Application of fennel volatile oil in medicine for treating pressure sores

Abstract

The invention discloses an application of fennel volatile oil in a medicine for treating pressure sores. The fennel volatile oil is used as a unique active component for preparing the medicine for treating the pressure sores. Through deep research on the pharmacological action of the fennel volatile oil and the treatment effect on a pressure sore animal model, it is proved that the fennel volatile oil can effectively promote healing of pressure sores, and a safer and more effective treatment choice can be provided for pressure sore patients.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to application of fennel volatile oil in preparing a medicine for promoting the healing of bedsores. Background Art

[0002] Pressure sores, also known as bedsores, are one of the common chronic wounds. Oxidative stress and inflammatory responses caused by ischemia-reperfusion injury are considered to be the main causes of the occurrence and development of pressure sores. Although acute inflammation is beneficial for clearing necrotic tissue and preventing pathogen invasion, persistent chronic inflammation is generally believed to induce severe tissue damage and delay normal tissue repair. Therefore, blocking the inflammatory response and promoting tissue repair is a promising treatment strategy for pressure sores.

[0003] At present, the treatment methods for pressure sores generally include the following: 1) Strengthening preventive measures; 2) Giving patients sterile dressings and bandaging according to the severity of the pressure sores; 3) Using ultraviolet and infrared irradiation to reduce inflammation and sterilize, promote blood circulation, and enhance cell function. At the same time, it can dry the wound surface, reduce exudation, and facilitate tissue regeneration and repair; 4) Giving drug treatment to infected pressure sores; 5) Performing surgical operations.

[0004] The above treatment methods can achieve certain clinical effects, but they also have some limitations. In many cases, the effects are unsatisfactory. Finding novel and effective treatment methods may be the key to promoting the repair of pressure ulcer wounds.

[0005] Fennel is a perennial herbaceous plant of the Apiaceae family. It is an ancient medicinal and edible plant with the effects of promoting qi and relieving pain, strengthening the stomach and dispelling cold. Fennel volatile oil is considered to be its main bioactive compound. Its main components are trans-anethole, anethole, fenchone, pinene, camphene and other substances. It has multiple pharmacological effects such as anti-inflammatory, antioxidant, antibacterial, promoting collagen production, and reducing inflammatory response after ischemia-reperfusion. However, there is no relevant report on the promotion of wound healing of pressure sores by fennel volatile oil. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide an application of fennel volatile oil in a medicine for treating bedsores, so as to solve the problems of unsatisfactory bedsore treatment effect and poor clinical efficacy in the prior art.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] The invention discloses an application of fennel volatile oil in a medicine for treating bedsores. The fennel volatile oil is used as the only active ingredient for preparing the medicine for treating bedsores.

[0009] Preferably, the main component of the fennel volatile oil is trans-anethole, with a molecular formula of C 10 H 12O, structural formula is

[0010] Preferably, the pressure sore drug is a pressure sore healing macrophage inflammation inhibitor.

[0011] Preferably, the pressure sore drug is an IL10 or TGFβ protein expression promoter.

[0012] Preferably, the pressure sore drug is an inhibitor of iNOS and IL6 protein expression.

[0013] Preferably, the pressure sore drug is an NF-kB / Hif-1α protein expression inhibitor.

[0014] Due to the adoption of the above technical scheme, the technical progress achieved by the present invention is as follows.

[0015] The occurrence of pressure sores involves many factors, including but not limited to pressure, shear force, friction, skin moisture, etc.; oxidative stress and inflammatory response caused by ischemia-reperfusion injury are considered to be the main causes of pressure sores. Acute inflammation in normal wound healing helps to clear necrotic tissue and prevent pathogen invasion, but persistent chronic inflammation is believed to induce severe tissue damage and limit or delay normal tissue repair. Therefore, how to effectively regulate local chronic inflammation in the wound is crucial to the healing of pressure sores.

[0016] Fennel essential oil can regulate macrophage inflammation and thus promote the healing of pressure ulcer wounds. On this basis, an effect verification analysis was conducted using an in vivo skin pressure ulcer model and an in vitro macrophage H / R model. Through wound healing status, HE staining, Masson staining, immunofluorescence detection, RT-qPCR detection and Westrenblot detection, it was confirmed that fennel essential oil can regulate the NF-kb / Hif-1α pathway, inhibit the inflammatory response of macrophages, promote their polarization to the anti-inflammatory type, and thus promote the healing of pressure ulcer wounds.

[0017] The present invention, through in-depth research on the pharmacological effects of fennel volatile oil and the therapeutic effects on animal models of pressure sores, confirms that fennel volatile oil can effectively promote the healing of pressure sores, and can provide a safer and more effective treatment option for patients with pressure sores. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the GCMS component analysis chart of fennel essential oil.

[0019] Figure 2 This is a diagram showing the process of fennel volatile oil promoting the healing of pressure sores in vivo;

[0020] Figure 3 HE staining of fennel essential oil promoting the repair of pressure ulcer tissue in vivo;

[0021] Figure 4 This is the masson diagram of fennel essential oil promoting collagen deposition on the surface of pressure sores in vivo;

[0022] Figure 5 This is the immunofluorescence staining image of fennel essential oil promoting the formation of new blood vessels on the surface of pressure sores in vivo;

[0023] Figure 6 This is the immunofluorescence staining image of fennel essential oil inhibiting inflammation in the microenvironment of pressure ulcers in vivo;

[0024] Figure 7 This is a graph showing the effect of fennel essential oil on cell viability;

[0025] Figure 8 This is an immunofluorescence staining image of fennel essential oil inhibiting macrophage inflammation in an in vitro model;

[0026] Fig. 9 To investigate the gene and protein expression of fennel essential oil in inhibiting macrophage inflammation in an in vitro model;

[0027] Fig.10 The inhibition of macrophage inflammation by fennel essential oil in an in vitro model may involve the gene and protein expression of related signaling pathways. DETAILED DESCRIPTION

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0029] The invention discloses an application of fennel volatile oil in a medicine for treating bedsores. The fennel volatile oil is used as the only active ingredient for preparing the medicine for treating bedsores.

[0030] In the present invention, the main component of fennel volatile oil is trans-anethole, the molecular formula of which is C 10 H 12 O, structural formula is

[0031] The pressure sore medicine of the present invention can be a pressure sore healing macrophage inflammation inhibitor, an IL10 and TGFβ protein expression promoter, an iNOS and IL6 protein expression inhibitor, and a NF-kB / Hif-1α protein expression inhibitor.

[0032] In this example, fennel essential oil was used to prepare a macrophage inflammation inhibitor for the healing of pressure sores; in the in vivo model, FEO was prepared in the form of fennel essential oil nanoemulsion (FEO-NE), whose components included 6% FEO, 4.5% Tween 20, 1.5% Span 80, and 88% high-purity water; in the in vitro model, FEO 0.4ul / ml group (0.1% DMSO, 0.04% FEO) and FEO0.12ul / ml group (0.03% DMSO, 0.012% FEO). The fennel essential oil in this example was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0033] The specific preparation method of the macrophage inflammation inhibitor for pressure ulcer healing is as follows: In the in vivo model, the preparation of FEO-NE is firstly to fully mix Tween 20, Span 80 and FEO with a stirrer at 200-300 rpm for 15 minutes; then the product is treated with an ultrasonic instrument for 5 minutes at 500W, during which time the product is cooled in an ice bath. In the in vitro model, DMSO and FEO are firstly fully mixed, and then gradiently diluted to the desired concentration (0.4ul / ml or 0.12ul / ml) using the corresponding culture medium (complete culture medium or serum-free culture medium).

[0034] The following experiment was conducted on the pressure ulcer healing macrophage inflammation inhibitor prepared in this example.

[0035] 1. Experimental Materials

[0036] 1.1 Experimental animals: SD rats, male, 6-8 weeks old, 200±20 g, purchased from the Experimental Animal Center of Chongqing Medical University.

[0037] 1.2 Experimental cells: RAW 264.7.

[0038] 1.3 Experimental reagents: fennel essential oil (Aladdin, CAS#: 8006-84-6), Tween 20 (Aladdin, CAS#: 9005-64-5), Span80 (Aladdin, CAS#: 1338-43-8), DMSO (Aladdin, CAS#: 67-68-5), DMEM culture medium (Gibco Co., Ltd., USA), DMEM fetal bovine serum (Gibco Co., Ltd., USA).

[0039] 2. Test methods

[0040] 2.1 Gas chromatography-mass spectrometry (GC-MS)

[0041] The gas chromatography-mass spectrometry conditions of fennel essential oil were as follows: Agilent HP-5ms (60m×0.25mm, 0.25μm) capillary column, carrier gas He, no splitting, 1ul fennel essential oil was injected into the instrument, the flow rate was 1ml / min, the starting temperature was 60℃ (holding time 1 group), and it was increased to 250℃ (holding time 5 minutes) at 10℃ / min; mass spectrometry conditions: ion source temperature 230℃, quadrupole temperature 150℃, EI ionization 70eV, full scan 35~550da.

[0042] MS mass spectrometry analysis: NIST20 was used for mass spectrometry analysis. The results are as follows Figure 1 shown.

[0043] 2.2 Preparation of fennel volatile oil nanoemulsion

[0044] FEO nanoemulsion (FEO-NE) was prepared according to the literature method, and the parameters were fine-tuned.

[0045] 6% FEO was dissolved in 6% surfactant Tween 20 and Span 80 (3:1) as the oil phase; the water phase was composed of high-purity water. First, the oil phase and the water phase were fully mixed at a speed of 200-300 rpm for 15 minutes using a stirrer to obtain a crude emulsion. The crude emulsion was treated with a 500W ultrasonic machine for 5 minutes, and the temperature was cooled in an ice bath during the process to obtain FEO-NE.

[0046] Blank emulsion (B-NE) was prepared by using high-purity water instead of FEO, and the other components and operations remained unchanged.

[0047] 2.3 Establishment and grouping of pressure ulcer animal model

[0048] The pressure ulcer animal model was established according to previous reports; the method is as follows.

[0049] After the rats were anesthetized, the back area was fully depilated; after the exposed skin was disinfected, the back skin layers including the epidermis, dermis, subcutaneous fat and loose connective tissue were lifted and fixed using a circular neodymium magnet (10 mm diameter × 5 mm height); a total of three cycles of pressure ulcer induction (12 hours of ischemia and 12 hours of reperfusion as one cycle) were performed.

[0050] The rats with pressure ulcer model were randomly divided into 4 groups: (i) Control group, (ii) Blank emulsion group (B-NE), (iii) Fennel essential oil nanoemulsion group (FEO-NE), and (iv) Aquacel ag group. The wound site was treated once a day.

[0051] 2.4 Photographing the process of pressure sore healing

[0052] The wounds were photographed and recorded on days 1, 4, 7, 10, and 14. The wound area was quantified using ImageJ software and the percentage of the remaining wound area was calculated using the formula: wound size = Sr / Si × 100%. Si represents the original wound size on day 1, and Sr represents the residual wound size on that day. Figure 2 Shown

[0053] 2.5 HE staining

[0054] After the rats were euthanized, the skin was removed, fixed with 4% paraformaldehyde, embedded in paraffin, and processed as usual. The skin tissue was then sliced ​​to 5 μm thickness. The skin tissue was stained with eosin and hematoxylin. Figure 3 shown.

[0055] 2.6 Masson staining

[0056] After dewaxing of the skin tissue, Masson's trichrome staining was performed according to the manufacturer's instructions to assess the fibers, extent of the extracellular matrix, and localization of the lesions; images were acquired, as Figure 4 shown.

[0057] 2.7 Tissue immunofluorescence

[0058] Tissue samples were dehydrogenated and rehydrated. After heat-induced antigen retrieval, nonspecific binding was blocked with 3% bovine serum albumin for 30 min, and then tissue samples were incubated with antibodies. Angiogenesis was studied by analyzing the expression of CD31 and α-SMA, as Figure 5 As shown; TNF-α was used to study the inflammatory state of the wound microenvironment and the expression of CD206 and CD86 was used to study the phenotype of macrophages, as shown Figure 6 shown.

[0059] 2.8 Cell proliferation activity detection

[0060] The cell suspension with a density of 5×10^4 cells / mL was evenly inoculated on a 96-well plate, 100uL per well, and placed in an incubator overnight to remove the old culture medium; then, 100ul of fresh culture medium was added to the control group, and 100ul of FEO-containing culture medium was added to the drug-treated group. The FEO concentrations were 0.12ul / ml, 0.18ul / ml, 0.27ul / ml, 0.4ul / ml, 0.6ul / ml, 0.9ul / ml, 1.33ul / ml, and 2ul / ml, respectively, and culture was continued for 24, 48, and 96h. The culture medium was discarded, 100ul of CCK-8 reagent was added to each well, and incubated at 37℃ in the dark for 1 to 2h. The absorbance at 450nm was measured with an enzyme reader. Figure 7 shown.

[0061] 2.9 Establishment of cell H / R model

[0062] RAW 264.7 cells were first cultured under normal oxygen concentrations and then subjected to H / R treatment when the cells grew to 70% of their density.

[0063] RAW 264.7 cells were divided into the following groups: (1) Control group; (2) H / R group; (3) FEO-0.4ul / ml group; (4) FEO-0.12ul / ml group. H / R group: cells were placed in serum-free medium and cultured at 37°C in a three-gas incubator containing 5% CO2, 94% N2 and 1% O2 for 6 hours, and then replaced with complete medium for reoxygenation under conventional culture conditions for 3 hours. For the FEO experimental group, different concentrations of fennel essential oil were pretreated for 1 hour before H / R, and the rest of the operations were the same as those of the H / R group (but all culture media were added with corresponding concentrations of fennel essential oil). Control group: cells were always in conventional culture conditions, during which serum-free medium was used to replace complete medium for 6 hours, and then replaced with complete medium for another 3 hours. After treatment, cells and supernatants were collected for analysis.

[0064] 2.10 Cell Immunofluorescence

[0065] Cells were fixed with 4% PFA for 30 min. After washing with PBS, cells were blocked and permeabilized with 0.1% Triton X-100 containing 5% BSA at room temperature for 1 h. They were then incubated overnight at 4°C. Fluorescence-conjugated secondary antibodies (1:1000, Inbitrogen) and DAPI (1:1000, Sigma Millipore) were incubated at room temperature for 1 h to visualize cell nuclei. Images were acquired and analyzed using ImageJ software and Photoshop. Figure 8 shown.

[0066] 2.11 Polymerase chain reaction (PCR)

[0067] use Total RNA from RAW264.7 cells was extracted using Vazyme (Nanjing, China) reagent. All-in-One SuperMix (Trans Gen, Beijing, China) was used to reverse transcribe into complementary DNA (cDNA), and qPCR was performed using a thermal cycler. Fig. 9 and Fig.10 shown.

[0068] Gene name Upstream primer Downstream primer TNF-α TCAACCTCCTCTCTGCCGT CTCCAAAGTAGACCTGCCCG iNOS GGAGATGGTCCGCAAGAGAG TCCGCAAATGTAGAGGTGGC CD86 CGTCCTGGTCGTTTTCAACC ATTGCTTCAGCAAAACCAAA IL-10 CAACATACTGCTAACCGACTCCT GCCTGGGGCATCACTTCTAC TNF-β AGGCGGTGCTCGCTTTGTA GATACGATTTCTCCAGTGGGCG Hif-1α ACGACCACTGCTAAGGCATC CTCTCTTTCCTGCTCTGTCTGG

[0069] 2.12 Western Blotting (WB)

[0070] Proteins were extracted from cells using RIPA lysis buffer containing protease inhibitors, kept on ice for 30 minutes, and then quantified by BCA protein re-quantification. Protein samples were separated by 7.5% or 10% SDS-PAGE and transferred to PVDF membranes. Each PVDF membrane was blocked with 5% skim milk for 2 hours, and after separation, it was incubated with primary antibodies and corresponding secondary antibodies at 4°C overnight. Protein bands were displayed using an ECL chemiluminescence kit. Protein bands were quantitatively analyzed using Image J software. Fig. 9 and Fig.10 shown.

[0071] 2.14 Data Analysis

[0072] The data were analyzed using GraphPadPrism 8.0 software and expressed as mean ± standard deviation. One-way analysis of variance was used to analyze the differences among multiple groups. p < 0.05 was considered statistically significant.

[0073] Result analysis:

[0074] like Figure 1 As shown, the composition of FEO was determined by GC-MS analysis, and the highest relative content was trans-anethole.

[0075] like Figure 2 As shown in the results, compared with the Control group and the B-NE group, FEO-NE prepared with fennel essential oil as the only active ingredient can significantly promote the repair of pressure sore wounds, while the commercial dressing Aquacel ag as the positive control group can also promote the repair of the wound surface to a certain extent, but the effect is still slightly inferior to fennel essential oil. Therefore, fennel essential oil can be used as an effective drug to promote the repair of pressure sores, and its effect is better than the commonly used dressings on the market.

[0076] like Figure 3 , 4 As shown in the figure, by comparing the HE and Masson staining results of the ulcer surface between different groups, compared with the incomplete epithelial structure, a large amount of inflammatory infiltration and less collagen deposition in the Control group and B-NE group, the FEO-NE group had a more complete epithelial structure, almost no inflammatory infiltration, rich collagen fibers filled between tissues, and skin appendage regeneration began to appear, indicating that fennel volatile oil can promote the disappearance of inflammation, collagen deposition, and extracellular matrix proliferation and remodeling.

[0077] like Figure 5 As shown in the results, tissue immunofluorescence staining was used to detect alpha smooth muscle actin (α-SMA) and platelet endothelial cell adhesion molecule (CD31). The FEO-NE group significantly increased the expression of CD31 and α-SMA in wound tissue, indicating that fennel volatile oil can promote the formation of new blood vessels during the healing process of pressure sores.

[0078] like Figure 6 As shown in the data, the FEO-NE group had significantly less expression of the inflammatory mediator TNF-α, and showed more anti-inflammatory macrophage phenotypes (CD206), which significantly increased the ratio of anti-inflammatory / inflammatory macrophages. This shows that fennel volatile oil can regulate the inflammatory microenvironment of the pressure sore surface, help macrophages change from a pro-inflammatory phenotype to an anti-inflammatory phenotype, thereby promoting the transition of pressure sore wounds from the inflammatory phase to the proliferative phase, and then promoting the healing of the sore surface.

[0079] like Figure 7 As shown, in the in vitro cell experiment, it was observed that within the set concentration range, when the FEO concentration was less than or equal to 0.4ul / ml, FEO not only did not show cytotoxic effect on raw264.7 cells, but instead had a significant effect of promoting cell proliferation.

[0080] like Figure 8 , 9 As shown in the results, cell immunofluorescence, q-PCR and WB experiments all showed that H / R treatment induced inflammatory expression of macrophages. Compared with Control, the mRNA levels of CD86, iNOS and TNF-α in the H / R group were significantly increased, and the protein expression of iNOS and IL-6 was also significantly increased. Cell immunofluorescence also showed similar results, while FEO could reduce this trend and promote the expression of TGF-β and IL-10. This indicates that fennel volatile oil can inhibit the inflammation of macrophages after hypoxia and reoxygenation, promote the polarization of anti-inflammatory macrophages, and promote the secretion of anti-inflammatory mediators.

[0081] like Fig.10 The results showed that fennel volatile oil can inhibit the protein expression of NF-kB / Hif-1α signaling pathway after H / R, indicating that the mechanism by which fennel volatile oil regulates macrophage inflammation and promotes anti-inflammatory macrophage polarization may involve NF-kB / Hif-1α signaling pathway crosstalk.

[0082] The present invention, through in-depth research on the pharmacological effects of fennel volatile oil and the therapeutic effects on animal models of pressure sores, confirms that fennel volatile oil can effectively promote the healing of pressure sores, and can provide a safer and more effective treatment option for patients with pressure sores.

Claims

1. An application of fennel volatile oil in a drug for treating bedsores, characterized in that: Fennel essential oil is used as the sole active ingredient in the preparation of pressure ulcer medication.

2. The use of fennel volatile oil in a drug for treating bedsores according to claim 1, characterized in that: The main component of the fennel volatile oil is trans-anethole, with a molecular formula of C 10 H 12 O, structural formula is 3. The use of fennel essential oil in a drug for treating bedsores according to claim 2, characterized in that: The pressure sore medicine is a pressure sore healing macrophage inflammation inhibitor.

4. The use of fennel volatile oil in a drug for treating bedsores according to claim 2, characterized in that: The pressure sore drug is an IL10 and TGFβ protein expression promoter.

5. The use of fennel volatile oil in a drug for treating bedsores according to claim 2, characterized in that: The pressure sore drug is an iNOS and IL6 protein expression inhibitor.

6. The use of fennel essential oil in a drug for treating bedsores according to claim 2, characterized in that: The pressure sore drug is an NF-kB / Hif-1α protein expression inhibitor.

Images