CD59 gene silenced T cell and application thereof

Abstract

A method of promoting T cell proliferation and function by intracellular CD59 is provided, comprising silencing the CD59 gene in a T cell. The invention also provides a nucleic acid molecule interfered by the CD59 gene, and a target sequence in the CD59 gene is shown as SEQ ID NO: 1. Gene editing is carried out through shRNA (short hairpin ribonucleic acid), siRNA (small interfering ribonucleic acid) or a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) technology, and human CD59 gene expression is silenced by sgRNA of a specific targeting CD59 gene. The constructed lentiviral vector realizes hereditary silencing of the CD59 gene in the T cell, and the expression level of the CD59 in the edited T cell is obviously reduced, so that the cell proliferation is obviously accelerated, the cell factor release is obviously increased, the function is obviously enhanced, and a new strategy is provided for the treatment of tumors and immune diseases.

Description

CD59 gene silenced T cell and its application Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to a method for promoting T cell proliferation and function, a CD59 gene-silenced T cell, and an inhibitor capable of silencing the CD59 gene in T cells. Background Art

[0002] The complement system is a crucial component of innate immunity and a key regulator of acquired immunity, serving as a bridge between innate and adaptive immunity. CD59 is a key complement membrane regulatory protein, anchored to the cell membrane via glycosylphosphatidylinositol (GPI). With a molecular weight of 18-20 kDa, it binds to complement C8 and C9, preventing the formation of the membrane attack complex (MAC) and inhibiting complement activation at the terminal stage of the complement cascade. Humans have one gene encoding CD59, while mice have two genes: mCd59a and mCd59b. These genes have similar functions but differ in their tissue expression and localization. mCd59a and mCd59b share 85% and 63% homology at the nucleotide and amino acid levels, respectively. mCd59a is highly expressed in various tissues, including the heart, kidney, and lung, while mCd59b is primarily expressed in the mouse testis. mCd59a is considered the mouse ortholog of human CD59. CD59 is widely expressed on normal cell membranes and plays a crucial role in protecting tissues from complement attack. However, studies have found that CD59 is abnormally highly expressed in tumor cells, potentially helping them evade complement attack. Potential therapeutic targets targeting CD59 include inhibition of CD59 with the recombinant inhibitor rILYd4 in complement-dependent cytotoxicity (CDC)-resistant lymphoma cell lines, and combined with rituximab in vitro and in vivo, demonstrating synergistic effects. Other studies have reported that neutralizing CD59 with specific antibodies can enhance the anti-tumor effect of anti-tumor drugs, and bispecific antibodies that recognize both CD59 and CD20 can improve the antibody immunotherapy effect of chronic lymphocytic leukemia. In addition to complement-related functions, CD59 also plays a complement-independent function. It is reported that CD59 is associated with T cell immune response in a membrane-bound form. Cross-linking of CD59 with its specific antibodies can activate intracellular calcium ion flow, and PMA treatment can promote T cell proliferation and IL-2 production. In the virus-specific mouse CD4 + The immune response was significantly enhanced in T cells, which was independent of complement activation and required the presence of APCs, suggesting that an unknown ligand expressed on the surface of APCs binds to CD4+ The above studies mainly focus on CD59 expressed on the cell membrane, while studies on CD59 inside cells are rare.

[0003] Existing technologies demonstrate that gene editing of T cells offers a new approach for treating cancer and autoimmune diseases. Designing shRNA, siRNA, or sgRNA targeting CD59 can downregulate CD59 expression through gene silencing, thereby promoting T cell proliferation and enhancing T cell function by enhancing Ras signaling. This technology offers valuable insights into improving immunotherapy, as it targets CD59 within the cell rather than on the cell membrane.

[0004] Summary of the Invention

[0005] The present application provides a method for modifying T cells, a reagent for modifying T cells, an engineered T cell, and applications thereof. The method and engineered T cell described herein have one or more uses selected from the following groups: (1) preparing a drug for treating tumors; (2) improving the ability of T cells to secrete cytokines; (3) improving the killing efficiency of T cells; (4) increasing the expansion multiple of T cells; and (5) prolonging the survival time of T cells.

[0006] The expression of CD59 in the engineered T cells described in this application is significantly reduced, and their immunological function is significantly enhanced, providing new methods and ideas for the treatment of tumors and immune diseases.

[0007] In one aspect, the present application provides a method for promoting T cell proliferation, which comprises inhibiting the expression, function and / or activity of CD59 molecules in T cells.

[0008] On the other hand, the present application provides a method for promoting cytokine secretion in T cells, which comprises inhibiting the expression, function and / or activity of CD59 molecules in T cells.

[0009] In certain embodiments, the CD59 molecule is an intracellular CD59 molecule.

[0010] In certain embodiments, the method comprises administering a CD59 inhibitor to the T cells.

[0011] In certain embodiments, the method comprises knocking down / silencing the CD59 gene in T cells.

[0012] In certain embodiments, the CD59 inhibitor comprises a nucleic acid molecule, a protein, a small molecule compound and / or PROTAC technology.

[0013] In certain embodiments, the CD59 inhibitor comprises a nucleic acid molecule that targets the CD59 gene.

[0014] In certain embodiments, the CD59 inhibitor is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.

[0015] In certain embodiments, the nucleic acid molecule targeting the CD59 gene includes shRNA, siRNA and / or sgRNA.

[0016] In certain embodiments, the CD59 inhibitor targets a target sequence of the CD59 gene in T cells, and the target sequence of the CD59 gene is shown in SEQ ID NO: 1.

[0017] In certain embodiments, the siRNA comprises the sequence shown in any one of SEQ ID NOs: 28-32 or a sequence that differs therefrom by no more than 3 nucleotides.

[0018] In certain embodiments, the siRNA comprises one or more modified nucleotides.

[0019] In certain embodiments, the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sense strand segment and the antisense strand segment contain complementary regions.

[0020] In certain embodiments, the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7 or a sequence that differs therefrom by no more than 3 nucleotides.

[0021] In certain embodiments, the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13 or a sequence that differs therefrom by no more than 3 nucleotides.

[0022] In certain embodiments, the sense strand and / or antisense strand of the shRNA independently comprises one or more modified nucleotides.

[0023] In certain embodiments, the method comprises editing the target gene using a CRISPR / Cas system.

[0024] In certain embodiments, the nucleic acid molecule comprises an sgRNA.

[0025] In certain embodiments, the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.

[0026] On the other hand, the present application provides a CD59 inhibitor that can inhibit the function and / or activity of the CD59 molecule in T cells. The CD59 inhibitor targets the target sequence of the CD59 gene in T cells, and the target sequence of the CD59 gene is shown in SEQ ID NO: 1.

[0027] In certain embodiments, the CD59 inhibitor targets a target sequence in the nucleotide region 82-165 of SEQ ID NO:1.

[0028] In certain embodiments, the CD59 inhibitor targets a target sequence in the nucleotide region 248-294 of SEQ ID NO:1.

[0029] In certain embodiments, the CD59 inhibitor targets a target sequence in the nucleotide region 248-269 of SEQ ID NO:1.

[0030] In certain embodiments, the CD59 inhibitor comprises a nucleic acid molecule capable of knocking down / silencing the CD59 gene.

[0031] In certain embodiments, the CD59 inhibitor is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.

[0032] In certain embodiments, the CD59 inhibitor comprises shRNA, siRNA and / or sgRNA.

[0033] In certain embodiments, the shRNA, siRNA and / or sgRNA is identical to or complementary to any continuous fragment of 16-35 nucleotides in length of the sequence shown in SEQ ID NO: 1.

[0034] In certain embodiments, the siRNA comprises the sequence shown in any one of SEQ ID NOs: 28-32 or a sequence that differs therefrom by no more than 3 nucleotides.

[0035] In certain embodiments, the siRNA comprises one or more modified nucleotides.

[0036] In certain embodiments, the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7, 9-13, and 16-27.

[0037] In certain embodiments, the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sense strand segment and the antisense strand segment contain complementary regions.

[0038] In certain embodiments, the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7 or a sequence that differs therefrom by no more than 3 nucleotides.

[0039] In certain embodiments, the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13 or a sequence that differs therefrom by no more than 3 nucleotides.

[0040] In certain embodiments, the sense strand and / or antisense strand of the shRNA independently comprises one or more modified nucleotides.

[0041] In certain embodiments, the modification comprises chemical modification.

[0042] In certain embodiments, the stem-loop of the shRNA comprises a nucleotide sequence represented by either CTCGAG or GAGCTC.

[0043] In certain embodiments, the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.

[0044] In certain embodiments, the CD59 inhibitor comprises an expression vector of the shRNA, siRNA and / or sgRNA.

[0045] In certain embodiments, the expression vector comprises a viral vector.

[0046] In certain embodiments, the viral vector comprises a lentiviral vector, a retroviral vector, or an adeno-associated viral vector.

[0047] In certain embodiments, the preparation of the shRNA expression vector comprises the following steps:

[0048] (1) designing the shRNA according to the CD59 gene as shown in SEQ ID NO: 1;

[0049] (2) Inserting the shRNA into an expression vector.

[0050] In certain embodiments, the shRNA is inserted into the XhoI and Agel restriction sites of the expression vector.

[0051] In certain embodiments, the CD59 inhibitor comprises a recombinant lentivirus, which is prepared by co-transfecting mammalian cells with the expression vector and a packaging helper plasmid.

[0052] In certain embodiments, the CD59 inhibitor comprises a host cell transfected with at least one CD59 inhibitor described herein.

[0053] On the other hand, the present application provides a method for inhibiting the expression, function and / or activity of CD59 molecules in T cells, comprising: contacting the T cells with the CD59 inhibitor.

[0054] On the other hand, the present application provides a method for silencing the CD59 gene in T cells, comprising: contacting the T cells with the CD59 inhibitor.

[0055] On the other hand, the present application provides an engineered T cell, wherein the expression, function and / or activity of the CD59 molecule of the engineered T cell is reduced compared with unengineered T cells.

[0056] In certain embodiments, the CD59 gene of the engineered T cells is knocked down or silenced.

[0057] In certain embodiments, the engineering approach comprises silencing the CD59 gene in the T cells by targeting a target sequence in the CD59 gene through antisense RNA, antagomiR, siRNA, shRNA, large-range nuclease, zinc finger nuclease, transcription activator-like effector nuclease and / or CRISPR system.

[0058] In certain embodiments, the CRISPR / Cas9 system can be used to silence the CD59 gene of the T cells.

[0059] In certain embodiments, the CRISPR / Cas9 system comprises sgRNA.

[0060] In certain embodiments, the sgRNA targets a target sequence in the CD59 gene, and the target sequence in the CD59 gene is shown in SEQ ID NO: 1.

[0061] In certain embodiments, the sgRNA is identical to or complementary to any continuous fragment of 16-35 nucleotides in length in the sequence shown in SEQ ID NO: 1.

[0062] In certain embodiments, the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.

[0063] In certain embodiments, the siRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 28-32.

[0064] In certain embodiments, the shRNA comprises a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, wherein the sense strand fragment and the antisense strand fragment contain complementary regions.

[0065] In certain embodiments, the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7.

[0066] In certain embodiments, the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13.

[0067] In certain embodiments, the stem-loop structure of the shRNA comprises a nucleotide sequence represented by either CTCGAG or GAGCTC.

[0068] In certain embodiments, the engineered cells have one or more of the following properties:

[0069] (1) Compared with unengineered T cells, the ability to secrete cytokines is enhanced;

[0070] (2) enhanced tumor cell killing efficiency compared with unengineered T cells;

[0071] (3) enhanced expansion capacity compared to unengineered T cells; and

[0072] (4) Compared with unengineered T cells, the survival time in the body is enhanced.

[0073] On the other hand, the present application also provides a pharmaceutical composition comprising the CD59 inhibitor, and / or the engineered cells, and optionally a pharmaceutically acceptable carrier.

[0074] On the other hand, the present application also provides the use of the CD59 inhibitor, the engineered cells, and / or the pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease and / or condition.

[0075] In certain embodiments, the disease and / or condition comprises a tumor.

[0076] In certain embodiments, the disease and / or condition comprises an immunodeficiency disorder.

[0077] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

[0079] Figures 1A-1D show the tumor size in the subcutaneous tumor-bearing model of WT / mCd59ab-KO mice;

[0080] Figures 2A-2C show the liver metastasis of tumor cells in the spleen-liver metastasis model of WT / mCd59ab-KO mice;

[0081] Figures 3A-3B show T cell detection in a subcutaneous lung cancer tumor model in WT / mCd59ab-KO mice;

[0082] Figures 4A-4C show T cell-mediated anti-tumor immunity in mCd59ab-KO mice;

[0083] Figures 5A-5N show that in primary mouse T cells, mCd59ab knockout enhances T cell activation, cytokine release, and cell proliferation;

[0084] Figure 6 shows the pLKO.1-shRNA vector map and multiple cloning restriction enzyme sites;

[0085] Figures 7A-7D show the detection of CD59 expression in Jurkat T cells and human peripheral blood T cells transfected with pLKO.1-shCD59;

[0086] Figures 8A-8D show the expression of activation marker CD69 and cytokines in Jurkat T cells and human peripheral blood T cells transfected with pLKO.1-shCD59;

[0087] Figures 9A-9E show that CD59 interacts with Ras in Jurkat cells and that knocking down CD59 affects the localization of Ras in the Golgi apparatus;

[0088] Figures 10A-10C show the activation of the MAPK signaling pathway in Jurkat T cells and human peripheral blood T cells transfected with pLKO.1-shCD59, as detected by Western Blot or flow cytometry;

[0089] Figure 11 shows a diagram of the CD59 negative regulatory T cell model;

[0090] ns means no significant difference, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. DETAILED DESCRIPTION

[0091] The following describes the implementation of the present invention through specific embodiments. People familiar with this technology can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0092] Definition of terms

[0093] In this application, the term "T cell" generally refers to a thymus-derived cell. T cells can participate in various cell-mediated immune responses. Including thymocytes, naive T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes or activated T lymphocytes. T cell populations can include but are not limited to helper T cells (HTL; CD4+ T cells), cytotoxic T cells (CTL; ​​CD8+ T cells), CD4+CD8+ T cells, CD4-CD8- T cells or any other subpopulation of T cells.

[0094] In the present application, the "sequence" should be understood to include sequences that are substantially identical to the sequences of the present application. The term "substantially identical sequence" means that after optimal alignment, such as using the GAP or BESTFIT program with default gap values ​​to determine whether the two sequences have at least 80%, 83%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, and have the same or similar function, or are protein / nucleotide sequences with the same or similar function obtained by deletion, substitution or addition of one or more amino acids / nucleotides to the sequence.

[0095] In this application, the term "gene knockdown" generally refers to a technique that utilizes small RNAs to efficiently and specifically bind to and degrade intracellular mRNAs containing sequences homologous to the small RNAs, thereby blocking the expression of target genes in cells. After the mRNA is degraded, the cell exhibits a phenotype indicating the loss of the target gene.

[0096] In this application, the term "interfering RNA" generally includes shRNA and siRNA, both of which can reduce protein expression at the RNA level. shRNA and siRNA lead to a decrease in target gene mRNA through similar mechanisms. The difference between the two is that siRNA can directly target the target gene without processing, while shRNA contains a neck loop structure. Generally, after expression in the cell nucleus, it is processed by intracellular proteins and transported to the cytoplasm. In the cytoplasm, shRNA binds to Dicer to remove the loop sequence, then binds to RISC and removes one of the RNA strands, ultimately recognizing the target gene mRNA and causing its degradation.

[0097] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or their analogs) of any length. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents and primers. Polynucleotides can be modified or substituted with any of the various modifications described herein or known in the art at one or more bases, sugars and / or phosphates. Polynucleotides can include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the nucleotide structure can be modified before or after polymer assembly. The nucleotide sequence can be blocked by non-nucleotide components. Polynucleotides can be modified after polymerization, for example, by coupling with a labeling component. The term can include both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present application as a polynucleotide includes both the double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.

[0098] In this application, the term "modified nucleoside" generally refers to a nucleoside that comprises at least one modification compared to a naturally occurring RNA or DNA nucleoside. For example, the modification can include a chemical modification. The modified nucleoside comprises a modified sugar moiety and / or a modified core base.

[0099] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Nucleotides may include modified nucleotides or nucleotide mimetics, abasic sites (Ab or X) or substitute replacement moieties. As used herein, a "nucleobase sequence" generally refers to the order of consecutive nucleobases that are independent of any sugar, linkage or nucleobase modification. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G); and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C) and uracil (U). "Modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.

[0100] In this application, the term "sugar moiety" generally refers to a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally refers to a ribofuranosyl group as found in naturally occurring RNA or a deoxyribofuranosyl group as found in naturally occurring DNA. A "modified sugar moiety" refers to a substituted sugar moiety or a sugar surrogate.

[0101] In the present application, the term "antisense strand" generally refers to a strand comprising a region that is substantially complementary to a target sequence of an RNAi agent (e.g., shRNA). As used herein, the term "region of complementarity" generally refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., target sequence) defined herein. When the region of complementarity is not fully complementary to the target sequence, mispairing can occur in the interior or terminal regions of the molecule. Typically, the most tolerated mispairing is in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' end and / or 3' end.

[0102] In this application, the term "sense strand" (S) generally refers to a strand of a RNAi agent that includes a region that is substantially complementary to a region that is the antisense strand as that term is defined herein. The "sense" strand may also be referred to as the "sense" strand, the "passenger strand," or the "anti-guide" strand.

[0103] In this application, term "complementary" refers generally to the ability of two oligonucleotide chains to form base pairs with each other. Base pairs are usually formed by hydrogen bonds between the nucleotides in the antiparallel oligonucleotide chains. Complementary oligonucleotide chains can carry out base pairing (for example, AT, AU, CG) using Watson-Crick method, or carry out base pairing with any other mode (for example Hoogsteen type or reverse Hoogsteen type base pairing) that allows to form a duplex.

[0104] In this application, "complementarity" includes both complete complementarity and incomplete complementarity. Complete complementarity or 100% complementarity refers to the situation where each nucleotide from the first oligonucleotide chain in the double-stranded region of the double-stranded oligonucleotide molecule can form hydrogen bonds with the nucleotides in the corresponding position of the second oligonucleotide chain without "mismatches". Incomplete complementarity refers to the situation where the nucleotide units of the two chains cannot all hydrogen bond with each other. For example, for two oligonucleotide chains with a double-stranded region of 20 nucleotides in length, if only two base pairs on each chain can hydrogen bond with each other, the oligonucleotide chains exhibit 10% complementarity. In the same example, if 18 base pairs on each chain can hydrogen bond with each other, the oligonucleotide chains exhibit 90% complementarity. Substantial complementarity refers to at least about 75%, about 79%, about 80%, about 85%, about 90%, about 95% or 99% complementarity.

[0105] As used herein, the term "target gene" or "target sequence" can be a nucleic acid sequence naturally present in an organism, a transgenic, a viral or bacterial sequence, a chromosomal or extrachromosomal sequence, and / or transiently or stably transfected or incorporated into a cell and / or its chromatin. The target gene can be a protein-coding gene or a non-protein-coding gene (e.g., a microRNA gene, a long non-coding RNA gene).

[0106] In this application, the terms "inhibit," "enhance," "elevate," "increase," "decrease," "lower," and the like generally refer to a quantitative difference between two states. These terms apply, for example, to expression levels and activity levels. The terms "reduce" and "reduce" are used interchangeably and generally refer to any change that is less than the original value. "Reduce" and "reduce" are relative terms, requiring a comparison between before and after a measurement. "Reduce" and "reduce" include complete depletion or elimination.

[0107] In this application, the term "expression vector" generally refers to a vector that carries the nucleic acid molecule of this application. In this application, the expression vector can include any vector type known in the art. For example, the expression vector can include a viral vector. For example, the expression vector can include a lentiviral vector.

[0108] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations may also generally include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to humans. When used in medicine, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0109] In this application, the term "prevention and / or treatment" includes not only preventing and / or treating a disease, but also generally includes preventing the onset of a disease, slowing or reversing the progression of a disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated therewith and / or preventing further increase in the severity of the disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage caused by the disease, and generally any pharmacological effect that is beneficial to the patient being treated. The CD59 inhibitor or pharmaceutical composition of the present application does not need to achieve a complete cure or eradication of any symptoms or manifestations of the disease to form a viable therapeutic agent. As recognized in the relevant art, drugs used as therapeutic agents can reduce the severity of a given disease state, but do not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a prophylactic administration of a treatment constitutes a viable preventive agent that does not need to be completely effective in preventing the onset of the disease. Simply reducing the effects of the disease in a subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or reducing the likelihood that the disease will occur or worsen, is sufficient.

[0110] In this application, the terms "disease" or "disorder" are used interchangeably and generally refer to any deviation of a subject from the normal state, such as any change in the state of the body or certain organs that prevents or disrupts the performance of a function and / or causes symptoms such as discomfort, dysfunction, suffering or even death in the person suffering from the disease or contact therewith. A disease or condition may also be referred to as distemper, ailment, ailment, malady, disorder, sickness, illness, complaint, inderdisposion or affectation.

[0111] In this application, the term "tumor" generally refers to any new pathological tissue proliferation. For the purposes of this application, angiogenesis may be part of the characteristics of a tumor. Tumors may be benign, such as hemangiomas, gliomas, teratomas, etc., or malignant, such as adenocarcinomas, sarcomas, glioblastomas, astrocytomas, neuroblastomas, retinoblastomas, etc. The term "tumor" is generally used to refer to benign or malignant tumors, while the term "cancer" is generally used to refer to malignant tumors, which may be metastatic or non-metastatic. For research purposes, these tissues can be isolated from readily available resources by methods well known to those skilled in the art.

[0112] In this application, the term "administer" generally refers to introducing the present pharmaceutical preparation into the body of a subject by any introduction or delivery route. Any method known to those skilled in the art for contacting cells, organs or tissues with the drug can be used. The administration may include, but is not limited to, intravenous, intraarterial, intranasal, intraperitoneal, intramuscular, subcutaneous transdermal or oral administration. The daily dose may be divided into one, two or more suitable forms of dosage to be administered at one, two or more times during a certain time period.

[0113] In this application, the term "effective amount" or "effective dose" generally refers to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutically effective amount" or "therapeutically effective dose" of a drug or therapeutic agent is generally any amount of the drug that, when used alone or in combination with another therapeutic agent, promotes disease regression (as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or the prevention of damage or disability caused by the disease). A "prophylactically effective amount" or "prophylactically effective dose" of a drug generally refers to an amount of the drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or disease recurrence, inhibits the progression or recurrence of the disease. The ability of a therapeutic or prophylactic agent to promote disease regression or inhibit disease progression or recurrence can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, predicting efficacy in humans in animal model systems, or by measuring the activity of the agent in in vitro assays. In certain embodiments, an "effective amount" refers to the amount of a CD59 inhibitor that produces the expected pharmacological, therapeutic or prophylactic result.

[0114] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of diagnosis, prognosis, improvement, prevention and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs) and experimental animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents and adult subjects. Subjects include animal disease models.

[0115] In this application, the terms "include," "comprising," "having," "may," "containing," and variations thereof are generally open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "consisting of generally indicates that no other components (or, similarly, features, integers, steps, etc.) can be present. The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0116] In this application, the term "about" generally means approximately, in the region of, roughly, or around. When the term "about" is used in reference to a numerical range, a cutoff or specific value is used to indicate that the stated value may vary from the recited value by up to 10%. Thus, the term "about" can be used to encompass variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from the specified value.

[0117] In this application, the abbreviations have the following meanings: "h" refers to hour, "min" refers to minute, "s" refers to second, "d" refers to day, "μL" refers to microliter, "mL" refers to milliliter, "L" refers to liter, "bp" refers to base pair, "mM" refers to millimole, and "μM" refers to micromole.

[0118] Detailed Description of the Invention

[0119] In one aspect, the present application provides a method for promoting T cell proliferation, which comprises inhibiting the expression, function and / or activity of CD59 molecules in T cells.

[0120] On the other hand, the present application also provides a method for promoting the secretion of T cell factors, which comprises inhibiting the expression, function and / or activity of CD59 molecules in T cells.

[0121] In the present application, the CD59 molecule is the CD59 molecule in T cells.

[0122] In the present application, the method comprises administering a CD59 inhibitor to T cells.

[0123] In the present application, the method comprises knocking down / silencing the CD59 gene of T cells.

[0124] On the other hand, the present application also provides a CD59 inhibitor, which can inhibit the expression and / or activity of CD59 in T cells.

[0125] On the other hand, the present application also provides engineered T cells whose CD59 gene is knocked down or silenced.

[0126] CD59 inhibitors

[0127] In the present application, the inhibitor for inhibiting CD59 gene expression may include any method known in the art capable of inhibiting gene expression. For example, the inhibitor may include a protein. For example, the inhibitor may include an antibody. For example, the inhibitor may include a small molecule compound. For example, the inhibitor may include a nucleic acid molecule. For example, the inhibitor may include PROTAC technology.

[0128] For example, the CD59 inhibitor may target an oligonucleotide of a nucleic acid molecule encoding CD59. In the present application, the nucleic acid molecule encoding CD59 may comprise the nucleotide sequence shown in SEQ ID NO: 1.

[0129] For example, the CD59 inhibitor may comprise a nucleic acid molecule that targets CD59.

[0130] In the present application, the nucleic acid molecule targeting CD59 can target at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or at least 26 consecutive nucleotides in SEQ ID NO: 1.

[0131] In the present application, the nucleic acid molecule targeting CD59 may comprise a nucleotide sequence of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 consecutive nucleotides that are partially or completely complementary to the nucleotide sequence shown in SEQ ID NO: 1.

[0132] In certain embodiments, for example, the length of the nucleic acid molecule targeting CD59 can be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. For another example, the length of the oligonucleotide can be 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.

[0133] For example, the nucleic acid molecule targeting CD59 can target the target sequence of the nucleotide region 82-165 of SEQ ID NO:1.

[0134] For example, the nucleic acid molecule targeting CD59 can target the target sequence of the nucleotide region 248-294 of SEQ ID NO:1.

[0135] For example, the nucleic acid molecule targeting CD59 can target the target sequence of the nucleotide region 248-269 of SEQ ID NO:1.

[0136] For example, the nucleic acid molecule targeting CD59 can target the target sequence of nucleotides 1 to 81 of SEQ ID NO: 1.

[0137] For example, the nucleic acid molecule targeting CD59 can target the target sequence of the nucleotide region 165-248 of SEQ ID NO:1.

[0138] For example, the nucleic acid molecule targeting CD59 can target the target sequence of the nucleotide region 269-387 of SEQ ID NO:1.

[0139] In the present application, the CD59 inhibitor may include shRNA, siRNA and / or sgRNA that is specifically targeted to the CD59 gene by gene editing using CRISPR-Cas9 technology.

[0140] For example, the sequence / target sequence of each nucleic acid molecule may be as shown below.

[0141] shRNA target sequence (sense chain sequence, the sequence is the sequence form in the expression vector):

[0142] SEQ ID NO:3:CCGTCAATTGTTCATCTGATT

[0143] SEQ ID NO:4:GCTAACGTACTACTGCTGCAA

[0144] SEQ ID NO:5: GCTACAACTGTCCTAACCCAA

[0145] SEQ ID NO:6:GATGCGTGTCTCATTACCAAA

[0146] SEQ ID NO:7: GACCTGTGTAACTTTAACGAA

[0147] The antisense strand sequence of the shRNA is reverse complementary to the sense strand sequence and is the sequence from the 5' end to the 3' end, and the sequence is in the sequence form in the expression vector):

[0148] SEQ ID NO:9:AATCAGATGAACAATTGACGG

[0149] SEQ ID NO:10:TTGCAGCAGTAGTACGTTAGC

[0150] SEQ ID NO:11:TTGGGTTAGGACAGTTGTAGC

[0151] SEQ ID NO:12:TTTGGTAATGAGACACGCATC

[0152] SEQ ID NO:13:TTCGTTAAAGTTACACAGGTC

[0153] siRNA sequence:

[0154] SEQ ID NO:28:CCGUCAAUUGUUCAUCUGAUU

[0155] SEQ ID NO:29:GCUAACGUACUACUGCUGCAA

[0156] SEQ ID NO:30:GCUACAACUGUCCUAACCCAA

[0157] SEQ ID NO:31:GAUGCGUGUCUCAUUACCAAA

[0158] SEQ ID NO:32: GACCUGUGUAACUUUAACGAA

[0159] sgRNA sequence (targeting sequence, the sequence is in the form of a sequence in an expression vector):

[0160] SEQ ID NO:33:ACGACGTCACAACCCGCTTG

[0161] SEQ ID NO:34:GTTCGGGCTGCTGCTCGTCC

[0162] SEQ ID NO:35: TAGGACAGTTGTAGCACTGC

[0163] SEQ ID NO:36:GCTGTTCGTTAAAGTTACAC

[0164] SEQ ID NO:37:CGAACAGGACAGACCCTCCT

[0165] SEQ ID NO:38:GCGTGTTCATTACCAAAGC

[0166] In the present application, the shRNA may include an inverted repeat sequence connected by a stem-loop.

[0167] In the present application, the shRNA may include a sense strand and an antisense strand.

[0168] In the present application, the stem-loop of the shRNA may include the nucleic acid sequence shown in SEQ ID NO: 26 and / or SEQ ID NO: 27.

[0169] SEQ ID NO: 26: CTCGAG

[0170] SEQ ID NO: 27: GAGCTC

[0171] In the present application, the shRNA may include a primer sequence. For example, the shRNA including a primer may include the amino acid sequence shown in any one of SEQ ID NOs: 16-25. In particular, SEQ ID NO: 16 and SEQ ID NO: 17 are sense and antisense to each other; SEQ ID NO: 18 and SEQ ID NO: 19 are sense and antisense to each other; SEQ ID NO: 20 and SEQ ID NO: 21 are sense and antisense to each other; SEQ ID NO: 22 and SEQ ID NO: 23 are sense and antisense to each other; and SEQ ID NO: 24 and SEQ ID NO: 25 are sense and antisense to each other.

[0172] In the present application, the nucleic acid sequences involved may include a nucleotide sequence that differs from one or more nucleotides. The sequence that differs from multiple nucleotides may be a sequence that differs from two nucleotides, a sequence that differs from three nucleotides, a sequence that differs from four nucleotides, a sequence that differs from five nucleotides, or a sequence that differs from more nucleotides. For example, the positive strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs:3-7 or a sequence that differs from it by no more than 3 nucleotides. For example, the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs:9-13 or a sequence that differs from it by no more than 3 nucleotides. For example, the siRNA includes the sequence shown in any one of SEQ ID NOs:28-32 or a sequence that differs from it by no more than 3 nucleotides. For example, the sgRNA includes the nucleotide sequence shown in any one of SEQ ID NOs:33-44 or a sequence that differs from it by no more than 3 nucleotides.

[0173] In certain embodiments, the sense strand and antisense strand of the nucleic acid molecules described herein contain the same number of nucleotides. In certain embodiments, the sense strand and antisense strand of the nucleic acid molecules described herein contain different numbers of nucleotides. In certain embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the nucleic acid molecule form a blunt end. In certain embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the nucleic acid molecule form a blunt end. In certain embodiments, both ends of the nucleic acid molecule form a blunt end. In certain embodiments, neither end of the nucleic acid molecule is a blunt end. As used herein, a blunt end refers to the end of a double-stranded nucleic acid in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs). In certain embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the nucleic acid molecule form a flared end. In certain embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the nucleic acid molecule form a flared end. In certain embodiments, both ends of the nucleic acid molecule form a flared end. In certain embodiments, neither end of the nucleic acid molecule is a flared end. As used herein, a frayed end generally refers to the end of a double-stranded nucleic acid molecule in which the terminal nucleotides of the two annealed chains form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used herein, an overhang is a segment of one or more unpaired nucleotides at the end of one chain of a double-stranded nucleic acid molecule. The unpaired nucleotides can be on the sense strand or the antisense strand, thereby producing a 3' or 5' overhang. In certain embodiments, the nucleic acid molecule contains: a blunt end and a frayed end, a blunt end and a 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends.

[0174] The present application also includes an expression vector for the nucleic acid molecule. For example, the expression vector may comprise a viral vector. For example, the expression vector may comprise a lentiviral vector, a retroviral vector, or an adeno-associated viral vector.

[0175] In the present application, the types of lentiviral vectors are well known in the art, for example, selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO.1-puro-IPTG-LxLacO, pLKO.1- puro-IPTG-3xLacO, pLP1, pLP2, pLP / VSV-G, pENTR / U6, pLenti6 / BlOCK-iT-DEST, pLenti6-GE / U6-laminshr na, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, pGCSIL-GFP or pLenti6.2 / N-Lumio / V5-GW / lacZ, etc.

[0176] The present application also includes recombinant lentivirus obtained by co-transfecting mammalian cells with the expression vector and packaging helper plasmid. For example, the mammalian cells may include any one or a combination of at least two of 293 cells, 293T cells, or 293F cells.

[0177] The present application also provides a CD59 gene interfering lentivirus, which is formed by viral packaging of the aforementioned interfering nucleic acid construct with the assistance of a lentiviral packaging plasmid and a cell line.

[0178] Engineered T cells

[0179] On the other hand, the present application also provides an engineered T cell whose CD59 gene is knocked down or silenced.

[0180] In the present application, the engineered T cells may be engineered in one or more ways. In the present application, the engineered approach includes silencing the CD59 gene in the T cells by targeting a target sequence in the CD59 gene through antisense RNA, antagomirs, siRNA, shRNA, large-range nucleases, zinc finger nucleases, transcription activator-like effector nucleases and / or CRISPR systems. In the present application, the engineered approach includes using PROTAC to inhibit the activity of the CD59 gene in T cells.

[0181] For example, the engineered T cells can be obtained by administering the CD59 inhibitor described herein.

[0182] In the present application, the T cell may include a thymocyte, a naive T lymphocyte, an immature T lymphocyte, a mature T lymphocyte, a resting T lymphocyte or an activated T lymphocyte. In the present application, the T cell may include a helper T cell (HTL; CD4+ T cell), a cytotoxic T cell (CTL; ​​CD8+ T cell), a CD4+CD8+ T cell, a CD4-CD8- T cell or any other subpopulation of a T cell.

[0183] In the present application, the engineered T cells may also include other modifications. For example, the engineered T cells may also be modified to express a chimeric antigen receptor. For example, the engineered T cells may also be modified to express a T cell receptor (TCR).

[0184] Pharmaceutical composition

[0185] In another aspect, the present application provides a pharmaceutical composition comprising a CD59 inhibitor and optionally a pharmaceutically acceptable excipient.

[0186] In certain embodiments, the CD59 inhibitor can be used to inhibit the expression of the CD59 gene in cells, cell populations or tissues such as in a subject. In certain embodiments, the CD59 inhibitor is used to formulate a composition for administration to a subject, i.e., a pharmaceutical composition or a drug. For example, a pharmaceutical composition or a drug may comprise a pharmacologically effective amount of at least one of the CD59 inhibitors and one or more pharmaceutically acceptable carriers. A pharmaceutically acceptable carrier is a substance other than the active pharmaceutical ingredient that has undergone appropriate safety evaluation and is intentionally included in a drug delivery system. The carrier does not exert or is not intended to exert a therapeutic effect at a predetermined dose. The carrier can be used to a) assist in the handling of the drug delivery system during manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptability of the CD59 inhibitor, c) assist in product identification and / or d) enhance any other properties of the overall safety and effectiveness of the CD59 inhibitor delivered during storage or use. A pharmaceutically acceptable carrier may or may not be an inert substance.

[0187] Carriers include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, adhesives, buffers, vehicles, coatings, pigments, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained-release matrices, sweeteners, thickeners, tonicity agents, vehicles, hydrophobic agents, and wetting agents.

[0188] use

[0189] On the other hand, the present application provides use of the CD59 inhibitor, the engineered cell, and / or the pharmaceutical composition in preparing a medicament for preventing and / or treating a disease and / or condition.

[0190] In another aspect, the present application provides a method for preventing and / or treating a disease and / or condition, comprising administering the CD59 inhibitor, the engineered cell, and / or the pharmaceutical composition to a subject in need thereof.

[0191] In another aspect, the present application provides the CD59 inhibitor, the engineered cell, and / or the pharmaceutical composition for use in preventing and / or treating a disease and / or condition.

[0192] In certain embodiments, the disease and / or condition may comprise a tumor.

[0193] In certain embodiments, the disease and / or disorder may comprise an immunodeficiency disorder.

[0194] Without intending to be bound by any theory, the following examples are merely intended to illustrate the methods, inhibitors, and uses of the present application, and are not intended to limit the scope of the present invention.

[0195] Example

[0196] Example 1 Mouse mCD59ab deletion reduces tumor proliferation and metastasis in tumor-bearing mice

[0197] 1. Tumor proliferation in WT and mCd59ab-KO mouse subcutaneous tumor models

[0198] WT and mCd59ab-KO mice were subcutaneously inoculated with mouse lung cancer TC-1 cells (2×10 5 The tumor size was monitored in real time starting from the 9th day after inoculation. The long diameter and short diameter of the tumor were measured respectively, and the tumor volume was calculated as 0.5 × long diameter × short diameter. 2 , followed by measurements every two to three days. On day 22 after inoculation, mice were anesthetized and sacrificed, and samples were collected after tumor size met ethical standards. Model results showed that tumor proliferation was almost completely inhibited in the mCd59ab-KO group, with tumors initially increasing and then regressing, with some mice even experiencing complete tumor regression. Quantitative statistical analysis of tumor weights revealed that tumors in the mCd59ab-KO group were significantly smaller than those in the WT group, indicating that mCd59ab knockout significantly inhibits tumor growth (Figure 1).

[0199] 2. Study the effect of CD59 on tumor cell metastasis in the spleen and liver metastasis models of WT and mCd59ab-KO mice

[0200] The spleens of WT and mCd59ab-KO mice were inoculated with mouse lung cancer TC-1 cells (4×10 6 cells / mouse), and a spleen-liver metastasis model was constructed. After inoculation, the mice were observed every day. After the model was constructed, the model mice were anesthetized and killed, and the liver and spleen were sampled separately. Figure 2A shows that multiple tumor metastases can be observed in the liver of the WT group, while there are almost no or very few liver tumor metastases in the mCd59ab-KO group; HE staining of the liver of the model mice (Figure 2C) further verified this conclusion. The results of this part show that knocking out mCd59ab can significantly inhibit the metastasis of transplanted tumor cells. In addition, tumor tissue growth was found in the spleens of mice in both the WT group and the mCd59ab-KO group, and there was no significant difference in the growth of the tumor tissue (Figure 2B).

[0201] Example 2 T cell detection in the subcutaneous tumor-bearing model of lung cancer cells in WT and mCd59ab-KO mice

[0202] Leukocytes were collected from the spleen and blood of mice in the subcutaneous tumor-bearing model and CD4 + (CD3 + CD4 + ) and CD8 + T cells (CD3 + CD8 + The results showed (Figure 3) that the CD4 + and CD8 + The percentage of T cells was higher than that of WT group, and the CD4 + or CD8 + The T cell content was negatively correlated with the weight of mouse tumors, indicating that mCd59ab knockout in mice can promote T cell proliferation and may be involved in the inhibition of transplanted tumor growth.

[0203] Example 3 T cell-mediated anti-tumor immunity in mCd59ab-KO mice

[0204] Construction of mouse CD4 + T and / or CD8 +T cell depletion model was conducted using Bioxcell InVioMab anti-mouse CD4 antibody (Clone: ​​GK1.5, catalog: BE0003-1) and InVioMAb anti-mouse CD8α antibody (clone: ​​2.43, catalog: BE0061). These two antibodies can be used to deplete CD4 in mice. + T cells or CD8 + T cell depletion was performed using the InVivoMAb rat IgG2b isotype control antibody (clone: ​​LTF-2, catalog: BE0090).

[0205] Two days before tumor bearing, mice were intraperitoneally injected with 150 μg / 150 μL PBS diluted anti-IgG2b, CD4, and CD8 antibodies. The experiment was divided into IgG2b control group, CD4 + T cell depletion group, CD8 + T cell depletion group, CD4 + T cells and CD8 + T cell depletion group, eliminating CD4 + T and / or CD8 + T cells were then injected twice a week. Two days after the antibody injection, mouse lung cancer TC-1 cells were subcutaneously inoculated. When the tumor grew to be visible to the naked eye, the tumor size was recorded and then measured every three days until the model was completed. As shown in Figure 4, in mCd59ab-KO mice, compared with the mCd59ab-KO IgG group, the CD4 + T cells or CD8 + After the T cells were removed, the tumor proliferation was accelerated, and the double combination was used to eliminate CD4 + T and CD8 + After the mCd59ab-KO mice were loaded with tumors, the tumor proliferation rate was not significantly different from that of the WT IgG group, indicating that the CD4 + T and CD8 + T cells play a crucial role in tumor proliferation.

[0206] Example 4: In primary mouse T cells, mCd59ab knockout enhances T cell activation, cytokine release, and cell proliferation

[0207] The spleens of WT and mCd59ab-KO mice were harvested and prepared into single cell suspensions. Primary CD4 + or CD8 +The purity of T cells can reach more than 90%. The isolated cells were resuspended in complete culture medium and plated on a 48-well plate coated with CD3 / CD28 (2μg / mL) antibody for stimulation and culture. First, the expression of T cell activation markers CD69 and CD25 was detected. The flow cytometry results showed that compared with the WT group, the mCd59ab-KO group could enhance the expression of CD4 + (Figure 5A, C) and CD8 + T cells (Figure 5B, D) responded to CD3 and CD28 antibody stimulation, with increased expression of CD69 and CD25, indicating more obvious cell activation. Brefeldin A-containing PMA ionomycin mixture was then added for 4-6 hours of stimulation, and cytokine expression was detected by flow cytometry. The results showed that compared with the WT group, mCd59ab-KO CD4 + T cells expressed IL-2 and IFN-γ (Figure 5E, G) and mCd59ab-KO CD8 + T cells secreted higher levels of IL-2, IFN-γ, Granzyme B, and Perforin (Figure 5F, H, I, J), indicating that knocking out mCd59ab in T cells can enhance their immunological response.

[0208] The isolated primary mouse T cells were stimulated and cultured, 10-100×10 6 1 μL of 5 mM CFSE was added to each cell / mL, and CFSE experiments were performed at different time points to detect cell proliferation. + In T cells (Figure 5K, L), CFSE results showed that at 36h, 48h, and 72h, the proliferation of cells in the mCd59ab-KO group was higher than that in the WT CD4 + T cells were faster, and there was no significant difference between the two groups at 96h. + In T cells (Fig. 5M, N), mCd59ab-KO CD8 + T cells at 72h and 96h were higher than those of WT CD8 + T cells proliferated faster, indicating that knockout of mCd59ab could enhance the proliferation ability of T cells.

[0209] Example 5 Construction of CD59 knockdown expression vector

[0210] 1. CD59 shRNA Design

[0211] An shRNA design tool (www.sigmaaldrich.com) was used to search for available shRNA sequences targeting CD59. Sequence alignment was performed using the BLAST tool (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Target sites with minimal off-target effects were selected. A total of five target sites (shRNA-CD59-1, shRNA-CD59-2, shRNA-CD59-3, shRNA-CD59-4, and shRNA-CD59-5) and one control target site (shRNA-NC) were selected. The shRNA target site sequences are shown in Table 1. Stem-loop structures and enzyme cleavage sites (EcoR1 and Agel) were designed for specific target sites to obtain the oligonucleotide sequences of shRNA. A total of five pairs of shRNAs (shRNA-CD59-1, shRNA-CD59-2, shRNA-CD59-3, shRNA-CD59-4, and shRNA-CD59-5) were designed. At the same time, a non-specific control shRNA (shRNA-NC) was designed. The primers required for shRNA synthesis are shown in Table 2 (shRNA primers were synthesized by Boshang Biotechnology (Shanghai) Co., Ltd.).

[0212] Table 1. CD59 shRNA target site DNA sequences

[0213] Table 2. CD59 shRNA primer sequence list

[0214] 2. Construction of shRNA lentiviral expression vector for CD59 gene

[0215] 2.1 The shRNA primers to be annealed were diluted to 50 μM with triple-distilled water. Primer synthesis was performed by Shanghai Boshang Biotechnology Co., Ltd. According to the following annealing reaction system, various reagents were added in sequence and mixed thoroughly.

[0216] Annealing reaction system:

[0217] The water bath was heated to 95°C, and the annealing system prepared above was placed in the 95°C water bath and heated for 5 minutes. The power was then turned off, and the temperature was naturally cooled to room temperature, and the annealing was completed.

[0218] 2.2 Double enzyme digestion of vector

[0219] Take 2 μg of the extracted pLKO.1 vector (Figure 6) and digest it with the corresponding restriction endonuclease at 37°C overnight. The enzyme digestion system is as follows:

[0220] 2.3 Recovery of enzyme digestion products

[0221] Take 0.4g agarose and dissolve it in 40mL 1×TAE. Heat it in a microwave for 2min. After the liquid boils, let it cool naturally at room temperature. When the temperature drops to about 50-60℃, add 4μL 10000×Goldview, shake well and pour into a gel tank for later use.

[0222] Add the overnight digestion product to 6× loading buffer, load the sample, run the gel at 100V, observe the bands under UV, and recover the target bands into a 1.5mL EP tube.

[0223] Add an equal amount of membrane binding solution and dissolve the gel at 56°C. After the gel is completely melted, mix it by inverting it upside down. Add it to the column and incubate it for 5 minutes. Centrifuge it, add 500 μL of PW rinse solution, centrifuge it, spin it for 2 minutes, let it stand at room temperature for 5 minutes, add an appropriate amount of elution solution to elute the DNA, and measure the concentration.

[0224] 2.4 T4 ligation reaction

[0225] The purified digested product was connected to the annealed product. The connection system is as follows:

[0226] Ligation was carried out at 16°C overnight;

[0227] 2.5 Conversion

[0228] Thaw 50 μL of DH5α on ice, add the ligation product to the DH5α, mix thoroughly, and place on ice for 30 minutes. Place the centrifuge tube in a 42°C water bath for 90 seconds, then quickly transfer the EP tube to ice and allow the cells to cool for 3 minutes.

[0229] Add 1 mL of sterile, antibiotic-free LB medium to the centrifuge tube, mix thoroughly, and incubate at 37°C in a shaker at 220 rpm for 45 minutes to allow the cells to recover and allow expression of the resistance gene on the plasmid. Centrifuge at 4000 rpm for 2 minutes, remove a portion of the supernatant, and retain 100 μL. Mix thoroughly by pipetting, then spread onto an LB plate containing ampicillin and incubate at 37°C for 12-16 hours.

[0230] 2.6 Clone identification

[0231] Multiple clones were selected from the plates and sent to Boshang Biotechnology (Shanghai) Co., Ltd. for sequencing. The consistent plasmids were used for subsequent experiments. The successfully constructed plasmids containing the CD59-shRNA expression cassette were numbered pLKO.1-shRNA-NC, pLKO.1-shCD59-1, pLKO.1-shCD59-2, pLKO.1-shCD59-3, pLKO.1-shCD59-4, and pLKO.1-shCD59-5.

[0232] Example 6 pLKO.1-shRNA-NC / pLKO.1-shCD59 lentiviral packaging

[0233] Discard the supernatant of 293T cells, rinse once with PBS, and add 0.25% EDTA-containing trypsin digestion solution to digest; when the cells fall off the culture dish, add DMEM medium containing 10% fetal bovine serum to stop digestion. Transfer the cell suspension to a 15mL centrifuge tube, centrifuge at 800rpm for 5min, and plate the cells (10cm 2 Cell culture plate), the cell density reached 80% on the second day, which is more suitable for cell transfection.

[0234] 1. Plasmid Transfection

[0235] Add the following plasmids to 500ul Opti-MEM: 7.5ug psPAX2 plasmid, 2.5ug pMD2.G plasmid, 10ug lentiviral vector plasmids (pLKO.1-shRNA-NC, pLKO.1-shCD59-1, and pLKO.1-shCD59-2), and then add the transfection reagent Neofect. TM Add 20 μl of DNA transfection reagent, mix thoroughly, and let stand at room temperature for 20 minutes. Finally, add the transfection complex to the cell culture medium and gently shake to mix. Transfer the cells to a 37°C cell culture incubator with 5% CO2.

[0236] 2. Virus Collection and Concentration

[0237] 48 hours after plasmid transfection, collect the cell supernatant in a 50mL centrifuge tube, centrifuge at 2000rpm for 10 minutes, and filter with a 0.45μm filter. Open the lid of the cleaned virus ultracentrifuge tube and sterilize it with UV for 2 hours. Divide the treated cell supernatant into the virus ultracentrifuge tube and balance it. The weight error of the two symmetrical ultracentrifuge tubes is less than 0.01g. After balancing, place it in the ultracentrifuge rotor and centrifuge it at 100000g at 4℃ for 2 hours. After centrifugation, you can see a cluster of virus particles precipitated at the bottom of the centrifuge tube. Discard the supernatant. Add 500μL Opti-MEM to resuspend the virus particles, divide it into portions and store at -80℃. Fill the used virus ultracentrifuge tube with glutaraldehyde and soak it overnight. Wash it and set it aside for next use.

[0238] Example 7 pLKO.1-shRNA-NC / pLKO.1-shCD59 lentiviral transduction of Jurkat T cells or primary human T cells

[0239] 1. Lentiviral transduction of Jurkat T cells: Jurkat T cells with good growth status were seeded in 25cm 2 Cell culture flasks were divided into pLKO.1-puro-shRNA-NC, pLKO.1-puro-shRNA-CD59-1 and pLKO.1-puro-shRNA-CD59-2 groups, 4.5 mL of 1640 complete medium was added, the cell density was about 50%, and 500 μL of virus solution (one 10 cm 2 The culture dish was inoculated with 6 μg / mL of polybrene for 48 hours. After 48 hours, the cells were centrifuged, the supernatant discarded, and the cells were conditioned with complete culture medium. After one generation, selection with puromycin was initiated. Initially, selection was performed at a dose of 2 μg / mL. Subsequently, the dose was increased based on the cell status. When the concentration reached approximately 6 μg / mL and no cell death was observed, a stable CD59 knockdown cell line was successfully established. Subsequently, the cells were cultured in complete culture medium for expansion. Knockdown efficiency was assessed using qPCR, Western blotting, and flow cytometry.

[0240] 2. Lentiviral Transduction of Human Peripheral Blood T Cells

[0241] Collected peripheral blood was mixed with saline at a 1:1 ratio. Ficoll was added to a centrifuge tube, and the diluted peripheral blood was slowly added. The tube was centrifuged at 800 g for 20 minutes, and the PBMC layer was gently aspirated and transferred to another centrifuge tube. The PBMCs were washed with saline and transferred to X-VIVO medium (containing 5% human AB serum and 200 IU / mL IL-2). Dynabeads human T-activator CD3 / CD28 (Gibco #11132D) was added at a 1:1 cell:magnetic bead ratio for activation. Two days later, lentiviral infection was performed. The cells were divided into three groups: pLKO.1-GFP-shRNA-NC, pLKO.1-GFP-shRNA-CD59-1 and pLKO.1-GFP-shRNA-CD59-2. T cells and lentiviral solution were added to a 24-well plate pre-coated with RetroNectin (5ug / mL), centrifuged at 1200g for 90min, and cultured in a cell culture incubator at 37°C, 5% CO2 and a certain humidity.

[0242] Example 8 Interference Experiment Verification, CD59 Knockdown Level Detection

[0243] 1. RT-PCR and Western Blot Screening of CD59 shRNA

[0244] The three groups of Jurkat-shRNA stably transfected cells were harvested and lysed with NucleoZOL. Total RNA was extracted and reverse transcribed. Using CD59 primers (Table 3), CD59 expression at the mRNA level was measured by fluorescent quantitative PCR (primers for the internal reference gene β-actin were required, as shown in Table 3). Q-PCR was then used to analyze the plasmid's interference effect. As shown in Figure 7A, the pLKO.1-shRNA-CD59 lentivirus significantly inhibited CD59 mRNA transcription after infection of the cells, reducing CD59 mRNA expression to 40% of its original level. Following RNA interference, CD59 gene expression was not only downregulated at the transcriptional level, but also at the protein level. In other words, CD59 protein expression was significantly downregulated in Jurkat T cells infected with pLKO.1-shRNA-CD59, as shown in Figure 7B.

[0245] Table 3. Primer list

[0246] 2. Flow Cytometry Screening of CD59 shRNA

[0247] Jurkat and human peripheral blood T cells infected with the pLKO.1-shRNA-NC, pLKO.1-shRNA-CD59-1, and pLKO.1-shRNA-CD59-2 lentiviruses were washed twice with PBS. PE-CD59 flow cytometry antibody (Biolegend; 304708) was prepared in 1% BSA / PBS according to the antibody manufacturer's instructions and incubated on ice for 40 minutes. Following staining, cells were centrifuged at 1500 rpm for 5 minutes, the supernatant discarded, and the cells were rinsed twice with PBS. The cells were then resuspended in 500 μL of PBS and transferred to flow cytometry tubes for analysis of CD59 knockdown efficiency. As shown in Figures 7C-D, CD59 expression levels were significantly reduced in the pLKO.1-shCD59-1 (sh1) and pLKO.1-shCD59-2 (sh2) groups compared to cells transfected with pLKO-shRNA-NC alone. Statistical analysis revealed significant differences in CD59 expression levels. These results indicate that these two CD59 shRNAs can reduce the expression of CD59 protein and exert a gene silencing effect.

[0248] Example 9 In vitro study on knocking down CD59 expression level and enhancing T cell immunological function

[0249] 1. Detection of T cell activation markers in CD59 gene-edited Jurkat T cells

[0250] Jurkat-shRNA-NC, Jurkat-shRNA-CD59-1, and Jurkat-shRNA-CD59-2 stably transfected cell lines were stimulated with 5 μg / mL of anti-CD3 and CD28 antibodies for 24 hours, and CD69 expression was assessed by flow cytometry (Figure 8A). The results showed that CD3 and CD28 antibodies could activate Jurkat T cells, and CD69 expression was higher in CD59 gene-edited Jurkat T cells.

[0251] 2. Detection of cytokine levels in T cells

[0252] 2.1 RT PCR detection of cytokine release in CD59 gene-edited Jurkat T cells

[0253] Jurkat-shRNA-NC, Jurkat-shRNA-CD59-1, and Jurkat-shRNA-CD59-2 stably transfected cell lines were stimulated with 5 μg / mL of anti-CD3 and CD28 antibodies for 24 hours, and then stimulated with a PMA-ionomycin mixture for 4-6 hours. Cells were collected to extract total RNA, which was reverse transcribed into cDNA. IL2 expression at the mRNA level was determined by fluorescence quantitative PCR using primers for IL2 and the housekeeping gene β-action (as shown in Table 3). As shown in Figure 8B, the results showed that compared with the unstimulated group, the IL2 expression level of the stimulated cell line group was significantly increased, and compared with the shNC control group, knocking down CD59 in the shCD59 group significantly enhanced the IL2 expression level.

[0254] 2.2 CD59 gene-edited human peripheral blood T cells, flow cytometry detection of factor release

[0255] PBMCs from Example 7 were infected with lentivirus for 7 days. The shRNA-NC, shRNA-CD59-1, and shRNA-CD59-2 groups were then cultured and stimulated with 2 μg / ml of anti-CD3 / CD28 antibodies. Cells were then harvested 24 and 48 hours later using cell activation (with Brefeldin) (Biolegend #423303) for 4-6 hours. TNFα and IFNγ cytokine expression levels were measured using flow cytometry with PE-IFNγ (Biolegend #502509) or PE-Cy7-TNFα (Biolegend #502930), respectively. As shown in Figures 8C-D, CD59 gene-edited human peripheral blood T cells showed significantly enhanced TNFα and IFNγ cytokine secretion.

[0256] Example 10 CD59 interacts with Ras in Jurkat cells, and knockdown of CD59 affects Ras localization in the Golgi apparatus

[0257] Co-immunoprecipitation (Co-IP) combined with liquid chromatography-mass spectrometry was used to screen protein molecules that interact with CD59. The results showed that Ras is one of the proteins that interact with CD59 (Figure 9A). Similar experiments using Ras antibodies showed that CD59 is one of the binding proteins of Ras (Figure 9B). Immunoprecipitation forward and reverse experiments further verified the interaction between the two. The results showed that when using CD59 antibody forward IP, Ras could be detected. At the same time, using Ras antibody reverse IP, CD59 could also be detected, indicating that the two do interact (Figure 9C).

[0258] Immunocytochemistry (ICC) was further used to verify the interaction between CD59 and Ras. The results showed (Figure 9D) that in the Jurkat-shNC cell line, CD59 and Ras were localized to the cell membrane and cytoplasm, and co-localized, consistent with the IP results. After knocking down CD59, the distribution of Ras was significantly altered, with a significant decrease in cell membrane localization and localization in the cytoplasm, suggesting that knocking down CD59 altered the distribution of Ras in intracellular subcellular organelles.

[0259] Previous studies have reported that growth factor-induced activation of Ras signaling at the plasma membrane is rapid and transient, while Ras signaling in the Golgi apparatus is slow and sustained. We performed ICC experiments using Giantin, a specific protein marker expressed in the Golgi apparatus. The results showed that Ras was significantly aggregated in the Jurkat-shCD59 cell line and co-localized with Giantin (Figure 9E). Previous studies have reported that when Jurkat cells are activated at low levels of TCR, N-Ras is activated at the Golgi membrane rather than the plasma membrane through the PLCγ and RasGRP1 signaling pathways. These results suggest that knocking down CD59 expression levels primarily localizes Ras trafficking to the Golgi apparatus, potentially inducing delayed and sustained signal transduction.

[0260] Example 11 Knockdown of CD59 can enhance the MAPK signaling pathway downstream of TCR signaling

[0261] Following TCR activation, multiple downstream signaling pathways, including MAPK, PI3K-Akt, and NF-κB, participate. Ras can activate a series of cascade reactions downstream of the MAPK signaling pathway. Jurkat-shRNA-NC, Jurkat-shRNA-CD59-1, and Jurkat-shRNA-CD59-2 stably transfected cell lines were stimulated with 5 μg / mL of anti-CD3 and CD28 antibodies for 15 minutes, and markers of the MAPK signaling pathway were analyzed by Western blotting. As shown in Figure 10A, compared with the unstimulated group, the phosphorylated protein levels of p-MEK1 / 2, p-ERk1 / 2, p-MKK3 / 6, p-p38, p-MKK4 and p-JNK were significantly increased after the cells were stimulated with anti-CD3 and CD28 antibodies, while the corresponding total proteins of MER1 / 2, ERK1 / 2, MKK3 / 1 / 6, p38, MKK4, MKK7 and JNK did not change significantly, indicating that the MAPK signaling pathway was activated after the TCR-CD3 complex was stimulated by anti-CD3 and CD28 antibodies.

[0262] In cells stimulated with anti-CD3 and CD28 antibodies, the phosphorylation levels of p-MEK1 / 2, p-ERK1 / 2, p-MKK3 / 6, p-p38, p-MKK4, and p-JNK in the Jurkat-shCD59 cell line were significantly increased compared to Jurkat-shNC cells, while the corresponding total proteins of MER1 / 2, ERK1 / 2, MKK3 / 6, p38, MKK4, and JNK did not change significantly. At the same time, the experiment used flow cytometry to further verify the protein phosphorylation levels of ERK, p38, and JNK in human peripheral blood T cells. The flow cytometry results showed that after stimulation with anti-CD3 and CD28 antibodies, knockdown of CD59 also enhanced the phosphorylation levels of ERK, p38, and JNK compared to the shNC group (Figure 10B-C). These results indicate that knockdown of CD59 can enhance the immune response of T cells by activating the MAPK signaling pathway.

[0263] In summary, the present invention detects the function of primary T cells in WT / mCD59ab-KO mice and screens shRNA targeting CD59, packages lentivirus, and introduces it into T cells to silence the CD59 gene. The expression of CD59 in the edited T cells is significantly reduced, and their cell proliferation and cytokine release are significantly enhanced. Mechanistically, CD59 interacts with Ras, changing the localization of Ras in the plasma membrane or Golgi apparatus. That is, when the intracellular expression level of CD59 increases, it helps Ras to move to the plasma membrane. At this time, the activation of Ras signal is rapid and short-lived. When the intracellular expression level of CD59 decreases or even disappears, the level of Ras membrane transport decreases, and it is mainly localized to the Golgi apparatus. At this time, the activation of Ras signal is slow and continuous (Figure 11), and further regulates the anti-tumor immune response of T cells by affecting the MAPK signaling pathway, providing new methods and ideas for the treatment of tumors and immune diseases.

[0264] The applicant declares that the present invention is not limited to the above-described detailed methods by means of the above-described embodiments, and that the present invention is not necessarily implemented in accordance with the above-described detailed methods. Those skilled in the art will appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention are intended to be included within the scope of protection of the present invention.

Claims

A method for promoting T cell proliferation, comprising inhibiting the expression, function and / or activity of CD59 molecules in T cells.

2. A method for promoting T cell cytokine secretion and enhancing its function, comprising inhibiting the expression, function and / or activity of CD59 molecules in T cells.

3. The method according to any one of claims 1-2, wherein the CD59 molecule is an intracellular CD59 molecule.

4. The method according to any one of claims 1 to 3, comprising administering a CD59 inhibitor to the T cells.

5. The method according to any one of claims 1 to 4, comprising knocking down / silencing the CD59 gene of T cells.

6. The method according to any one of claims 4-5, wherein the CD59 inhibitor comprises a nucleic acid molecule, a protein, a small molecule compound and / or PROTAC technology.

7. The method according to any one of claims 4 to 6, wherein the CD59 inhibitor comprises a nucleic acid molecule targeting the CD59 gene.

8. The method according to any one of claims 4 to 7, wherein the CD59 inhibitor is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.

9. The method according to any one of claims 7-8, wherein the nucleic acid molecule targeting the CD59 gene comprises shRNA and / or siRNA.

10. The method according to any one of claims 4 to 9, wherein the CD59 inhibitor targets a target sequence of the CD59 gene in T cells, and the target sequence of the CD59 gene is shown in SEQ ID NO:

1.

11. The method according to any one of claims 9-10, wherein the siRNA comprises the sequence shown in any one of SEQ ID NOs: 28-32 or a sequence that differs therefrom by no more than 3 nucleotides.

12. The method of any one of claims 9-11, wherein the siRNA comprises one or more modified nucleotides. 13 . The method according to claim 9 , wherein the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, and the sense strand segment and the antisense strand segment contain complementary regions.

14. The method according to any one of claims 9 to 13, wherein the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3 to 7.

15. The method according to any one of claims 9 to 14, wherein the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9 to 13.

16. The method according to any one of claims 9 to 15, wherein the sense strand and / or antisense strand of the shRNA independently comprises one or more modified nucleotides.

17. The method according to any one of claims 1 to 16, comprising editing the target sequence of the CD59 gene using a CRISPR / Cas system.

18. The method of any one of claims 6-17, wherein the nucleic acid molecule comprises an sgRNA.

19. The method according to claim 18, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.

20. A CD59 inhibitor capable of inhibiting the expression, function and / or activity of CD59 molecules in T cells, wherein the CD59 inhibitor targets a target sequence of the CD59 gene in T cells, and the target sequence of the CD59 gene is shown in SEQ ID NO:

1. The CD59 inhibitor according to claim 20 , wherein the CD59 molecule is an intracellular CD59 molecule.

22. The CD59 inhibitor according to any one of claims 20 to 21, which targets a target sequence in the nucleotide region from 82 to 165 in SEQ ID NO:

1.

23. The CD59 inhibitor according to any one of claims 20 to 22, which targets a target sequence in the nucleotide region from 248 to 294 in SEQ ID NO:

1. The CD59 inhibitor according to any one of claims 20 to 23, which targets a target sequence in the nucleotide region from 248 to 269 in SEQ ID NO:

1.

25. The CD59 inhibitor according to any one of claims 20 to 24, comprising a nucleic acid molecule capable of knocking down / silencing the CD59 gene. The CD59 inhibitor according to any one of claims 20 to 25, which is a single-stranded nucleic acid molecule or a double-stranded nucleic acid molecule.

27. The CD59 inhibitor according to any one of claims 20 to 26, comprising shRNA, siRNA and / or sgRNA.

28. The CD59 inhibitor according to claim 27, wherein the shRNA, siRNA and / or sgRNA is identical to or complementary to any continuous fragment of 16-35 nucleotides in length of the sequence shown in SEQ ID NO:

1.

29. The CD59 inhibitor according to any one of claims 27-28, wherein the siRNA comprises the sequence shown in any one of SEQ ID NOs: 28-32.

30. The CD59 inhibitor of any one of claims 27-29, wherein the siRNA comprises one or more modified nucleotides.

31. The CD59 inhibitor according to any one of claims 27 to 30, wherein the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3 to 7 and 9 to 25.

32. The CD59 inhibitor according to any one of claims 27 to 31, wherein the shRNA comprises a sense chain segment and an antisense chain segment, and a stem-loop structure connecting the sense chain segment and the antisense chain segment, and the sense chain segment and the antisense chain segment contain complementary regions.

33. The CD59 inhibitor according to any one of claims 27 to 32, wherein the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3 to 7.

34. The CD59 inhibitor according to any one of claims 27 to 33, wherein the antisense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9 to 13 or a sequence that differs therefrom by no more than 3 nucleotides.

35. The CD59 inhibitor according to any one of claims 27 to 34, wherein the sense strand and / or antisense strand of the shRNA independently comprises one or more modified nucleotides.

36. The CD59 inhibitor according to any one of claims 27 to 35, wherein the stem-loop of the shRNA comprises a nucleotide sequence represented by CTCGAG or GAGCTC.

37. The CD59 inhibitor according to any one of claims 27 to 35, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33 to 44.

38. The CD59 inhibitor according to any one of claims 30-37, wherein the modification comprises a chemical modification.

39. The CD59 inhibitor according to any one of claims 20 to 38, comprising an expression vector for the shRNA, siRNA and / or sgRNA according to any one of claims 27 to 38.

40. The CD59 inhibitor of claim 39, wherein the expression vector comprises a viral vector. The CD59 inhibitor according to claim 40 , wherein the viral vector comprises a lentiviral vector, a retroviral vector or an adeno-associated viral vector.

42. The CD59 inhibitor according to any one of claims 39 to 41, wherein the preparation of the shRNA expression vector comprises the following steps: (1) designing the shRNA according to the CD59 gene as shown in SEQ ID NO: 1; (2) Inserting the shRNA into an expression vector. The CD59 inhibitor according to claim 42 , wherein the shRNA is inserted into the XhoI and Agel restriction sites of the expression vector.

44. The CD59 inhibitor according to any one of claims 20 to 43, comprising a recombinant lentivirus, wherein the recombinant lentivirus is prepared by co-transfecting mammalian cells with the expression vector according to any one of claims 39 to 43 and a packaging helper plasmid.

45. The CD59 inhibitor of any one of claims 20-44, comprising a host cell transfected with at least one CD59 inhibitor of any one of claims 20-44.

46. ​​The CD59 inhibitor of claim 45, wherein the host cell comprises an immune cell.

47. The CD59 inhibitor of claim 46, wherein the immune cells comprise T cells.

48. A method for inhibiting the expression, function and / or activity of CD59 molecules in T cells, comprising: The T cells are contacted with the CD59 inhibitor of any one of claims 20-47.

49. A method for silencing the CD59 gene in T cells, comprising: The T cells are contacted with the CD59 inhibitor of any one of claims 20-47.

50. An engineered T cell having reduced expression, function and / or activity of the CD59 molecule compared to a non-engineered T cell. The engineered T cell according to claim 50 , wherein the CD59 gene is knocked down or silenced.

52. The engineered T cell of any one of claims 50-51, wherein the engineering approach comprises silencing the CD59 gene in the T cell by targeting a target sequence in the CD59 gene through antisense RNA, antagomir, siRNA, shRNA, large-range nuclease, zinc finger nuclease, transcription activator-like effector nuclease and / or CRISPR system.

53. The engineered T cell according to any one of claims 50-52, comprising silencing the CD59 gene of the T cell using the CRISPR / Cas9 system.

54. The engineered cell of claim 53, wherein the CRISPR / Cas9 system comprises sgRNA.

55. The engineered cell of claim 54, wherein the sgRNA targets a target sequence in the CD59 gene, the target sequence in the CD59 gene being as shown in SEQ ID NO:

1.

56. The engineered cell according to any one of claims 54-55, wherein the sgRNA is identical to or complementary to any continuous fragment of 16-35 nucleotides in length of the sequence shown in SEQ ID NO:

1.

57. The engineered cell of any one of claims 54-56, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 33-44.

58. The engineered cell of any one of claims 52-57, wherein the siRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 28-32.

59. The engineered cell according to any one of claims 52-58, wherein the shRNA comprises a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, the sense strand fragment and the antisense strand fragment containing complementary regions.

60. The engineered cell according to any one of claims 52-59, wherein the sense strand of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 3-7.

61. The engineered cell according to any one of claims 52-60, wherein the stem-loop structure of the shRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 9-13.

62. The engineered cell of any one of claims 50-61, having one or more of the following properties: (1) Compared with unengineered T cells, the ability to secrete cytokines is enhanced; (2) enhanced tumor cell killing efficiency compared with unengineered T cells; (3) enhanced expansion capacity compared to unengineered T cells; and (4) Compared with unengineered T cells, the survival time in the body is enhanced.

63. A pharmaceutical composition comprising the CD59 inhibitor of any one of claims 20-47, and / or the engineered cell of any one of claims 50-62, and optionally a pharmaceutically acceptable carrier.

64. Use of the CD59 inhibitor of any one of claims 20-47, the engineered cell of any one of claims 50-62, and / or the pharmaceutical composition of claim 63 in the preparation of a medicament for preventing and / or treating a disease and / or condition.

65. Use according to claim 64, wherein the disease and / or disorder comprises a tumor.

66. The use according to any one of claims 64-65, wherein the disease and / or disorder comprises an immunodeficiency disease.

Images