Method for establishing zebrafish model for simulating duodenal obstruction

Abstract

Neonatal congenital duodenal obstruction is an intestinal lumen obstructive disease caused by abnormal development of the duodenum during fetal period, and it is a relatively common type among neonatal digestive tract obstructions. Its global incidence is approximately 1 / 5000 to 1 / 10000 neonates, and it is more common in Asian populations. The typical clinical manifestations of this disease include vomiting, upper abdominal distension, and delayed passage of meconium after birth. The present invention provides a method for establishing a zebrafish model for simulating duodenal obstruction, and additionally provides a design idea for the target.

Description

Technical Field

[0001] The present invention relates to the technical field of the construction method of a model animal disease model, and particularly relates to a method for establishing a zebrafish model for simulating duodenal obstruction. Background Art

[0002] Neonatal congenital duodenal obstruction is an intestinal obstructive disease caused by abnormal development of the duodenum during fetal development, and is a relatively common type among neonatal digestive tract obstructions. Its global incidence is approximately 1 / 5000 to 1 / 10000 neonates, and it is more common in the Asian population. The typical clinical manifestations of this disease include vomiting, abdominal distension in the upper abdomen, and delayed passage of meconium after birth.

[0003] The etiology of duodenal obstruction has not been fully clarified. Currently, the main pathological mechanism hypotheses include abnormal recanalization of the intestinal tract during embryonic development (usually occurring at 5 - 7 weeks of pregnancy) and mesenteric artery blood supply disorders. Most cases are sporadic, but some patients may have genetic susceptibility. In recent years, gene research has shown that genes such as JAG1, GATA4, and FGF10 may play important roles in the development of the duodenum.

[0004] SNAPC4 The gene is located on human chromosome 15 and encodes the 4th subunit of the small nuclear ribonucleoprotein activating protein complex (Small Nuclear RNA Activating Protein Complex 4). This protein plays a key role in the transcription processes of RNA polymerase II and III, especially in the transcriptional activation of small nuclear RNA. In recent years, research on the snapc4 gene has shown that its mutations are associated with various diseases. In 2023, Altamimi et al. found homozygous mutations in the snapc4 gene in 2 neonates with biliary atresia born to a consanguineous couple, highlighting its possible role in neonatal biliary atresia. snapc4 The association between the function and expression of [the gene] and abnormal development of the digestive tract requires further study.

[0005] This study uses the CRISPR / Cas9 system to construct snapc4 a zebrafish line, and describes the disease onset situation of the mutant fish line through structural and pathological analyses of the digestive tract malformations of the mutants.

[0006] Clinical features Patient information Gender Male Phenotype of digestive tract malformation Duodenal obstruction Other diseases Congenital ileocecal ectopia, neonatal gastric hemorrhage, scalp edema, patent ductus arteriosus, neonatal hyperbilirubinemia, neonatal anemia Family members with the disease None Related genes SNAPC4 Nucleotide change NM_003086:c.A1354GNM_003086:c.A1021G Amino acid change p.K452E, p.N341D Genotype Compound heterozygous Genetic origin Mother / Father Summary of the Invention

[0007] A method for establishing a zebrafish model for simulating duodenal obstruction, characterized by comprising the following steps:

[0008] S1. Design the gRNA target sequence on the amino acid domain of the zebrafish snapc4 gene. The specific sequence of sgRNA is GAGATCGAGGTCCAGCTCTCTGG or AACTCTATCTTCTCAGTACCTGG or CTAGGGTCCTCCAGCTAATGAGG or GATAAAATCGCAGAGGCTCTTGG on the coding strand. Synthesize primers.

[0009] S2. Using the pMD19- gata5 _gRNA scaffold vector as a template, prepare the in vitro transcription template of gRNA using the primers in step S1.

[0010] S3. Perform in vitro transcription and purification and recovery on the in vitro transcription template of gRNA in step S2 to obtain gRNA.

[0011] S4. Freshly mix the gRNA recovered in step S3 and Cas9 mRNA, so that the final concentration of gRNA reaches 320 ng / μL and Cas9 mRNA reaches 800 ng / μL, and then microinject them into single-cell stage zebrafish embryos, injecting 180 - 220 embryos for each target.

[0012] S5. Collect the zebrafish embryos 72 hours after injecting into single-cell stage zebrafish embryos in step S4, extract the genome, PCR amplify the target fragment, sequence it. The injection batch of embryos with double peaks in the sequencing results enter the breeding system (Beijing Aisheng Company). Breed until sexual maturity, and detect zebrafish with effective mutation types by screening their next-generation embryos, thereby obtaining snapc4 mutant zebrafish.

[0013] S6. Take the snapc4 mutant zebrafish in step S5, and perform real-time in vivo fluorescence imaging examination of the peristalsis of the fish digestive tract on the snapc4 mutant zebrafish when the embryos are 6 days old.

[0014] S7. Take the snapc4 mutant zebrafish in step S5, and perform pathological analysis on the snapc4 mutant zebrafish when the embryos are 7 days old.

[0015] S8. Analyze and describe the snapc4 disease occurrence of the mutant zebrafish by analyzing the data obtained in step S6 and step S7.

[0016] For the above steps of model establishment, further optimization is carried out as follows:

[0017] In step S1, the specific sequence selected for sgRNA is GATAAAATCGCAGAGGCTCTTGG on the coding strand. Its sequence directly corresponds to the sequence of mRNA and encodes a protein.

[0018] In step S1, the gRNA target sequence is designed in the snapc4 amino acid domain of the zebrafish gene.

[0019] In step S4, the gRNA and Cas9 mRNA are freshly mixed and microinjected into zebrafish embryos at the single-cell stage. The gRNA is 320 ng / μL and the Cas9 mRNA is 800 ng / μL.

[0020] In step S5, the embryos of the injection batch with a double-peak sequencing result enter the feeding system. When they reach sexual maturity, their next-generation embryos are screened to detect zebrafish with effective mutation types.

[0021] In step S6, the method for observing the condition with a fluorescence microscope: Select zebrafish larvae at 6 dpf from the mutant zebrafish in step S5 and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add DMSO dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash with zebrafish culture water 3 times, fix the sample with low melting point glue after washing, and finally take pictures with a stereomicroscope. snapc4 In step S6, the method for observing the condition with a fluorescence microscope: Select zebrafish larvae at 6 dpf from the mutant zebrafish in step S5 and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add DMSO dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash with zebrafish culture water 3 times, fix the sample with low melting point glue after washing, and finally take pictures with a stereomicroscope.

[0022] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: Put snapc4 the mutant zebrafish larvae into 4% paraformaldehyde for fixation for 48 h, and successively perform dehydration, clearing, wax infiltration, and embedding. When sectioning, the section thickness is 4 μm, stained with HE, and observe the pathological conditions of the digestive tract with a bright-field microscope.

[0023] The snapc4 mutant zebrafish larvae are 6 - 7 days old when they develop.

[0024] The beneficial effects of the present invention: Based on the online CRISPR target design tool ChopChop platform, the present invention designs the target. According to factors such as the PAM sequence, GC content, and specificity score, the most suitable target selection is provided. The gRNA and Cas9 mRNA are freshly mixed and microinjected. Embryos 72 hours after injection are collected, the target fragment is amplified by PCR and then sequenced. The results show that there are double peaks in the Crispant homozygous genotype zebrafish, indicating that the CRISPR / Cas9 system designed this time works. The mutant zebrafish line established by the present invention snapc4 can finally simulate the disease characteristics of neonatal congenital duodenal obstruction after the detection and analysis in steps S6 - S8. Brief Description of the Drawings

[0025] Figure 1 For zebrafish snapc4 Target sequence map for mutant construction.

[0026] Figure 2 For the zebrafish control group and snapc4 Real-time in vivo fluorescence imaging of gastrointestinal motility in the mutant.

[0027] Figure 3 For the zebrafish control group and snapc4 Data comparison chart of fluorescence intensity measurement in the mutant. In the figure, control is the control group, snapc4 is the experimental group, and "*" is used to mark statistical significance.

[0028] Figure 4 For the zebrafish control group and snapc4 Pathological changes in the digestive tract of the mutant.

[0029] Figure 5 For zebrafish snapc4 Genomic sequence verification map.

[0030] Figure 6 Sequencing results of mutant zebrafish with the Target1 site cleaved.

[0031] Figure 7 Sequencing results of mutant zebrafish with the Target2 site cleaved.

[0032] Figure 8 Sequencing results of mutant zebrafish with the Target3 site cleaved.

[0033] Figure 9 Sequencing results of mutant zebrafish with the Target4 site cleaved.

[0034] Figure 10 Cleavage efficiency map of mutant zebrafish with the Target1 site cleaved.

[0035] Figure 11 Cleavage efficiency map of mutant zebrafish with the Target2 site cleaved.

[0036] Figure 12 Cleavage efficiency map of mutant zebrafish with the Target3 site cleaved.

[0037] Figure 13 Cleavage efficiency map of mutant zebrafish with the Target4 site cleaved.. Detailed Implementation Manner

[0038] To overcome the above deficiencies, the present invention provides a method for establishing a zebrafish model for simulating duodenal obstruction to solve the problems in the above-mentioned background art.

[0039] A method for establishing a zebrafish model for simulating duodenal obstruction, comprising the following steps:

[0040] S1. Design the gRNA target sequence on the amino acid domain of the zebrafish snapc4 gene and synthesize primers;

[0041] S2. Using the pMD19- gata5 _gRNA scaffold vector as a template, prepare the gRNA in vitro transcription template using the primers in step S1;

[0042] S3. Perform in vitro transcription and purification and recovery on the gRNA in vitro transcription template in step S2 to obtain gRNA;

[0043] S4. Freshly mix the gRNA obtained by recovering in step S3 and Cas9 mRNA and microinject them into zebrafish embryos at the single-cell stage, injecting 180-220 embryos for each target;

[0044] S5. Collect the zebrafish embryos 72 hours after injecting into the single-cell stage zebrafish embryos in step S4, extract the genome, PCR amplify the target fragment, sequence, and the injection batch embryos with a double-peak sequencing result enter the breeding system. The breeding system selects a zebrafish breeding system (ESEN-AW-DU5SS, Beijing Aisheng Company). When breeding until sexual maturity, screen the next-generation embryos to detect zebrafish with effective mutation types, thereby obtaining snapc4 mutant zebrafish;

[0045] S6. Take the snapc4 mutant zebrafish in step S5, and perform real-time in vivo fluorescence imaging examination of the digestive tract peristalsis of the snapc4 mutant zebrafish when the embryos are 6 days old;

[0046] S7. Take the snapc4 mutant zebrafish in step S5, and perform pathological analysis on the snapc4 mutant zebrafish when the embryos are 7 days old;

[0047] S8. Analyze and describe the snapc4 disease onset situation of the mutant zebrafish by analyzing the data obtained in step S6 and step S7.

[0048] In step S1, the synthesis and reading of the specific sequence of sgRNA is the end of the pentose sugar in the nucleotide, which has a hydroxyl group. Here, an explanation is needed. The 5' and 3' ends of DNA or RNA refer to the numbering of the pentose sugar in the nucleotide. The 5' end has a phosphate group, and the 3' end has a hydroxyl group. The synthesis and reading directions of the nucleic acid chain are both from 5' to 3', with 5' being the head end and 3' being the tail end.

[0049] In step S1, the gRNA target sequence is designed in the snapc4 amino acid domain of the zebrafish gene.

[0050] In step S4, after the gRNA and Cas9 mRNA are freshly mixed, they are microinjected into zebrafish embryos at the single-cell stage. The gRNA is 320 ng / μL, and the Cas9 mRNA is 800 ng / μL.

[0051] In step S4, 200 injections are made for each target.

[0052] In step S6, the method for observing the situation with a fluorescence microscope: Take the snapc4 mutant zebrafish. Select zebrafish larvae at 6 dpf and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add DMSO dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash 3 times with zebrafish culture water, fix the sample with low melting point gel after washing, and finally take pictures with a stereomicroscope.

[0053] In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: Place the snapc4 mutant zebrafish larvae in 4% paraformaldehyde for fixation for 48 h, and successively perform dehydration, clearing, wax infiltration, and embedding. When sectioning, the section thickness is 4 μm, stained with HE, and observe the pathological conditions of the digestive tract with a bright field microscope.

[0054] snapc4 The mutant zebrafish larvae are 6 - 7 days old.

[0055] In order to make the technical means, creative features, achieved purposes and effects of the present invention easy to understand, the present invention will be further described below in conjunction with specific embodiments.

[0056] The specific target design of the present invention is as follows:

[0057] (1) Selection of target position. Select the target position as follows (note: the exon sequence of the gene is marked in red font; the sequence amplification primer is underlined; the target sequence is marked with a yellow background or wavy line), as Figure 1 shown.

[0058] (2) The designed target sequences are as follows:

[0059] snapc4-Target1 GAGATCGAGGTCCAGCTCTC TGG-3

[0060] snapc4-Target2 AACTCTATCTTCTCAGTACC TGG-3

[0061] snapc4-Target3 CTAGGGTCCTCCAGCTAATG AGG-3

[0062] snapc4-Target4 GATAAAATCGCAGAGGCTCT TGG-3

[0063] The 3 above is 3', which is the tail end.

[0064] (3) The forward primers for amplifying the target gRNA transcription templates are respectively:

[0065] snapc4-T1F

[0066] TTAATACGACTCACTATAGAGATCGAGGTCCAGCTCTCGTTTTAGAGC

[0067] TAGAAATAG

[0068] snapc4-T2F

[0069] TTAATACGACTCACTATAGAACTCTATCTTCTCAGTACCGTTTTAGAGC

[0070] TAGAAATAG

[0071] snapc4-T3F

[0072] TTAATACGACTCACTATAGCTAGGGTCCTCCAGCTAATGGTTTTAGAG

[0073] CTAGAAATAG

[0074] snapc4-T4F

[0075] TTAATACGACTCACTATAGATAAAATCGCAGAGGCTCTGTTTTAGAGC

[0076] TAGAAATAG

[0077] (4) The reverse primer for amplifying the target gRNA transcription template is:

[0078] T7gRNA-R AAAAAAAGCACCGACTCGGTGCCAC

[0079] (5)Design and synthesize target detection primers as follows:

[0080] The detection primers for target 1, target 2, and target 3 are:

[0081] snapc4-F1 GTGCTGACGATTTAGAGCTTCC

[0082] snapc4-R1 AACTGCATTGGTCAGCAAAGTC

[0083] The detection primer for target 4 is:

[0084] snapc4-F2 GATGATTTGAAGAGGTTCTGGC

[0085] snapc4-R2 TGAGGAGATCGTCTTCCTCTTC

[0086] (6)Verification of the snapc4 genomic sequence:

[0087] After amplifying the DNA sequence containing several targets and sequencing, it is consistent with the designed target sequence.

[0088] (7)In vitro transcription concentration of snapc4 targets

[0089] T1-gRNA: 5115 ng / μL

[0090] T2-gRNA: 1851 ng / μL

[0091] T3-gRNA: 3943 ng / μL

[0092] T4-gRNA: 2922 ng / μL

[0093] (8)Injection of snapc4 targets

[0094] Mix the target gRNA and Cas9 protein and inject them into AB wild-type zebrafish embryos. The final concentration of Cas9 protein injection is 800 ng / μL, and the final concentration of gRNA is 320 ng / μL. Microinjection is performed at the 1-cell stage of zebrafish embryos, 1 nL is injected into each embryo, and about 100 embryos are injected for each target. After 3 dpf, 20 larvae are randomly selected from each group to extract genomic DNA and perform PCR amplification, and then sent for sequencing. The sequencing results are as Figure 6 ,Figure 7 , Figure 8 and Figure 9 as shown below:

[0095] A. Figure 6 Showing cleavage of Target1 GAGATCGAGGTCCAGCTCTC TGG;

[0096] B. Figure 7 Showing cleavage of Target2 AACTCTATCTTCTCAGTACC TGG;

[0097] C. Figure 8 Showing cleavage of Target3 CTAGGGTCCTCCAGCTAATG AGG;

[0098] D. Figure 9 Showing cleavage of Target4 GATAAAATCGCAGAGGCTCT TGG.

[0099] (9) Detection of snapc4 target cleavage efficiency

[0100] The PCR products were subjected to TA cloning, and 15 clones were selected for each and sent for sequencing. After removing the sequencing results without signals and non-clonal ones, the target cleavage efficiency was calculated. For specific reference, see Figure 10 , Figure 11 , Figure 12 and Figure 13 , and the conclusions are as follows:

[0101] As Figure 10 shown, the cleavage efficiency of Target1 is 6 / 15;

[0102] As Figure 11 shown, the cleavage efficiency of Target2 is 7 / 15;

[0103] As Figure 12 shown, the cleavage efficiency of Target3 is 10 / 18;

[0104] As Figure 13 shown, the cleavage efficiency of Target4 is 6 / 7.

[0105] In summary, the specific sequences of the sgRNAs of the present invention can actually be selected from any one of Target1, Target2, Target3, or Target4, and cleavage has occurred in all of them. However, considering the cleavage efficiency, Target4 is preferably selected.

[0106] Example 1:

[0107] The present invention designs the target based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. Freshly mix and microinject gRNA and Cas9 mRNA, collect embryos 72 hours after injection, amplify the target fragment by PCR and then sequence. The results show that there are double peaks in the Crispant homozygous genotype zebrafish, indicating that the designed CRISPR / Cas9 system in this experiment works ( Figures 6 - 9 )

[0108] Fluorescent gastrointestinal tract examination of mutants: Real-time in vivo fluorescence imaging of the gastrointestinal tract peristalsis of mutant zebrafish at 7 days of development shows obvious abnormalities in the gastrointestinal tract structure, including narrowing of the intestinal bulb, severe stenosis of the gastrointestinal lumen, obstruction of contraction, and absence of peristalsis, etc. ( Figure 2 ) Measure the fluorescence intensity of zebrafish. It is found that the fluorescence intensity of the control group is about twice that of the snapc4 knockdown group. After statistical software analysis, the difference is significant (p < 0.0001, indicated by four * in the figure), indicating that obvious congenital obstruction has occurred in the gastrointestinal tract of zebrafish obtained by using this experimental method ( Figure 3 ) In the experimental results, "*" is usually used to mark statistical significance. Specifically, it means that the difference between two or more groups has reached a preset significance level, so that this difference is considered not caused by random error but has practical significance. The P value is less than or equal to 0.0001: In the statistical significance report of statistics, four asterisks indicate that the P value is less than or equal to 0.0001, which means that the probability of observing the current difference or a more extreme difference between the two or more groups of data being compared is very small, and it can almost be considered due to a real difference rather than accidental factors.

[0109] Pathological analysis of mutants: Take the Crispant homozygous genotype zebrafish larvae at 7 days of growth screened in Example 1. The HE staining results show that the zebrafish with snapc4 gene knockdown shows a trend of overall narrowing of the gastrointestinal tract, obvious reduction of the intestinal bulb folds, and the appearance of a large number of small vesicular goblet cells ( Figure 4 )

[0110] Combining the fluorescent gastrointestinal tract examination of mutants and the pathological analysis of mutants, thus the mutant zebrafish line established by the present invention snapc4 can simulate the disease characteristics of neonatal congenital duodenal obstruction.

[0111] The present invention provides Experimental Example 1, Experimental Example 2, Experimental Example 3 and Experimental Example 4. Experimental Examples 1-4 all use the following same reagents and instruments:

[0112] Reagents: DEPC water (Solarbio), agarose powder Agarose - Molecular Biology Grade (invitrogen), borosilicate glass capillary (model 1B100F - 4, World Precision Instruments, USA), HiScribe™ T7 (product number E2040S, New England Biolabs, USA); miRNA isolation kit (product number AM1561, Invitrogen, USA); NLS - Cas9 nuclease (model E365, Novoprotein, China).

[0113] Instruments: The feeding system selects the zebrafish breeding system (ESEN - AW - DU5SS, Beijing Aisheng Co., Ltd.), constant temperature biochemical incubator (Shanghai Yuejin Medical Instrument Co., Ltd.), stereomicroscope (P2 - CTLA, Nekon, Japan), culture dish, microinjection needle, microinjector (model PICOSPRITZER® Ⅲ, Parker, USA), real - time fluorescence quantitative PCR instrument (CFX96, Bio - Rad, USA).

[0114] Experimental Example 1

[0115] Based on the online CRISPR target design tool ChopChop platform, the present invention designs the target, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score.

[0116] A method for establishing a zebrafish model for simulating duodenal obstruction, comprising the following steps:

[0117] S1. Design the gRNA target sequence on the amino acid domain of the zebrafish snapc4 gene, and the specific sequence of sgRNA is 5'-GATAAAATCGCAGAGGCTCT TGG-3', and synthesize primers;

[0118] S2. Using the pMD19 - gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template;

[0119] S3. Perform in vitro transcription and purification recovery on the gRNA in vitro transcription template in step S2 to obtain gRNA;

[0120] S4. Freshly mix the gRNA obtained by recycling in step S3 and Cas9 mRNA, and then microinject them into single - cell - stage zebrafish embryos, with 180 - 220 injections for each target;

[0121] S5. Collect zebrafish embryos 72 hours after injecting into single-cell stage zebrafish embryos in step S4, extract the genome, PCR amplify the target fragment, sequence, and for the injection batches of embryos with double peaks in the sequencing results, put them into the breeding system. When they reach sexual maturity, screen their next-generation embryos to detect zebrafish with effective mutant types, thereby obtaining snapc4 mutant zebrafish;

[0122] S6. Take the snapc4 mutant zebrafish, and perform real-time in vivo fluorescence imaging examination of the peristalsis of the fish digestive tract on the snapc4 mutant zebrafish at 6 days after the embryo stage; measure the fluorescence intensity of the zebrafish. It is found that the fluorescence intensity of the control group is about twice that of the snapc4 knockdown group. After statistical software analysis, the difference is significant (p < 0.001, indicated by four * in the figure), indicating that obvious congenital obstruction has occurred in the digestive tract of the zebrafish obtained by using the experimental method of this experiment.

[0123] S7. Take the snapc4 mutant zebrafish, and perform pathological analysis on the snapc4 mutant zebrafish at 7 days after the embryo stage;

[0124] S8. Analyze and describe the snapc4 pathogenesis of the mutant zebrafish based on the data obtained in step S6 and step S7.

[0125] In step S1, the gRNA target sequence is designed in the snapc4 amino acid domain of the zebrafish

[0126] In step S4, after the gRNA and Cas9 mRNA are freshly mixed, they are microinjected into single-cell stage zebrafish embryos. The gRNA is 320 ng / μL and the Cas9 mRNA is 800 ng / μL.

[0127] In step S4, 200 embryos are injected for each target.

[0128] The method for observing the condition with a fluorescence microscope in step S6: Select the zebrafish larvae at 6 dpf from the snapc4 mutant zebrafish in step S5 and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add the dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash 3 times with zebrafish culture water, fix the sample with low melting point glue after washing, and finally take pictures with a stereomicroscope.

[0129] In step S7 snapc4 perform pathological analysis on the mutant zebrafish larvae: snapc4The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, cleared, infiltrated with wax, and embedded in turn. When sectioning, the section thickness was 4 μm, stained with HE, and the pathological conditions of the digestive tract were observed under a bright-field microscope.

[0130] snapc4 The mutant zebrafish larvae had developed to 6 - 7 days old.

[0131] For this experimental example, the specific sequence of the sgRNA selected was GAGATCGAGGTCCAGCTCTCTGG, and it was at the tail end. Because it was known from the above target design module that the cleavage efficiency of Target1 selected was 6 / 15, although the efficiency was not high, cleavage still occurred and it could be selected.

[0132] Experimental Example 2

[0133] The present invention designs the target based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score.

[0134] A method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps:

[0135] S1. Design the gRNA target sequence on the amino acid domain of the zebrafish snapc4 gene, and the specific sequence of the sgRNA is GATAAAATCGCAGAGGCTCT TGG-3, and synthesize primers;

[0136] S2. Using the pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the in vitro transcription template of gRNA;

[0137] S3. Perform in vitro transcription on the in vitro transcription template of gRNA in step S2, and purify and recover to obtain gRNA;

[0138] S4. Freshly mix the gRNA recovered in step S3 and Cas9 mRNA, and microinject them into zebrafish embryos at the single-cell stage, injecting 180 - 220 embryos for each target;

[0139] S5. Collect the zebrafish embryos 72 hours after injecting into the single-cell stage zebrafish embryos in step S4, extract the genome, PCR amplify the target fragment, sequence, and the injection batch embryos with double peaks in the sequencing results enter the breeding system. When breeding until sexual maturity, screen the next-generation embryos to detect zebrafish with effective mutation types, so as to obtain snapc4 mutant zebrafish;

[0140] S6. Take the snapc4Mutant zebrafish, at 6 days after embryo completion snapc4 Perform real-time in vivo fluorescence imaging examination of the digestive tract peristalsis of mutant zebrafish; measure the fluorescence intensity of zebrafish. It was found that the fluorescence intensity of the control group was about twice that of the snapc4 knockdown group. After statistical software analysis, the difference was significant (p < 0.001, indicated by four * in the figure), indicating that obvious congenital obstruction occurred in the digestive tract of zebrafish obtained by using this experimental method.

[0141] S7. Take the snapc4 Mutant zebrafish, at 7 days after embryo completion snapc4 Perform pathological analysis on mutant zebrafish;

[0142] S8. Analyze and describe snapc4 The morbidity of mutant zebrafish.

[0143] In step S1, the gRNA target sequence is designed in the snapc4 Amino acid domain of the zebrafish gene.

[0144] In step S4, after the gRNA and Cas9 mRNA are freshly mixed, they are microinjected into zebrafish embryos at the single-cell stage. The gRNA is 320 ng / μL, and the Cas9 mRNA is 800 ng / μL.

[0145] In step S4, 200 injections are made for each target.

[0146] In step S6, the method for observing the condition with a fluorescence microscope: Take the snapc4 Mutant zebrafish. Select zebrafish larvae at 6 dpf and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add the dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash with zebrafish culture water 3 times, fix the sample with low melting point glue after washing, and finally take pictures with a stereomicroscope.

[0147] In step S7 snapc4 Perform pathological analysis on mutant zebrafish larvae: Put the snapc4 Mutant zebrafish larvae into 4% paraformaldehyde for fixation for 48 h, and successively perform dehydration, clearing, wax infiltration, and embedding. When sectioning, the section thickness is 4 μm, stained with HE, and observe the pathological conditions of the digestive tract with a bright-field microscope.

[0148] snapc4 The mutant zebrafish larvae are 6 - 7 days old.

[0149] The specific sequence of the sgRNA selected for this experimental example is AACTCTATCTTCTCAGTACCTGG, and it is at the tail end. Since it is known from the above target design module that the cleavage efficiency of Target2 selected is 7 / 15, although the efficiency is not high, cleavage still occurred and it can be selected.

[0150] Experimental Example 3

[0151] The present invention designs the target based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score.

[0152] A method for establishing a zebrafish model for simulating duodenal obstruction includes the following steps:

[0153] S1. Design the gRNA target sequence on the amino acid domain of the zebrafish snapc4 gene. The specific sequence of the sgRNA is GATAAAATCGCAGAGGCTCT TGG-3, and synthesize primers.

[0154] S2. Using the pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the in vitro transcription template of the gRNA.

[0155] S3. Perform in vitro transcription and purification and recovery on the gRNA in vitro transcription template in step S2 to obtain the gRNA.

[0156] S4. Freshly mix the gRNA recovered in step S3 and Cas9 mRNA and microinject them into zebrafish embryos at the single-cell stage, injecting 180 - 220 embryos for each target.

[0157] S5. Collect the zebrafish embryos 72 hours after injecting into the single-cell stage zebrafish embryos in step S4, extract the genome, PCR amplify the target fragment, sequence, and the injection batch embryos with a double-peak sequencing result enter the feeding system. When they reach sexual maturity, screen their next-generation embryos to detect zebrafish with effective mutation types, thereby obtaining snapc4 mutant zebrafish;

[0158] S6. Take the snapc4 mutant zebrafish in step S5, and at 6 days after the embryo snapc4Perform real-time in vivo fluorescence imaging of the digestive tract peristalsis of mutant zebrafish; measure the fluorescence intensity of zebrafish and find that the fluorescence intensity of the control group is about twice that of the snapc4 knockdown group. After statistical software analysis, the difference is significant (p < 0.001, indicated by four * in the figure), indicating that obvious congenital obstruction has occurred in the digestive tract of zebrafish obtained by using this experimental method.

[0159] S7. Take the snapc4 mutant zebrafish at 7 days after embryo completion snapc4 and perform pathological analysis on the mutant zebrafish;

[0160] S8. Analyze and describe the snapc4 disease incidence of the mutant zebrafish by analyzing the data obtained in steps S6 and S7.

[0161] In step S1, the gRNA target sequence is designed in the snapc4 amino acid domain of the zebrafish gene.

[0162] In step S4, after freshly mixing gRNA and Cas9 mRNA, they are microinjected into zebrafish embryos at the single-cell stage. The concentration of gRNA is 320 ng / μL, and the concentration of Cas9 mRNA is 800 ng / μL.

[0163] In step S4, 200 injections are made for each target.

[0164] The method for observing the situation under a fluorescence microscope in step S6: Select zebrafish larvae at 6 dpf in step S5 and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add the dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash with zebrafish culture water 3 times, fix the sample with low melting point glue after washing, and finally take pictures with a stereomicroscope. snapc4 In step S7,

[0165] perform pathological analysis on the mutant zebrafish larvae: snapc4 Put the snapc4 mutant zebrafish larvae into 4% paraformaldehyde for fixation for 48 h, and successively perform dehydration, clearing, wax infiltration, and embedding. When sectioning, the section thickness is 4 μm, perform HE staining, and observe the pathological conditions of the digestive tract under a bright field microscope.

[0166] snapc4 The mutant zebrafish larvae are developed to 6 - 7 days old.

[0167] The specific sequence of the sgRNA selected for this experimental example is CTAGGGTCCTCCAGCTAATGAGG, and it is at the tail end. Since it is known from the above target design module that the cleavage efficiency of Target3 selected is 10 / 18, although the efficiency is not high, cleavage still occurred and it can be selected.

[0168] Experimental Example 4

[0169] The present invention designs the target based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score.

[0170] A method for establishing a zebrafish model for simulating duodenal obstruction, comprising the following steps:

[0171] S1. Design the gRNA target sequence on the amino acid domain of the zebrafish snapc4 gene, and the specific sequence of the sgRNA is GATAAAATCGCAGAGGCTCT TGG-3, and synthesize primers;

[0172] S2. Using the pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template;

[0173] S3. Perform in vitro transcription and purification and recovery on the gRNA in vitro transcription template in step S2 to obtain gRNA;

[0174] S4. Freshly mix the gRNA recovered in step S3 and Cas9 mRNA, and then microinject them into zebrafish embryos at the single-cell stage, injecting 180-220 embryos for each target;

[0175] S5. Collect the zebrafish embryos 72 hours after the injection into the single-cell stage zebrafish embryos in step S4, extract the genome, PCR amplify the target fragment, sequence, and the injection batch embryos with a double-peak sequencing result enter the feeding system. When they reach sexual maturity, screen their next-generation embryos to detect zebrafish with effective mutation types, thereby obtaining snapc4 mutant zebrafish;

[0176] S6. Take the snapc4 mutant zebrafish in step S5, and at 6 days after the embryo snapc4Perform real-time in vivo fluorescence imaging of the digestive tract peristalsis of mutant zebrafish; measure the fluorescence intensity of zebrafish and find that the fluorescence intensity of the control group is about twice that of the snapc4 knockdown group. After statistical software analysis, the difference is significant (p < 0.001, indicated by four * in the figure), indicating that obvious congenital obstruction has occurred in the digestive tract of zebrafish obtained by using this experimental method.

[0177] S7. Take the snapc4 mutant zebrafish at 7 days after embryo completion snapc4 and perform pathological analysis on the mutant zebrafish;

[0178] S8. Analyze and describe snapc4 the disease incidence of the mutant zebrafish through the data obtained in steps S6 and S7.

[0179] In step S1, the gRNA target sequence is designed in the snapc4 amino acid domain of the zebrafish gene.

[0180] In step S4, after the gRNA and Cas9 mRNA are freshly mixed, they are microinjected into zebrafish embryos at the single-cell stage. The gRNA is 320 ng / μL and the Cas9 mRNA is 800 ng / μL.

[0181] In step S4, 200 injections are made for each target.

[0182] The method for observing the fluorescence microscope in step S6: Take the snapc4 mutant zebrafish and select zebrafish larvae at 6 dpf and place them in a 6-well plate for staining. Add 4 mL of zebrafish culture water to each well, and then add the dye to make the final concentration reach 1 mg / L. After staining for 24 hours, wash with zebrafish culture water 3 times, fix the sample with low melting point glue after washing, and finally take pictures with a stereomicroscope.

[0183] In step S7 snapc4 perform pathological analysis on the mutant zebrafish larvae: Put the snapc4 mutant zebrafish larvae into 4% paraformaldehyde for fixation for 48 h, and successively perform dehydration, clearing, wax infiltration, and embedding. When sectioning, the section thickness is 4 μm, stained with HE, and observe the pathological conditions of the digestive tract with a bright-field microscope.

[0184] snapc4 The mutant zebrafish larvae are developed to 6 - 7 days old.

[0185] The specific sequence of the sgRNA selected for this experimental example is GATAAAATCGCAGAGGCTCTTGG, and it is the tail end. Since it is known from the above target design module that the cleavage efficiency of the selected Target4 is 6 / 7, cleavage has occurred and the efficiency is the highest, so it can be selected and is the most preferred.

[0186] Advantages of the present invention: The present invention designs the target based on the online CRISPR target design tool ChopChop platform, and provides the most suitable target selection according to factors such as PAM sequence, GC content, and specificity score. The gRNA and Cas9mRNA are freshly mixed and microinjected, and the embryos 72 hours after injection are collected. After PCR amplification of the target fragment and sequencing, the results show that there are double peaks in the Crispant homozygous genotype zebrafish, indicating that the CRISPR / Cas9 system designed this time works. The snapc4 mutant zebrafish line can finally simulate the disease characteristics of neonatal congenital duodenal obstruction after the detection and analysis in steps S6-S7.

[0187] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for establishing a zebrafish model for simulating duodenal obstruction, characterized in that: The following steps are involved: S1. Design gRNA target sequences in zebrafish snapc4 On the amino acid domain of the gene, the specific sequence of sgRNA is any one of GAGATCGAGGTCCAGCTCTCTGG, AACTCTATCTTCTCAGTACCTGG, CTAGGGTCCTCCAGCTAATGAGG, and GATAAAATCGCAGAGGCTCTTGG, and the primer is synthesized; S2, pMD19- gata5 _gRNA scaffold vector as a template, use the primers in step S1 to prepare the gRNA in vitro transcription template; S3, in vitro transcription of the gRNA in vitro transcription template in step S2, purification and recovery to obtain gRNA; S4, freshly mix the gRNA and Cas9 mRNA recovered in step S3 to make the final concentration of gRNA reach 320 ng / μL and Cas9 mRNA reach 800 ng / μL, then microinject into one-cell stage zebrafish embryos, injecting 180 to 220 pieces per target site; S5. Collect zebrafish embryos injected into the single-cell stage zebrafish embryos in step S4 72 hours after completion, extract the genome, PCR amplify the target fragment, sequence, and enter the injected batch embryos with double peaks in the sequencing results into the breeding system, and raise them until sexual maturity by screening the next generation of embryos to detect effective mutant types of zebrafish, thereby obtaining snapc4 Mutant zebrafish.

2. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 1, characterized in that: In step S1, the sgRNA uses a specific sequence GATAAAATCGCAGAGGCTCTTGG.

3. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 2, characterized in that: The following steps are also included: S6, take step S5 snapc4 Mutant zebrafish, embryonic day 6 snapc4 Real-time in vivo fluorescence imaging of fish digestive tract motility in mutant zebrafish; S7, take step S5 snapc4 Mutant zebrafish, embryos at 7 days old snapc4 Pathological analysis of mutant zebrafish; S8. Analyze and describe the data obtained in step S6 and step S7 snapc4 Pathogenesis of mutant zebrafish.

4. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 3, characterized in that: In step S1, the sgRNA is synthesized and read as a specific sequence of the tail end of the pentose in the nucleotide, with a hydroxyl group.

5. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 3 or 4, characterized in that: The method for observing the situation under a fluorescence microscope in step S6 is as follows: snapc4 Mutant zebrafish: 6dpf zebrafish larvae were selected and placed in a 6-well plate for staining. 4 mL of zebrafish culture water was added to each well, and then DMSO dye was added to make the final concentration reach 1 mg / L. After 24 hours of staining, the zebrafish culture water was used for 3 washes, and after washing, the samples were fixed with low-melting point glue and finally photographed using a stereo microscope.

6. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 4, characterized in that: In step S7 snapc4 Pathological analysis of mutant zebrafish larvae: snapc4 The mutant zebrafish larvae were fixed with 4% paraformaldehyde for 48 h, and then dehydrated, transparentized, wax-impregnated, embedded, and sectioned at a thickness of 4 μm. The digestive tract pathology was observed under a bright-field microscope after HE staining.

7. The method for establishing a zebrafish model for simulating duodenal obstruction according to claim 5, characterized in that: Said snapc4 Mutant zebrafish larvae were 6-7 days old.

Images