reaction system per PCR detection well according to the method described in the kit instructions. Each detection system contains 5 μL of cDNA template obtained by the above reverse transcription reaction, 10 μL SYBR TM Select Master Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer (primer information see Table 5), and 4 μL of RNase-Free H2O were added. The prepared reaction system was placed on an ABI StepOnePlus PCR instrument and amplified using a three-step real-time PCR protocol: 95°C pre-denaturation for 10 minutes, followed by 95°C denaturation for 30 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds. This denaturation, annealing, and extension cycle was repeated for 40 cycles. After completion, gene expression differences were calculated using the ΔΔCt method described above. The results are shown in Figure 1 and Table 6. The results showed that D5 of RZ899008 exhibited significant inhibitory effects on target genes across different brain regions, with the greatest inhibitory effect in the hippocampus (82.94%) and parietal cortex (73.57%). Inhibitory activity was also observed in the cerebellum (40.08%).

[0639] Table 5: Primer sequences of internal reference genes and target genes

[0640] Table 6: Inhibitory activity of target genes in various tissue samples

[0641] Test Example 2

[0642] Evaluation of the inhibitory activity of NM031-conjugated siRNA against SOD1 via intrathecal administration

[0643] (1) Animal grouping, drug administration, and tissue sample collection

[0644] 6-8 week old C57BL / 6j mice were randomly divided into 4 groups according to body weight. The PBS group was given PBS solution without siRNA, the RX899001 group was given carrier-free conjugated siRNA compound RX899001, the RZ899001 group was given siRNA RZ899001 prepared in Example 1 (Uhd conjugated at position 4 of the sense chain), and the RZ899008 group was given siRNA RZ899008 prepared in Example 1 (NM031 conjugated at position 4 of the sense chain). Each group of mice was anesthetized with isoflurane. After anesthesia, their waists were sprayed with 75% disinfectant alcohol. 10 μL of siRNA drug containing PBS solvent (concentration 80 μg / μL) was drawn with an insulin injection needle. The mouse's waist was pinched with the index finger and thumb of the left hand, and the patellar crest was supported. The needle was held in the right hand and bent with tweezers in advance. First, the middle was bent 80°-90°, and then the front half of the needle was bent again. The overall arc was about 60°-90°. The mouse's abdomen was padded with something about 2 cm thick. The needle was inserted from the junction of the mouse's lumbar vertebrae L5 and L6. The hand was slightly tilted forward when inserting the needle. After the needle was inserted, if the mouse's tail suddenly trembled or wagged, it meant that the needle was inserted correctly. At this time, the needle was turned forward or tilted forward. After it was fixed, the drug was injected. After the injection was completed, the needle was slowly and evenly withdrawn. Each mouse in the RX899001, RZ899001, and RZ899008 groups received an 800 μg dose in a total injection volume of 10 μL. The PBS group received the same volume of siRNA-free PBS solution. After awakening, the animals were returned to the animal housing facility for continued care. The day of dosing was designated Day 1 (D1). Mice were sacrificed on Day 9 (D9). Lumbar vertebrae, thoracic vertebrae, and cerebellum were harvested and stored in RNAlater.

[0645] (2) Detection of inhibitory activity of target genes in various tissue samples

[0646] RNA extraction: Take appropriate amounts of lumbar vertebrae, thoracic vertebrae, and cerebellum samples from RNAlater and disrupt them in a Tissuelyser II fully automatic tissue homogenizer for 60 seconds. Use the fully automatic nucleic acid extraction instrument and nucleic acid extraction kit from Zhejiang Hanwei Technology Co., Ltd. to extract total RNA from each tissue sample according to the instructions. Reverse transcription reaction: Take 1 μg of total RNA from each tissue sample and use the Promega Reverse Transcription System (A3500) and select Oligo(dT) 15 Prepare 20 μL of reverse transcription system according to the kit instructions for reverse transcription primers and complete the reverse transcription reaction. After the reaction is complete, add 80 μL of RNase-free water to the reverse transcription system to obtain the cDNA solution for real-time PCR detection.

[0647] Real-time PCR detection: using ABI SYBR TM Select Master Mix (Catalog number: 4472908) reagent, and prepare 20 μL Real-time PCR reaction system per PCR detection well according to the method described in the kit instructions. Each detection system contains 5 μL of cDNA template obtained by the above reverse transcription reaction, 10 μL SYBR TM Select Master Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer (primer information see Table 5), and 4 μL of RNase-Free H2O. The prepared reaction system was placed on an ABI StepOnePlus PCR instrument, and real-time PCR amplification was performed using a three-step method: pre-denaturation at 95°C for 10 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. The denaturation, annealing, and extension process was repeated for 40 cycles. After completion of the program, gene expression differences were calculated using the ΔΔCt method described above. The results are shown in Figures 2 to 4 and Table 7. The results showed that D9 of RZ899008 had a significant inhibitory effect on target genes in the lumbar spine, thoracic spine, and cerebellum, and the activity was superior to that of the control molecule RZ899001 and the carrier-free conjugated molecule RX899001. Among them, RZ899008 had the best inhibitory effect in the lumbar spine, with an inhibition rate of 80.09%; the inhibition rate in the thoracic spine was 78.99%; and it also had an inhibitory activity of 67.72% in the cerebellum.

[0648] Table 7: Inhibitory activity of target genes in various tissue samples

[0649] Test Example 3

[0650] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences on SOD1 via intracerebroventricular administration in mice

[0651] In this example, the target gene inhibitory activity assessment method for intracerebroventricular administration of mice was used to evaluate the inhibitory activity of lipid conjugates RZ899060 (conjugated to NM031 at position 4 of the sense chain), RZ899052 (conjugated to NM058 at position 5 of the sense chain), and RZ899053 (conjugated to NM058 at position 6 of the sense chain) with the same carbon chain length and different base sites on the target gene SOD1 in different regions of the mouse brain.

[0652] 6-8 week old C57BL / 6j mice were randomly divided into 4 groups according to body weight, with 5 mice in each group. Each group of mice was given the above-mentioned siRNA conjugate by intracerebroventricular administration, with a dose of 200 μg per mouse. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as day 0 (D0), and the mice were killed on D5 after administration. The hippocampus, cortex and cerebellum were taken separately and stored in RNAlater. RNA extraction, reverse transcription and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and the gene expression differences were calculated by the above-mentioned ΔΔCt method.

[0653] The PCR primers used in Test Example 3 are shown in Table 5 in Test Example 1.

[0654] The experimental results of Test Example 3 are shown in Figure 5 and Table 8. The results show that after administration, the D5 sense chain 4-position NM031 lipid conjugate RZ899060, 5-position and 6-position NM058 lipid conjugates RZ899052 and RZ899053 have a certain inhibitory effect on the target gene in the hippocampus, cortex and cerebellum, with the inhibitory activity reaching 70% or more in the hippocampus, 50% or more in the cortex, and more than 40% in the cerebellum; among them, the sense chain 4-position NM031 lipid conjugate has the best inhibitory activity, reaching more than 90% in the hippocampus and still maintaining an inhibitory activity of 56.11% in the cerebellum.

[0655] Table 8 Inhibitory activity of target genes in mouse brain after administration of siRNA of this test example

[0656] Test Example 4

[0657] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences with different carbon chain lengths on SOD1 in the mouse brain via intracerebroventricular administration

[0658] In this example, the target gene inhibitory activity assessment method of intracerebroventricular administration of mice was used to evaluate the inhibitory activity of siRNA sequences RZ899092, RZ899090, RZ899091, and RZ899077 conjugated to NM031 (C16) at position 4 of the sense chain, NM073 (C18), and NM074 (C20) at position 4 of the sense chain; and siRNA sequence RZ899078 conjugated to NM202 (C22) at position 6 of the sense chain, as well as carrier-free siRNA sequence RX599002, siRNA reference sequence RZ899093 conjugated to Uhd (C16) at position 4 of the sense chain, and siRNA reference sequence RZ899076 conjugated to NM200 (C22) at position 4 of the sense chain against the target gene SOD1 in the mouse brain.

[0659] 6-8 week old C57BL / 6j mice were randomly divided into 9 groups according to body weight, with 5 mice in each group. Each group of mice was given the above-mentioned siRNA conjugate by intracerebroventricular administration, with a dose of 150 μg per mouse. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as day 0 (D0), and the mice were killed on D5 after administration. The left and right brains were taken and stored in RNAlater respectively. RNA extraction, reverse transcription, and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and the gene expression differences were calculated by the above-mentioned ΔΔCt method.

[0660] The PCR primers used in Test Example 4 are shown in Table 5 in Test Example 1.

[0661] The experimental results of Test Example 4 are shown in Figure 6 and Table 9. The results show that at D5, NM031 (C16), NM073 (C18), and NM074 (C20) lipid conjugates all exhibited better left and right hemisphere inhibitory activity than the carrier-free siRNA sequence RX599002; among them, the NM073 (C18) lipid conjugate RZ899090 and the NM074 (C20) lipid conjugate RZ899091 were compared with the Uhd conjugated reference sequence RZ899093 and the NM200 (C22) conjugated reference sequence RZ899076. The activity in the right hemisphere (administered side) and the left hemisphere (non-administered side) was basically equivalent or better, especially the C20 lipid conjugate RZ899091, which exhibited better brain inhibitory activity. The C16 lipid conjugate RZ899092 showed similar activity to the Uhd-conjugated reference control sequence RZ899093 and the NM200(C22)-conjugated reference control sequence RZ899076 in the right hemisphere.

[0662] Table 9 Inhibitory activity of target genes in mice after administration of the siRNA conjugates of this test example

[0663] Test Example 5

[0664] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences against SOD1 via intrathecal administration in rats

[0665] In this example, the rat intrathecal administration target gene inhibitory activity evaluation method was used to evaluate the inhibitory activity of the siRNA sequence RZ899060 conjugated with NM031 at position 4 of the positive strand, the carrier-free siRNA sequence RZ899056, and the siRNA reference sequence RZ899055 conjugated with Uhd against the target gene SOD1 in the rat spinal cord and brain.

[0666] 6-8 week old SD rats were randomly divided into 4 groups according to body weight, with 5 rats in each group. Each group of rats was given the above-mentioned siRNA conjugate by intrathecal administration, with a dose of 900 μg per rat and a dosage of 40 μL. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as day 0 (D0), and the rats were killed on D7 after administration. Different spinal cord segments (lumbar, thoracic, cervical) and cerebral cortex, hippocampus, cerebellum and other tissues were taken and stored in RNAlater. RNA extraction, reverse transcription and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and the gene expression differences were calculated by the above-mentioned ΔΔCt method.

[0667] Table 10 Sequence list of PCR primers used in Test Example 5

[0668] The experimental results of Test Example 5 are shown in Figure 7 and Table 11. The results show that at D7, the NM031 conjugate RZ899060 was more active than the Uhd-conjugated reference sequence RZ899055 in the thoracic and cervical segments of the spinal cord, and was essentially equivalent to the reference sequence in the lumbar segment, with the inhibitory activity remaining above 80%. In the hippocampus and cortex of the brain, it was essentially equivalent to the reference sequence RZ899055.

[0669] Table 11 Inhibitory activity of target genes in rats after administration of the siRNA conjugates described in this test example

[0670] Test Example 6

[0671] Evaluation of the inhibitory activity of NM073 and NM074 conjugated siRNA sequences on SOD1 by intrathecal administration in rats

[0672] This test example used the rat intrathecal administration target gene inhibition activity assessment method to evaluate the inhibitory activity of siRNA sequence RZ899090 conjugated to NM073 at position 4 of the sense strand, siRNA sequence RZ899091 conjugated to NM074 at position 4 of the sense strand, and siRNA control sequence RZ899093 conjugated to Uhd against the target gene SOD1 in the rat spinal cord and brain. The difference between these conjugated vectors is that NM073 has a C18 fatty chain, while NM074 has a C20 fatty chain.

[0673] 6-8 week old SD rats were randomly divided into groups according to body weight, 5 in each group, a total of 4 groups. Each group of rats was given the above-mentioned siRNA conjugate by intrathecal administration, 900 μg of each dose, and 40 μL of administration volume. The PBS control group was given the same volume of siRNA conjugate-free PBS solution. The administration day was recorded as D0, and rats were killed at D28 after administration. Different spinal cord segments (lumbar segment, thoracic segment, cervical segment) and tissues such as cerebral cortex, hippocampus, cerebellum were taken respectively and stored in RNAlater. According to the above method, each tissue RNA was extracted, reverse transcribed, and detected by real-time fluorescence quantitative detection, and the gene expression difference was calculated by the above-mentioned ΔΔCt method, and the primers were as shown in Table 10 of Test Example 5.

[0674] The results of Test Example 6 showed that at D28, the NM074 conjugate (RZ899091) exhibited significant inhibitory activity in both the spinal cord and brain regions of rats, with superior target gene inhibition levels compared to the Uhd control conjugate (RZ899093) in the spinal cord, cerebellum, and hippocampus. The NM073 conjugate (RZ899090) exhibited comparable inhibition levels to the Uhd control conjugate in the spinal cord and cerebellum ( Figure 8 , Table 12).

[0675] Table 12 Inhibitory activity of target genes in rats after administration of the siRNA conjugates described in this test example

[0676] Test Example 7

[0677] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences against SOD1 in mouse adipose and muscle tissues

[0678] This test example used an in vivo target gene inhibition activity assessment method to evaluate the inhibitory activity of siRNA sequences RZ899090, RZ899091, and RZ899078 conjugated to NM073 at position 4 of the sense strand, as well as reference siRNA sequences RZ899093, RZ899076, and NM200 at position 4 of the sense strand, against the target gene SOD1. The differences between these conjugated vectors are that NM073 has a C18 fatty chain, NM074 has a C20 fatty chain, and NM0202 and NM0200 have a C22 fatty chain.

[0679] 6-8 week old C57BL / 6j mice were randomly divided into 6 groups according to body weight, with 15 mice in each group. Each group of mice was given the above-mentioned siRNA conjugate by tail vein injection, with a dose of 5 mg / kg per mouse and a dosage of 150 μL. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as D0, and 5 mice were killed in each group at D14, D28 and D49 after administration. Tissues such as paragonadal fat, left hind leg quadriceps, heart, liver, and kidney were taken and stored in RNAlater. RNA extraction, reverse transcription, and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and gene expression differences were calculated by the above-mentioned ΔΔCt method. The primers are shown in Table 5 of Test Example 1.

[0680] The results of Test Example 7 showed that in D14, D28 and D49 mouse heart tissue, the NM073 conjugated sequence RZ899090, the NM074 conjugated sequence RZ899091, and the NM202 conjugated sequence RZ899078 exhibited superior inhibitory activity compared with the Uhd-conjugated reference sequence RZ899093 and the NM200-conjugated reference sequence RZ899076 ( Figure 9 , Table 13).

[0681] Table 13 Inhibitory activity of target genes in mouse heart tissue after administration of the siRNA conjugates described in this test example

[0682] In mouse adipose tissue, at D14, the NM073 conjugated sequence RZ899090, the NM074 conjugated sequence RZ899091, and the NM202 conjugated sequence RZ899078 had comparable inhibitory activity compared with the NM200 conjugated reference sequence RZ899076. At D49, RZ899091 exhibited superior gene inhibition effects compared with RZ899076 ( Figure 10 , Table 14 ).

[0683] Table 14 Inhibitory activity of target genes in mouse adipose tissue after administration of the siRNA conjugates described in this test example

[0684] In mouse skeletal muscle tissue, NM073 conjugated sequence RZ899090, NM074 conjugated sequence RZ899091, and NM202 conjugated sequence RZ899078 all had certain inhibitory activity in this tissue site, among which NM202 conjugated sequence RZ899078 had the highest inhibitory activity in muscle, and could still maintain an inhibitory activity of about 57% at D49 ( Figure 11 , Table 15 ).

[0685] Table 15 Inhibitory activity of target genes in mouse skeletal muscle tissue after administration of the siRNA conjugates described in this test example

[0686] In addition, the gene inhibition test results of D28 and D49 showed that the NM073 conjugated sequence RZ899090, the NM074 conjugated sequence RZ899091, and the NM202 conjugated sequence RZ899078 had no inhibitory effect on liver and kidney tissues, which to some extent reflects the safety of these conjugates in non-target tissues ( Figure 12 , Figure 13 , Table 16 ).

[0687] Table 16 Relative expression levels of target genes in mouse liver and kidney tissues after administration of the siRNA conjugates described in this test example

[0688] Test Example 8

[0689] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences on the target gene SOD1 in different parts of mouse adipose tissue

[0690] This test example used the in vivo target gene inhibitory activity assessment method to evaluate the inhibitory activity of siRNA sequence RZ899090 conjugated to NM073 at position 4 of the sense chain, siRNA sequence RZ899091 conjugated to NM074 at position 4 of the sense chain, siRNA sequence RZ899078 conjugated to NM202 at position 6 of the sense chain, and siRNA reference sequence RZ899093 conjugated to Uhd at position 4 of the sense chain, and siRNA reference sequence RZ899076 conjugated to NM200 at position 4 of the sense chain against the target adipose tissue target gene SOD1 in mice.

[0691] 6-8 week old C57BL / 6j mice were randomly divided into 6 groups according to body weight, with 5 mice in each group. Each group of mice was given the above-mentioned siRNA conjugate by tail vein injection, with a dose of 5 mg / kg per mouse and a dosage volume of 150 μL. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as D0, and 5 mice were killed in each group on D14 after administration. Paragonadal fat, abdominal subcutaneous fat, and back brown fat were taken respectively. RNA extraction, reverse transcription, and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and the gene expression difference was calculated by the above-mentioned ΔΔCt method. The primers are shown in Table 5 of Test Example 1.

[0692] The results of Test Example 8 showed that the NM073 conjugated sequence RZ899090, the NM074 conjugated sequence RZ899091 and the NM200 conjugated reference sequence RZ899076 all exhibited equivalent or superior inhibitory activity in paragonadal fat and back brown fat; the inhibitory effects on target genes in subcutaneous fat were basically equivalent ( Figure 14 , Table 17 ).

[0693] Table 17 Relative expression levels of target genes in mouse adipose tissue after administration of the siRNA conjugates described in this test example

[0694] Test Example 9

[0695] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences against SOD1 in mouse muscle tissue

[0696] This test example used the in vivo target gene inhibition activity assessment method for mice to evaluate the inhibitory activity of the target gene SOD1 in muscle tissues of different parts of mice using siRNA sequence RZ899090 conjugated to NM073 at position 4 of the sense chain, siRNA sequence RZ899091 conjugated to NM074 at position 4 of the sense chain, siRNA sequence RZ899078 conjugated to NM202 at position 6 of the sense chain, and siRNA reference sequence RZ899093 conjugated to Uhd at position 4 of the sense chain, and siRNA reference sequence RZ899076 conjugated to NM200 at position 4 of the sense chain.

[0697] 6-8 week old C57BL / 6j mice were randomly divided into 6 groups according to body weight, with 5 mice in each group. Each group of mice was given the above-mentioned siRNA conjugate by tail vein injection, with a dose of 5 mg / kg per mouse and a dosage of 150 μL. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as D0, and 5 mice were sacrificed in each group on D14 after administration. The left hind leg quadriceps, diaphragm, and heart tissue were taken respectively and stored in RNAlater. According to the above method, RNA extraction, reverse transcription, and real-time fluorescence quantitative detection of each tissue were performed, and the gene expression differences were calculated by the above-mentioned ΔΔCt method. The primers are shown in Table 5 of Test Example 1.

[0698] The results of Test Example 9 showed that in cardiac tissue, NM073 conjugated sequence RZ899090, NM074 conjugated sequence RZ899091, and NM202 conjugated siRNA sequence RZ899078 all exhibited superior inhibitory activity compared with NM200 conjugated reference sequence RZ899076; they also had a certain inhibitory effect on the left quadriceps and diaphragm (Figure 15, Table 18).

[0699] Table 18 Relative expression levels of target genes in mice after administration of the siRNA conjugates described in this test example

[0700] Test Example 10

[0701] Evaluation of the inhibitory activity of siRNA conjugates on the target gene SOD1 in mouse adipose and heart tissues via different administration routes

[0702] This test example used the in vivo target gene inhibitory activity evaluation method to evaluate the inhibitory activity of the siRNA sequence RZ899090 conjugated with NM073 at position 4 of the positive strand on the target gene SOD1 in mice under different administration methods.

[0703] 6-8 week old C57BL / 6j mice were randomly divided into 4 groups according to body weight, with 5 mice in each group. Among them, 1 group of mice was given the above-mentioned siRNA conjugate by tail vein injection, with a dosage of 5 mg / kg and a dosage volume of 150 μL. 1 group was given the above-mentioned siRNA conjugate by subcutaneous administration, with a dosage of 5 mg / kg and a dosage volume of 5 ml / kg. The other 2 groups were used as PBS control groups, and the same volume of siRNA conjugate-free PBS solution was given by tail vein injection and subcutaneous administration, respectively. The day of administration was recorded as D0, and mice were killed on D14 after administration. Paragonadal fat and heart tissue were taken respectively and stored in RNAlater. According to the above method, RNA extraction, reverse transcription and real-time fluorescence quantitative detection of each tissue were performed, and gene expression differences were calculated by the above-mentioned ΔΔCt method, and the primers are shown in Table 5 of Test Example 1. The results of Test Example 10 showed that in D14 mouse heart tissue, the same dose of NM073 conjugated sequence RZ899090 administered via different administration routes had comparable inhibitory activity in the heart ( FIG. 16 , Table 19 ).

[0704] Table 19 Inhibitory activity of target genes in mouse heart tissue after administration of the siRNA conjugates described in this test example

[0705] In the adipose tissue of mice at D14, the same dose of NM073 conjugated sequence RZ899090 was administered via different routes, and the inhibitory activity in fat was comparable ( FIG. 17 , Table 20 ).

[0706] Table 20 Inhibitory activity of target genes in mouse adipose tissue after administration of the siRNA conjugates described in this test example

[0707] Test Example 11

[0708] Evaluation of the inhibitory activity of the target gene SOD1 in mouse adipose and heart tissues at different dosages of siRNA conjugates

[0709] This test example used the in vivo target gene inhibitory activity assessment method to evaluate the inhibitory activity of the siRNA sequence RZ899090 conjugated to position 4 of the positive strand NM073 on the target gene SOD1 in mice at different dosages.

[0710] 6-8 week old C57BL / 6j mice were randomly divided into 4 groups according to body weight, with 5 mice in each group. The mice were administered the above-mentioned siRNA conjugates by tail vein injection, wherein 1 group of mice was administered the above-mentioned siRNA conjugates at a dose of 5 mg / kg, 1 group of mice was administered the above-mentioned siRNA conjugates at a dose of 2 mg / kg, and 1 group was administered the above-mentioned siRNA conjugates at a dose of 0.5 mg / kg, and the administration volume was 150 μL. The remaining 1 group was given the same volume of PBS solution without siRNA conjugates as a PBS control group. The day of administration was recorded as D0, and the mice were killed on D14 after administration. Paragonadal fat and heart tissue were taken respectively and stored in RNAlater. RNA extraction, reverse transcription, and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and gene expression differences were calculated by the above-mentioned ΔΔCt method. The primers are shown in Table 5 of Test Example 1.

[0711] The results of Test Example 11 showed that in D14 mouse heart tissue, NM073 conjugated sequence RZ899090 exhibited certain inhibitory activity at different dosages, and had obvious dose dependence (Figure N, Table N).

[0712] Table 21 Inhibitory activity of target genes in mouse heart tissue after administration of the siRNA conjugates described in this test example

[0713] In the adipose tissue of D14 mice, NM073 conjugated sequence RZ899090 showed certain inhibitory activity at different dosages, and had obvious dose-dependence ( FIG. 19 , Table 22 ).

[0714] Table 22 Inhibitory activity of target genes in mouse adipose tissue after administration of the siRNA conjugates described in this test example

[0715] Test Example 12

[0716] Evaluation of the inhibitory activity of lipid-conjugated siRNA sequences against SOD1 in mouse eyes

[0717] This test example used the in vivo target gene inhibitory activity assessment method to evaluate the inhibitory activity of the siRNA sequence RZ899091 conjugated with NM074 at position 4 of the positive strand and the siRNA reference sequence RX899121 without a carrier conjugated against the target gene SOD1 in mice.

[0718] 6-8 week old C57BL / 6J mice were randomly divided into 3 groups according to body weight, with 5 mice in each group. Each group of mice was given the above-mentioned siRNA conjugate in the right eye of the mouse by intravitreal injection, with a dose of 7.5 μg per mouse and a dosing volume of 2 μL. The PBS control group was given the same volume of PBS solution without siRNA conjugate. The day of administration was recorded as D0, and the mice were killed on D14 after administration. Tissues such as the retina, choroid, cornea and sclera of the administrated side were taken respectively and stored in RNAlater. RNA extraction, reverse transcription and real-time fluorescence quantitative detection of each tissue were performed according to the above method, and the gene expression differences were calculated by the above-mentioned ΔΔCt method, and the primers are shown in Table 5 of Test Example 1.

[0719] The results of Test Example 12 showed that the NM074 conjugated sequence RZ899091 exhibited superior inhibitory activity compared to the vector-free reference sequence RX899121 in the retina and choroid of D14 mice ( FIG. 20 , Table 23 ).

[0720] Table 23 Inhibitory activity of target genes in mouse adipose tissue after administration of the siRNA conjugates described in this test example

[0721] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present disclosure. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification and features of different embodiments or examples, unless they are mutually inconsistent.

[0722] Although the embodiments of the present disclosure have been shown and described above, it is understood that the above embodiments are illustrative and are not to be construed as limitations on the present disclosure. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present disclosure. Industrial Applicability

[0723] The present disclosure provides a modified nucleoside analog and an oligonucleotide containing a nucleotide analog. The nucleoside analog and oligonucleotide can enhance the targeted delivery of drugs to nervous system cells, thereby increasing the rate of drug inhibition on the expression of specific genes in nervous system cells, thereby achieving effective prevention and / or treatment of pathological conditions or diseases caused by abnormal expression of specific genes in nervous system cells.

Claims

1. A nucleoside analogue, It is characterized in that The nucleoside analog is a compound represented by formula (Ia) or a prodrug thereof: Among them, R 1 Selected from H or a hydroxyl protecting group; R 2 is selected from H or a phosphorus-containing leaving group; B is selected from substituted or unsubstituted nucleoside bases, or substituted or unsubstituted nucleoside base analogs, and each substituent in B is independently halogen, C 1 -C 3 Alkyl, C 1 -C 3 Alkyloxy, or substituted iminoacyl; if there is an amino group in B, the amino group is protected with an amino protecting group; X is selected from O, S, NH or -NH-C(=O)-; L is selected from substituted or unsubstituted C 4 -C 12 The hydrocarbon group, each substituent in L is independently halogen, C 1 -C 3 Alkyl or C 1 -C 3 Alkoxy; p, q are each independently selected from 1, 2, 3 or 4; n is selected from 1, 2 or 3.

2. The nucleoside analog according to claim 1, It is characterized in that L is selected from substituted or unsubstituted linear or branched C 4 -C 12 alkenyl, or substituted or unsubstituted straight or branched chain C 4 -C 12 Alkyl, each substituent in L is independently selected from halogen, C 1 -C 3 Alkyl or C 1 -C 3 Alkoxy; Optionally, L is selected from substituted or unsubstituted C 4 -C 12 Straight chain alkyl, or substituted or unsubstituted C 4 -C 12 Straight chain alkenyl, each substituent in L is independently selected from halogen, C 1 -C 3 Alkyl or C 1 -C 3 Alkyloxy; Optionally, L is selected from C 4 -C 12 Straight chain alkyl or C 4 -C 12 Straight chain alkenyl; Optionally, L is selected from C 9 -C 12 Straight chain alkyl or C 9 -C 12 Straight chain alkenyl; Optionally, L is selected from C 9 -C 10 Straight chain alkyl or C 12 Straight chain alkenyl; Optionally, L is selected from any of the following structures: Optionally, L is selected from Optionally, L is selected from Optionally, L is selected from Optionally, X is selected from O or -NH-C(=O)-; Optionally, X is selected from O; Optionally, X is selected from -NH-C(=O)-; Optionally, X is selected from O, and L is selected from Optionally, X is selected from -NH-C(=O)-, and L is selected from Optionally, X is selected from -NH-C(=O)-, and L is selected from Optionally, n=1; Optionally, p and q are each independently selected from 1 or 2; Optionally, p=1 and q=1; Optionally, B is selected from a nucleoside base or a nucleoside base analog, and if an amino group exists in B, the amino group is protected with an amino protecting group; Optionally, the nucleobase is selected from cytosine, adenine, guanine, thymine, or uracil; Optionally, the nucleoside base analog is selected from hypoxanthine 9-yl, purine 9-yl, 2-aminopurine 9-yl, 2,4-difluoro-5-methylphenyl, 5-nitroindole 1-yl, 3-nitropyrrole 1-yl, 4-fluoro-6-methylbenzimidazole 1-yl, or 4-methylbenzimidazole 1-yl; Optionally, the amino protecting group is selected from an alkoxycarbonyl amino protecting group, an acyl amino protecting group or an alkyl amino protecting group; Optionally, the amino protecting group is selected from acyl amino protecting groups; Optionally, the acyl amino protecting group is selected from phthaloyl (Pht), p-toluenesulfonyl (Tos), trifluoroacetyl (Tfa), o-(or p-)nitrobenzenesulfonyl (Ns), pivaloyl (Piv), acetyl (Ac) or benzoyl (Bz); Optionally, the amino protecting group is selected from benzoyl; Optionally, B is selected from any of the following structures: Optionally, B is selected from Optionally, B is selected from Optionally, B is selected from Optionally, B is selected from Optionally, B is selected from Optionally, the hydroxy protecting group is selected from trityl, 4-methoxytrityl, 4,4'-dimethoxytrityl or 4,4',4"-trimethoxytriphenyl; Optionally, the hydroxy protecting group is selected from 4,4'-dimethoxytrityl; Optionally, the phosphorus-containing leaving group is selected from Optionally, the phosphorus-containing leaving group is selected from Optionally, the phosphorus-containing leaving group is selected from 3. The nucleoside analog according to any one of claims 1 to 2, It is characterized in that The nucleoside analog is a compound represented by formula (IIa) or a prodrug thereof:

4. The nucleoside analog according to any one of claims 1 to 2, It is characterized in that The nucleoside analog is a compound represented by formula (IIIa) or a prodrug thereof:

5. The nucleoside analog according to any one of claims 1 to 2, It is characterized in that The nucleoside analog is a compound represented by formula (IVa) or a prodrug thereof:

6. The nucleoside analog according to claim 1, It is characterized in that The nucleoside analog is selected from the following compounds of any structure:

7. A nucleoside analogue, It is characterized in that The nucleoside analog is selected from the compounds represented by formula (Ib), formula (Ic) or formula (Id) or their prodrugs: Wherein, B' is selected from substituted or unsubstituted nucleoside bases or substituted or unsubstituted nucleoside base analogs; each substituent in B' is independently halogen, C 1 -C 3 Alkyl, C 1 -C 3 Alkyloxy, or substituted iminoyl; if there is an amino group in B', the amino group is not protected; p, q, n, X and L are respectively the same as p, q, n, X and L defined in any one of claims 1 to 6.

8. The nucleoside analog according to claim 7, It is characterized in that B' is selected from a nucleoside base; Optionally, B' is selected from Optionally, B' is selected from Optionally, B' is selected from Optionally, B' is selected from Optionally, B' is selected from Optionally, B' is selected from 9. The nucleoside analogue according to any one of claims 7 to 8, It is characterized in that The nucleoside analog is selected from the compounds represented by formula (IIb), formula (IIc) or formula (IId) or their prodrugs:

10. The nucleoside analog according to any one of claims 7 to 8, It is characterized in that The nucleoside analog is selected from the compounds represented by formula (IIIb), formula (IIIc) or formula (IIId) or their prodrugs:

11. The nucleoside analog according to claim 7, It is characterized in that The nucleoside analog is selected from any of the following structures:

12. Use of the nucleoside analogue according to any one of claims 1 to 11 in the preparation of oligonucleotides; Optionally, the oligonucleotide is selected from a single-stranded oligonucleotide or a double-stranded oligonucleotide; Optionally, the oligonucleotide is selected from a single-stranded oligonucleotide; Optionally, the oligonucleotide is selected from a double-stranded oligonucleotide; Optionally, the single-stranded oligonucleotide is an antisense oligonucleotide, a nucleic acid aptamer, a ribozyme, a deoxyribozyme, a circular RNA, a sense strand of siRNA, or an antisense strand of siRNA; Optionally, the double-stranded oligonucleotide is a small interfering RNA, a double-stranded RNA, a microRNA, a small guide RNA, a small activating RNA and or a short hairpin RNA; Optionally, the oligonucleotide is selected from siRNA.

13. A double-stranded oligonucleotide, It is characterized in that The double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the antisense strand has a complementary region of at least partial base pairing with the sense strand, and the sense strand and / or the antisense strand comprises at least one nucleoside analogue according to any one of claims 7 to 11; Optionally, the sense strand and the antisense strand are each independently 15-25 nucleotides in length; Optionally, the antisense strand does not comprise the nucleoside analog, and the sense strand comprises one of the nucleoside analogs; Optionally, the nucleoside analog is located at position 2-8 of the sense strand starting from the 5' end; Optionally, the nucleoside analog is located at position 3-7 of the sense strand starting from the 5' end; Optionally, the nucleoside analog is located at position 4-6 of the sense strand starting from the 5' end; Optionally, the nucleoside analog is located at the 4th position of the sense strand starting from the 5' end; Optionally, the nucleoside analog is located at the 5th position of the sense strand starting from the 5' end; Optionally, the nucleoside analog is located at the 6th position of the sense strand starting from the 5' end; Optionally, the double-stranded oligonucleotide is selected from siRNA.

14. A composition, It is characterized in that The composition comprises: the double-stranded oligonucleotide of claim 13; Optionally, the composition further comprises one or more pharmaceutically acceptable carriers or excipients.

15. Use of the nucleoside analogue according to any one of claims 1 to 11, the double-stranded oligonucleotide according to claim 13 or the composition according to claim 14 in the preparation of a medicament for treating and / or preventing a pathological condition or disease caused by abnormal expression of a specific gene in a nervous system cell.

16. A method for inhibiting the expression of a specific gene in a target cell, It is characterized in that The method comprises: contacting the double-stranded oligonucleotide of claim 13 or the composition of claim 14 with the target cell; Optionally, the target cell is selected from cells of the nervous system.

17. A method for preventing and / or treating a pathological condition or disease caused by abnormal expression of a specific gene in a target cell, It is characterized in that The method comprises: administering a pharmaceutically acceptable dose of the double-stranded oligonucleotide of claim 13 or the composition of claim 14 to a subject; Optionally, the target cell is selected from cells of the nervous system.

18. A double-stranded oligonucleotide, It is characterized in that The double-stranded oligonucleotide comprises a sense strand and an antisense strand, each strand having 17-25 modified and / or unmodified nucleotides, and the antisense strand is complementary to the sense strand to form a duplex region; the sense strand and / or the antisense strand comprises at least one nucleotide analogue represented by formula (100), or a tautomer, a stereoisomer, or a pharmaceutically acceptable salt thereof: in, represents the covalent bond site between the nucleotide analog and the adjacent nucleotide; B is selected from unsubstituted or substituted nucleoside bases, or unsubstituted or substituted nucleoside base analogs; if B contains a substituent group, the substituent group is independently selected from halogen, C 1 -C 3 Alkyl, C 1 -C 3 Alkyloxy, or iminoyl; L' is selected from substituted or unsubstituted C 16 -C 24 If the L' contains a substituent group, the substituent group is independently selected from halogen, C 1 -C 3 Alkyl or C 1 -C 3 Alkoxy; p is selected from 1, 2, 3 or 4; q is selected from 1, 2, 3 or 4; n is selected from 1, 2 or 3; Z is selected from hydroxyl or mercapto.

19. The double-stranded oligonucleotide according to claim 18, It is characterized in that The sense strand and / or the antisense strand comprises at least one nucleotide analogue represented by formula (200) or a tautomer thereof, or a pharmaceutically acceptable salt thereof: Here, the definitions of the substituents are the same as those in formula (100).

20. The double-stranded oligonucleotide according to claim 18 or 19, It is characterized in that B is selected from the nucleoside base A, U, G, C or T, or an analog of said nucleoside base; Wherein, L' is selected from saturated or unsaturated C 18 -C 22 Hydrocarbyl; p is selected from 1 or 2; q is selected from 1 or 2; n is selected from 1 or 2; Z is selected from hydroxyl or mercapto; Optionally, L' is selected from saturated C 18 -C 22 alkyl; Optionally, L' is selected from saturated C 18 , C 19 , C 20 , C 21 or C 22 Straight chain alkyl; Optionally, n is selected from 1.

21. The double-stranded oligonucleotide according to claim 20, It is characterized in that The nucleotide analog is selected from any of the following structures, or its tautomer, or its pharmaceutically acceptable salt:

22. The double-stranded oligonucleotide according to any one of claims 18 to 21, It is characterized in that The sense strand comprises one or two nucleotide analogs; optionally, the sense strand comprises one nucleotide analog; Optionally, the nucleotide analog is located at the 5' end of the sense strand, or at the 3' end of the sense strand, or at an internal position between the 5' end and the 3' end of the sense strand; Optionally, the nucleotide analog is located at any position from position 2 to position 19 of the sense strand starting from the 5' end; Optionally, the nucleotide analog is located at the 5' end or the 3' end of the sense strand; Optionally, the nucleotide analog is located at any position from position 2 to position 8 of the sense strand starting from the 5' end; Optionally, the nucleotide analog is located at any position between the 4th and 6th positions of the sense strand starting from the 5' end; Optionally, the length of the sense strand and the antisense strand are each independently selected from 19-23 nucleotides; Optionally, the antisense strand comprises 1-3 phosphorothioate diester bonds at the 5' terminus and 1-3 phosphorothioate diester bonds at the 3' terminus; and / or, the sense strand comprises 1-3 phosphorothioate diester bonds at the 5' terminus; Optionally, the antisense strand does not comprise the nucleotide analogs, and the antisense strand is substantially reverse complementary, essentially reverse complementary, or completely reverse complementary to a nucleotide sequence in the mRNA expressed by the target gene.

23. A double-stranded oligonucleotide according to any one of claims 18 to 22, It is characterized in that The other nucleotides in the double-stranded oligonucleotide except the nucleotides replaced by the nucleotide analogs are all modified, and are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides and 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides; Optionally, in the direction from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14 and 16 of the antisense strand are selected from 2'-fluoro-modified nucleotides; and / or, the nucleotides at positions 7 and 9 of the sense strand are selected from 2'-fluoro-modified nucleotides; Optionally, in the direction from the 5' end to the 3' end, at least three nucleotides in positions 7 to 10 of the sense strand are selected from 2'-fluoro-modified nucleotides; and / or, at least four nucleotides in positions 2, 6, 9, 12, 14 and 16 of the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotide at position 15 is selected from 2'-O-methoxyethyl or 2'-O-methyl modified nucleotides; Optionally, in the direction from the 5' end to the 3' end, at least three nucleotides in positions 7-10 of the sense strand are selected from 2'-fluoro-modified nucleotides, and one nucleotide in positions 2-8 is selected from the nucleotide analog; and / or, at least four nucleotides in positions 2, 6, 9, 12, 14 and 16 of the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotide in position 15 is selected from 2'-O-methoxyethyl-modified nucleotides or 2'-O-methyl-modified nucleotides; and the nucleotides in the remaining positions are selected from 2'-O-methyl-modified nucleotides; Optionally, in the direction from the 5' end to the 3' end, the nucleotides at positions 7-10 in the sense strand are selected from 2'-fluoro-modified nucleotides, and one nucleotide at positions 4-6 is selected from the nucleotide analogs; and / or, at least five nucleotides at positions 2, 6, 9, 12, 14 and 16 in the antisense strand are selected from 2'-fluoro-modified nucleotides, and the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides; and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides.

24. A composition, It is characterized in that The composition comprises the double-stranded oligonucleotide according to any one of claims 18 to 23.

25. Use of the double-stranded oligonucleotide according to any one of claims 18 to 23 or the composition according to claim 24 in the preparation of a medicament for treating and / or preventing a pathological condition or disease caused by abnormal expression of a specific gene in a nervous system cell.

26. A pharmaceutical composition, It is characterized in that The pharmaceutical composition comprises the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24; Optionally, the composition further comprises one or more pharmaceutically acceptable carriers or excipients.

27. A method for reducing gene expression in a target cell, It is characterized in that The method comprises: contacting the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24 and / or the pharmaceutical composition according to claim 26 with the target cell; Optionally, the target cell is selected from cells of the nervous system.

28. A method for preventing and / or treating a pathological condition or disease caused by abnormal expression of a specific gene in a target cell, It is characterized in that The method comprises: administering to a subject a pharmaceutically acceptable dose of the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24 and / or the pharmaceutical composition according to claim 26; Optionally, the target cell is selected from cells of the nervous system.

29. A method for reducing the expression of a target gene in a subject, the method include: Administering the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24 and / or the pharmaceutical composition according to claim 26 to a subject; Optionally, the method comprises intrathecal administration; Optionally, the method reduces expression of the target gene in brain or spinal tissue; Optionally, the brain or spinal tissue includes, but is not limited to, tissue selected from the group consisting of: cortex, cerebellum, cervical spine, lumbar spine, and thoracic spine.

30. A method of treating a subject suffering from a disease or condition associated with a CNS disorder, the method include: Administering a therapeutically effective amount of the double-stranded oligonucleotide of any one of claims 18 to 23 and / or the composition of claim 24 and / or the pharmaceutical composition of claim 26 to the subject, thereby treating a CNS disorder-related disease or condition in the subject; Optionally, the CNS disorder is selected from the group consisting of Parkinson's disease, amyotrophic lateral sclerosis (ALS), diffuse Lewy body disease, Parkinson's disease dementia, Huntington's disease, multiple system atrophy, Alzheimer's disease and other neurodegenerative diseases; Optionally, the subject is selected from humans.

31. A kit comprising the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24 and / or the pharmaceutical composition according to claim 26.

32. A method for inhibiting the expression of a target gene in skeletal muscle cells, eye cells, cardiomyocytes or adipocytes, It is characterized in that The method comprises: contacting cells with the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24 and / or the pharmaceutical composition according to claim 26.

33. A method for preventing and / or treating a disease or condition associated with skeletal muscle, myocardium, eye or adipose tissue, It is characterized in that The method comprises: administering to the subject a therapeutically effective amount of the double-stranded oligonucleotide according to any one of claims 18 to 23 and / or the composition according to claim 24 and / or the pharmaceutical composition according to claim 26, thereby treating the subject; Optionally, the subject is a human.

34. The method of claim 33, It is characterized in that The skeletal muscle-related disease or disorder is muscular dystrophy; Optionally, the muscular dystrophy is selected from the group consisting of Duchenne muscular dystrophy, myotonic muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy and Emery-Dreifuss muscular dystrophy, myostatin-related muscle hypertrophy, congenital myasthenic syndrome and facioscapulohumeral muscular dystrophy (FSHD).

35. The method of claim 33, It is characterized in that The myocardial related diseases or disorders are composed of the following group consisting of: obstructive hypertrophic cardiomyopathy (HOCM); familial hypertrophic cardiomyopathy (FHC); heart failure with preserved ejection fraction (HFPEF); atrial fibrillation (AFIB); ventricular fibrillation (VFIB); angina pectoris; myocardial infarction (MI); heart failure or heart failure with reduced ejection fraction (HFREF); supraventricular tachycardia (SVT); hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), arrhythmias and congestive heart failure (CHF).

36. The method of claim 33, It is characterized in that The adipose tissue-related disease or disorder is a metabolic disease; Optionally, the metabolic disease is selected from the group consisting of a lipid metabolism disorder, hypertension, a cardiovascular disease or an excess weight related disorder.

37. The method of claim 33, It is characterized in that The eye-related disease or condition is selected from the group consisting of: glaucoma (including but not limited to primary open-angle glaucoma, secondary glaucoma, pigmentary glaucoma, pseudoexfoliation glaucoma, traumatic glaucoma, neovascular glaucoma, uveitic glaucoma, eye conditions of angle-closure glaucoma, normal-tension glaucoma, juvenile open-angle glaucoma, primary open-angle glaucoma), iridocorneal endothelial syndrome, macular degeneration, cataract, diabetic retinopathy, dry eyes, night blindness, strabismus, nystagmus, color blindness, uveitis, eye inflammation, presbyopia, retinal diseases, corneal diseases, diabetic macular edema, ocular hypertension, astigmatism, diabetic eye disease, hyperopia, myopia, macular edema.

38. The method according to any one of claims 32 to 37, It is characterized in that The double-stranded oligonucleotide agent is administered to the subject, wherein the administration is selected from the group consisting of: subcutaneous administration, intramuscular administration, intravenous administration, intraperitoneal administration, or intravitreal administration.

39. The method according to claim 38, It is characterized in that Administration of the double-stranded oligonucleotide agent results in target gene expression of no more than 40%, no more than 50%, no more than 60%, or no more than 70% of that without administration.

Images