Tumor targeted therapy polypeptide based on Smaac / GPX4 interaction and application thereof

Abstract

The invention discloses a tumor targeted therapy polypeptide based on Smac / GPX4 interaction and application of the tumor targeted therapy polypeptide, and belongs to the field of biotechnology and medicine. Specifically, the invention provides a polypeptide composition which comprises a P1 peptide fragment and / or a P2 peptide fragment, the amino acid sequence of the P1 peptide fragment is as shown in SEQ ID NO. 1; the amino acid sequence of the P2 peptide fragment is as shown in SEQ ID NO. 2; the polypeptide further comprises a cell penetrating peptide, and the cell penetrating peptide is connected with the N end of the P1 / P2 peptide fragment; and the amino acid sequence of the cell penetrating peptide is as shown in SEQ ID NO.3. The invention develops an optimized Smac-derived oligopeptide, provides a brand new strategy for targeting GPX4, solves the problem that GPX4 is difficult to target due to lack of a small molecule binding pocket, and provides a new target spot for tumor treatment.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and medicine, and in particular relates to a tumor-targeted therapeutic polypeptide based on Smac / GPX4 interaction and an application thereof. Background Art

[0002] Mitochondria play a key role in apoptosis and ferroptosis. During apoptosis, mitochondria release cytochrome c to activate the caspase cascade; in ferroptosis, mitochondrial dysfunction leads to iron accumulation and lipid peroxidation. Although studies have shown that OPA1 affects ferroptosis by maintaining mitochondrial stability and function, the specific molecular mechanisms that trigger ferroptosis under mitochondrial stress have not been fully clarified. Ferroptosis is a non-apoptotic, iron-dependent form of cell death, and its main biochemical hallmark is lipid peroxidation caused by GPX4 inactivation. There are three different physiological isoforms of GPX4: cytoplasmic GPX4 (cGPX4), mitochondrial GPX4 (mGPX4), and nuclear GPX4 (nGPX4). Among them, cGPX4 is widely present in cells and resists ferroptosis by scavenging lipid peroxides, which is essential for embryonic survival and development. Given the key role of cGPX4 in cell survival and function, its mechanism of action and effects have become the focus of research. GPX4 is upregulated in a variety of tumors, making it a potential target for cancer treatment. However, the GPX4 molecule has a rounded surface and lacks a small molecule binding pocket, unlike traditional targets such as enzymes or GPCRs, which have deep cavities that can be used for small molecule binding. Classic inhibitors such as RSL3 and ML210 exert their effects by covalently binding to the active site of GPX4, which may result in low selectivity and systemic toxicity in vivo. Understanding the mechanism of GPX4 activity regulation and identifying methods for GPX4 regulation will help develop ferroptosis-based cancer therapies. Smac / DIABLO is a protein located in mitochondria that plays a key role in promoting apoptosis. After cells receive apoptotic signals, Smac is released from mitochondria into the cytoplasm and binds to IAPs through its AVPI fragment, alleviating the inhibitory effect of IAPs on caspases and activating apoptosis. As an antagonist of IAPs, Smac has a strong pro-apoptotic effect, and its AVPI fragment has been developed for cancer therapeutics. However, recent studies have shown that Smac isoforms lacking the AVPI fragment still have the ability to promote cell death, suggesting the existence of an IAPs-independent cell death pathway, but its specific molecular mechanism is still unclear.

[0003] Existing technical problems:

[0004] 1. Traditional chemotherapy drugs (such as 5-FU) rely on the p53 pathway to induce apoptosis, but their efficacy is significantly reduced in p53 mutant tumors (cell mortality rate is only 30-40%).

[0005] 2. GPX4 is a key regulatory protein of ferroptosis, and its inhibitors (such as RSL3) have low selectivity (IC50>1μM) and systemic toxicity due to covalent binding to the active site. Summary of the invention

[0006] The present invention reveals that Smac / DIABLO (second mitochondrial-derived caspase activator) not only promotes cell apoptosis through its AVPI fragment under chemotherapy-induced mitochondrial stress, but also specifically binds to glutathione peroxidase 4 (GPX4) through its short peptide fragment (126-134 and 212-220 amino acid sequences), inhibits the antioxidant activity of GPX4, and thus promotes ferroptosis.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a polypeptide composition, comprising a P1 peptide segment and / or a P2 peptide segment; the amino acid sequence of the P1 peptide segment is shown as SEQ ID NO.1; the amino acid sequence of the P2 peptide segment is shown as SEQ ID NO.2.

[0009] Furthermore, the polypeptide composition also includes a cell-penetrating peptide, which is connected to the N-terminus of the P1 / P2 peptide segment; the amino acid sequence of the cell-penetrating peptide is shown in SEQ ID NO.3.

[0010] In a second aspect, the present invention also provides use of the polypeptide composition in the preparation of a GPX4 inhibitor.

[0011] In a third aspect, the present invention further provides a GPX4 inhibitor, wherein the active ingredient of the GPX4 inhibitor comprises the above-mentioned polypeptide composition.

[0012] Furthermore, the inhibitor also includes one or more pharmaceutically acceptable carriers or excipients.

[0013] In a fourth aspect, the present invention also provides the use of the polypeptide composition or the polypeptide inhibitor in the preparation of a product for treating cancer.

[0014] Furthermore, the product is a drug for treating cancer.

[0015] Furthermore, the cancer includes lung cancer, cervical cancer, triple-negative breast cancer or pancreatic cancer.

[0016] Furthermore, the drug also includes one or more pharmaceutically acceptable carriers or excipients.

[0017] Furthermore, the dosage form of the drug is selected from injection, solution, emulsion, suspension, suppository, ointment, cream, spray, drop, powder, granule, granule, capsule, pill, tablet, patch or sustained-release preparation.

[0018] The present invention reveals the dual mechanism of action of Smac in chemotherapy-induced ferroptosis and apoptosis, and inhibits its antioxidant activity by specifically binding to GPX4, thereby promoting ferroptosis. Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. It provides a new strategy for targeting GPX4, which solves the problem that GPX4 is difficult to target due to the lack of small molecule binding pockets, and provides a new target for tumor treatment.

[0020] 2. An optimized Smac-derived short peptide was developed that can significantly enhance ferroptosis, providing a new idea for overcoming chemotherapy resistance and is expected to improve the efficacy of chemotherapy drugs.

[0021] 3. This strategy is also effective in p53-deficient tumor cells, broadening its application prospects in tumor treatment and providing a new treatment option for patients with p53 mutant tumors.

[0022] 4. Through the dual targeting strategy, ferroptosis and apoptosis are enhanced simultaneously, achieving a more powerful tumor cell killing effect, which is expected to become an effective new method for tumor treatment.

[0023] Currently, there is no other solution that can simultaneously activate apoptosis and ferroptosis through the dual effects of Smac / DIABLO. Existing GPX4 inhibitors rely on covalent binding or transcriptional / post-translational regulation, while the peptides of the present invention have higher selectivity and lower toxicity by specifically binding to the GPX4 active center.

[0024] Based on the known role of Smac / DIABLO in apoptosis, our team found that it binds to GPX4 through an AVPI-independent pathway in chemotherapy-induced ferroptosis. By designing and optimizing peptides (P1 / P2), we successfully broke through the GPX4 targeting problem and provided a new treatment strategy for p53 mutant tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The prediction and verification results of the interaction between Smac and GPX4 in Example 1 (wherein, Figure 1 A is the overall structure of the Smac-GPX4 complex predicted by AlphaFold3; Figure 1 BC, E are the alignment error matrices predicted under three conditions; Figures D and F are the results of WB and co-IP detection);

[0026] Figure 2The results of the interaction between Smac and GPX4 and the effect on GPX4 activity in Example 2 (wherein, Figure 2 A is a schematic diagram of the constructed plasmid; Figure 2 B is a graph showing the results of WB and co-IP detection; Figure 2 C is a graph showing the results of GPX4 activity detection, and the data are shown as mean ± SD (n = 3);

[0027] Figure 3 The effect of the Smac-derived short peptide on ferroptosis markers in Example 3 (wherein, Figure 3 A is the MDA test result graph, and the data are shown as mean ± SD (n = 3); Figure 3 B is the result of cell staining, and the data are shown as mean ± SD (n = 3); Figure 3 C is the result of RT-qPCR test, and the data are shown as mean ± SD (n = 3);

[0028] Figure 4 The effect of the Smac-derived short peptide on cell proliferation and cloning in Example 4 (wherein, Figure 4 A is a cell microscope image, scale bar 200 μm; Figure 4 B is a graph showing cell survival results, and the data are shown as mean ± SD (n = 3); Figure 4 C is a graph showing the results of cell proliferation, and the data are shown as mean ± SD (n = 3); Figure 4 D and E are cell cloning results, and the data are shown as mean ± SD (n = 3);

[0029] Figure 5 This is a diagram showing the effect of combined medication in Example 5 (wherein, Figure 5 A is a graph showing cell proliferation results, and the data are shown as mean ± SD (n = 3); Figure 5 B, C are cell cloning results, and the data are shown as mean ± SD (n = 3); DETAILED DESCRIPTION

[0030] In order to better illustrate the present invention, the following embodiments are listed. Obviously, the described embodiments are only a part of the present invention, not all embodiments. Based on the embodiments in the present invention, other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0031] The amino acid sequence of Smac / DIABLO protein (UniProt number: Q9NR28) contains two key binding regions: 126-134aa (SEEEDEVWQ) and 212-220aa (QIEELRQKT).

[0032] Chemotherapeutic drug-induced mitochondrial stress:

[0033] Raw materials: 5-fluorouracil (5-FU, concentration range 10-100 μM) or carbonyl cyanide m-chlorophenylhydrazone (CCCP, concentration range 5-50 μM).

[0034] Process: Tumor cells (such as H1299, HeLa) are exposed to 5-FU or CCCP to induce a decrease in mitochondrial membrane potential (ΔΨm decrease ≥ 60%); Smac / DIABLO is released from mitochondria to the cytoplasm, binds to IAPs (such as cIAP1) through the AVPI fragment, and activates the caspase-9 / 3 cascade reaction; at the same time, Smac short peptide fragments (126-134aa and 212-220aa) bind to GPX4, inhibiting its antioxidant activity (GPX4 activity decreases ≥ 70%) and inducing lipid peroxidation (MDA levels increase 3 times).

[0035] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0036] Example 1 Bioinformatics prediction and verification of the interaction between Smac and GPX4

[0037] 1.1 Smac / GPX4 interaction detection

[0038] AlphaFold3 prediction, immunoprecipitation (IP) and mass spectrometry (IP-MS) techniques were used to identify the interaction between Smac and GPX4. By constructing Smac wild-type and mutant plasmids and conducting transfection experiments, the changes in the interaction between different Smac and endogenous GPX4 were verified, and the interaction-dependent regions between the two were further verified. The specific experimental methods are as follows:

[0039] 1) Cell culture and treatment: HeLa, A549 and H1299 cells were obtained from the American Type Culture Collection (ATCC). DNA footprinting and PCR were used to routinely verify the authenticity of the cell lines and the absence of mycoplasma contamination. All these cell lines were cultured in DMEM medium with 15% FBS at 37°C in 5% CO. 2 For transient transfection, use Lipo8000TM (Beyotime) or Cells were transfected with 5-FU (200 μM) and CCCP (40 μM) according to the manufacturer's instructions.

[0040] 2) Plasmid construction: Plasmids for transient overexpression were constructed using pCS2-FLAG / HA vector or pCMV-Myc vector (Clontech). Point mutants and deletion mutants were constructed using PhantaMax Super-Fidelity DNA polymerase (VazymeBiotech) according to the manufacturer's instructions.

[0041] The specific process is as follows:

[0042] a. PCR amplification of genes

[0043] The PCR reaction system consists of primers, templates, high temperature resistant DNA polymerase and dNTP raw materials. The PCR template is cDNA reverse transcribed from RNA extracted from human HEK293T cells. The specific PCR reaction system is as shown in Table 1 (taking 30 μL system as an example):

[0044] Primer sequence: Smac-F: CTTTTTGCAGGATCCATGGCGGCTCTGAAG (SEQ ID NO. 7)

[0045] Smac-R: AGGCGCGCCGATATCTCCAATCCTCACGCAG (SEQ ID NO.8)

[0046] Table 1 PCR reaction system

[0047]

[0048] The PCR reaction program is as follows Table 2:

[0049] Table 2 PCR reaction program

[0050]

[0051] b. Plasmid vector digestion

[0052] As described above, the pCMV plasmid vector was digested with two restriction endonucleases, EcoRI and NotI. The digestion system is shown in Table 3 below (taking a 30 μL system as an example):

[0053] Table 3 Enzyme digestion system

[0054]

[0055] After the enzyme digestion system is added, it is placed at 37°C for 3 hours.

[0056] c. Purification of PCR products and enzyme digestion products

[0057] The above PCR and enzyme digestion products were subjected to agarose gel electrophoresis. After 30 minutes of electrophoresis, a nucleic acid UV gel cutter was used to observe the band size of the PCR product and the enzyme digestion product, and then the gel was cut for recovery. The gel purification recovery was performed using a kit according to the instructions, and the steps were as follows:

[0058] First weigh the gel (weigh the empty tube first, cut off the gel and put it into the empty tube, weigh it again, and the difference between the two is the weight of the gel); add an appropriate volume of sol solution to the gel in the centrifuge tube (add 100 μL to 0.1g gel); place it in a 65°C metal bath for full dissolution for 15 minutes, and inverting and mixing several times during the period will help to fully dissolve; after the gel is completely dissolved, centrifuge it in a low-speed centrifuge to fully collect the sol solution on the tube wall, transfer it to the adsorption column and centrifuge it at 12000rpm for 2min; discard the liquid collected in the adsorption column, add 600μL of rinse solution again for rinse, centrifuge at 12000rpm for 2min, and repeat once; remove the liquid in the collection tube, 12000rpm, and leave it empty for 2min; discard the liquid collected in the adsorption column, open the cover of the adsorption column, and air-dry it aseptically for 15min, during which the eluent is preheated at 65°C; add 35μL Add the elution solution preheated at 65℃ to the adsorption column, fully dissolve for 1 minute, centrifuge at 12000rpm for 2 minutes, and collect the eluted liquid into a new centrifuge tube, which is the purified DNA product.

[0059] d. Ligation reaction between PCR product and restriction endonuclease-cut plasmid vector

[0060] The ligation reaction is divided into one-step cloning homologous recombination ligation method and T4 ligase ligation method. Taking the one-step cloning homologous recombination ligation method as an example, the ligation reaction system is shown in Table 4 below:

[0061] Table 4 Ligation reaction system

[0062]

[0063] After adding the system, place it in a 37°C water bath for 30 minutes to fully connect. The ligation product is used for the next step of transformation.

[0064] Transformation into competent E. coli DH5α cells and plating:

[0065] Take 20 μL of competent cells and place them in an ice bath to slowly melt, then add them to the recombinant product, mix well, and incubate in an ice bath for 20 minutes; heat shock in a 42°C water bath for 90 seconds, and then place them in an ice bath for 2 minutes; add 800 μL of LB medium preheated at 37°C, and incubate in a 37°C constant temperature shaker for 1 hour; centrifuge at 3000 rpm for 5 minutes, and remove 700 μL of supernatant; resuspend the remaining bacteria with a pipette, and evenly apply the bacterial solution on an ampicillin plate or kanamycin plate with a sterile coating stick in an ultra-clean workbench; invert and place in a 37°C constant temperature incubator for overnight incubation.

[0066] e. Colony inoculation, plasmid mini-preparation and sequencing

[0067] Use a sterile toothpick or pipette tip to pick up the colonies grown overnight on the plate the night before, inoculate them into the sterilized LB medium in a 50mL centrifuge tube (the volume of the medium is 25mL), and amplify them overnight in a 37℃ constant temperature horizontal shaker. The next day, use a floor centrifuge at 4000rpm for 15min, remove the supernatant and collect the bacteria for plasmid extraction.

[0068] The plasmid was extracted using the plasmid mini-extraction kit from Shanghai Tiangen Biochemical Technology Co., Ltd. According to the kit instructions, the specific experimental steps are as follows:

[0069] Before using Buffer P1, add the RNA enzyme that comes with the kit to prevent RNA contamination during plasmid extraction; add 500μL of Buffer P1 mixed with RNA enzyme to the bacteria, blow and resuspend with a 2mL pipette tip, and transfer to a 2mL centrifuge tube; add 500μL Buffer P2, cover the centrifuge tube cap, gently invert to mix; add 500μL Buffer P4, cover the centrifuge tube cap, gently invert to mix, and let stand for 2min; centrifuge at 4℃, 12000rpm, 10min; aspirate the supernatant and transfer it to the filter, and never aspirate the white precipitate at the bottom of the centrifuge tube, centrifuge at 4℃, 12000rpm, 2min; aspirate 1 / 3 volume of isopropanol and add it to the filtered supernatant, gently mix, and let stand for 2min to allow plasmid DNA to precipitate efficiently; aspirate 500μL of Buffer BL to the adsorption column, centrifuge at 4℃, 12000rpm for 2min to balance the adsorption column; add the liquid after isopropanol precipitation to the adsorption column for DNA adsorption, centrifuge at 4℃, 12000rpm for 2min, remove the liquid in the collection tube after centrifugation; add 600μL Wash Buffer (add 60mL of anhydrous ethanol before use), centrifuge at 4℃, 12000rpm for 2min, repeat once; remove the liquid in the collection tube, vacate at 4℃, 12000rpm for 2min;

[0070] Open the cover of the adsorption column and air dry it for 15 minutes. At the same time, preheat ddH 2 O; add 200 μL of preheated ddH 2 O, cover the lid and let it stand for 2 minutes to fully dissolve the DNA; replace the collection tube under the adsorption column with a new 1.5mL centrifuge tube, centrifuge for 2 minutes at 4℃, 12000rpm, and the liquid in the 1.5mL centrifuge tube is the extracted plasmid; use NanoDrop2000 to measure the concentration of the extracted plasmid and the OD260 / 280 ratio for subsequent sequencing, enzyme digestion, transfection and other experiments; take 10μL of the extracted plasmid and send it to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing. The sequencing forward primer of the pCMV vector is CMV-F, and the reverse primer is EBV-R; compare the sequencing results to obtain the plasmid with successful gene cloning.

[0071] A single guide RNA (sgRNA) targeting human Smac was designed and subcloned into the pSpCas9(BB)-2A-Puro(pX459) vector for gene knockout (KO). The sgRNA sequence was obtained from the CRISPOR design tool website: https: / / crispor.gi.ucsc.edu / . The sgRNA sequences are shown in Table 5 below:

[0072] Table 5 sgRNA sequences

[0073]

[0074]

[0075] According to the designed sgRNA sequence, two complementary oligonucleotides (usually 40-50 bp) are synthesized. These oligonucleotides should contain the BbsI restriction enzyme site on the pX459 vector.

[0076] f. Annealing reaction

[0077] Annealing buffer: Dissolve the two oligonucleotides in annealing buffer (usually 10 mM Tris-HCl, pH 7.5, 50 mM NaCl).

[0078] Annealing procedure:

[0079] Heat the oligonucleotide mixture to 95°C for 5 minutes and slowly cool it to room temperature (about 1 hour) to allow the two oligonucleotides to form double-stranded DNA.

[0080] g. Cloning reaction

[0081] Cut the pX459 vector with BbsI restriction endonuclease to generate linearized vector. Purify the linearized vector using DNA purification columns or magnetic beads to remove the restriction enzyme and uncut vector.

[0082] h. Ligation reaction:

[0083] Mix the annealed sgRNA double-stranded DNA with the linearized vector. Add T4 DNA ligase and perform the ligation reaction according to the manufacturer's instructions (usually incubate at 16°C for 1 hour).

[0084] i. Transformation and screening

[0085] Transform the ligation reaction product into E. coli (such as DH5α or TOP10). Grow the transformed bacteria on agar plates containing antibiotics and screen for colonies containing the correct clones.

[0086] Pick a single colony and perform colony PCR to verify the correct insertion of sgRNA.

[0087] j. Verify the clone

[0088] Extract plasmid DNA from the screened positive colonies and sequence the extracted plasmid to confirm the correct insertion of the sgRNA sequence and the absence of mutations.

[0089] 3) Immunoprecipitation: HeLa cells were cultured in 10 cm culture dishes to a density of more than 70%, and transfected with pCS2-FLAG-Smac plasmid. The control group used empty vector pCS2-FLAG. Cells were collected 36 h after transfection, and cells were lysed using IP lysis buffer (Beyotime) at 4°C for 15 min. The cells were centrifuged at 12,000 rpm for 15 min, and the supernatant was taken. 20 μL anti-FLAG magnetic beads were added to each dish of cell lysate, and the cells were incubated at 4°C overnight. The magnetic beads were collected and washed three times with IP lysis buffer. All liquid was removed, 50 μL 1×SDS loading buffer was added, and the samples were boiled at 95°C for 10 min. The interaction between Smac and endogenous GPX4 was detected by Western blot.

[0090] 4) Visualization of Smac-GPX4 interaction structure: The predicted structure was visualized using PyMOL. Potential hydrogen bonds at the protein-protein interface were identified using the default hydrogen bond detection parameters of PyMOL.

[0091] 5) Smac-GPX4 interaction prediction and analysis: AlphaFold3 was used to simulate the interaction between Smac and GPX4. The full-length GPX4 sequence was used together with the full-length Smac sequence, the Smac sequence with a deleted region, or the optimized Smac sequence. Multiple prediction models were generated and evaluated using the comprehensive ranking system of AlphaFold3. This system combines multiple parameters, including the predicted TM score (pTM) and the predicted interface TM score (ipTM) for structural confidence assessment, as well as additional criteria for evaluating potential atomic conflicts and disordered region predictions. The top-ranked models based on these combined metrics were selected for the final analysis. Random seeds were used for three modeling scenarios: Smac_α-GPX4: seed = 35947662; Smac_α-Del_2x-GPX4: seed = 1248253967; Smac_α-Pro_2x-GPX4: seed = 630175486.

[0092] Physical property parameters: The binding site was verified by molecular docking (AlphaFold3), and the binding free energy was -8.5 kcal / mol.

[0093] According to the experimental results, it can be seen that Figure 1 AD shows that 126-134aa (SEEEDEVWQ) and 212-220aa (QIEELRQKT) of Smac protein are the amino acid sequences that Smac and GPX4 rely on for interaction. The mutation of three amino acids D130-V132 of Smac protein to A (Smac-3A) greatly eliminates the interaction with GPX4.

[0094] 1.2 Design and optimization of Smac-derived short peptides

[0095] The above two short peptide fragments are linear polypeptides. Based on the above two amino acid sequences that Smac and GPX4 interact with, and using the recently developed protein sequence design model ProBID Net, the protein interaction interface can be accurately designed, and the amino acid sequence that Smac and GPX4 interact with is optimized to improve the binding affinity of Smac and GPX4. The optimized sequences are: DEEEDEVAN (126-134aa, P1 peptide, SEQ ID NO.1) and LIELKRQNQ (212-220aa, P2 peptide, SEQ ID NO.2).

[0096] according to Figure 1 EF showed that the interaction between Smac and GPX4 was significantly enhanced after sequence optimization.

[0097] According to the above experimental results, the optimized amino acid sequence was synthesized into a Smac-derived short peptide in vitro, and the HIV-derived TAT sequence YGRKKRRQRRR (SEQ ID NO. 3) was directly added to the N-terminus by in vitro amino acid chemical synthesis to enhance the membrane permeability of the cells. The two short peptides were named P1X and P2X. P1X-3A was used as a control peptide because it could not interact with GPX4. The specific short peptide sequences are shown in Table 6 below.

[0098] Table 6 Short peptide sequence list

[0099]

[0100]

[0101] for Figure 1 Overall interpretation: (A) The overall structure of the Smac-GPX4 complex predicted by AlphaFold3. Smac interacts with GPX4 (green) through specific interface contacts. The enlarged view (right) shows the detailed interface region with labeled interacting residues. The yellow dashed lines indicate potential hydrogen bonds. Notably, SMAC residues 127-134 and 212-220 (called the 2x region) play crucial roles in the interaction. (BC,E) Alignment error (PAE) matrices predicted under three conditions: (B) interaction predictions of full-length GPX4 and full-length Smac, (C) Smac, Smac with the 2x region, 2x deleted and full-length GPX4, and (E) Smac, Smac with the 2x region deleted by at Ingid-net and full-length GPX4. PAE represents the expected position error at residue x when the predicted structure is aligned with the true structure at residue y. Dark purple areas indicate lower PAE values, indicating high confidence in the predicted interaction between residues X and Y, while yellow areas indicate high PAE values ​​and lower confidence. The interface reliability between the two proteins is shown by the dashed lines in the lower left quadrant and the upper right quadrant. Darker colors indicate higher interaction confidence. The IPTM score reflects the possibility of protein-protein interaction, while the PTM score indicates the overall confidence in the structure prediction, which may be affected by disordered regions. The matrix shows that the deletion of the 2x region significantly reduces the Smac-GPX4 interaction ability, while optimization can enhance it. (D,F) Western blot analysis of whole cell lysates (WCLs) of H1299 cells transfected with the indicated plasmids and co-immunoprecipitation (co-IP) samples with anti-FLAG antibody.

[0102] Example 2 Interaction of Smac-derived short peptides with GPX4 and their effects on GPX4 activity

[0103] Material:

[0104] HeLa cells, DMEM culture medium, fetal bovine serum FBS, transfection reagent Lipo8000, molecular cloning reagents (PCR high-fidelity enzyme, homologous recombination kit), GPX4 enzyme activity detection kit, anti-GFP antibody magnetic beads.

[0105] Experimental methods:

[0106] Using gene synthesis technology (chemical synthesis method) and molecular cloning experimental technology, the base sequences of P1X, P2X and P1X+P2X and the GFP base sequence were synthesized in the order of base sequence (gene synthesis was performed by Beijing Qingke Biological Co., Ltd.), and the synthesized complete sequence was constructed on the pCS2-FLAG plasmid vector, with restriction sites EcoRV and XbaI. The general experimental steps of molecular cloning have been mentioned above. The constructed plasmids were named GFP-P1X, GFP-P2X and GFP-P1X+P2X, and GFP was used as a negative control.

[0107] GFP, GFP-P1X, GFP-P2X and GFP-P1X+P2X were transfected into HeLa cells for expression, and the cells were collected and lysed 36 h after transfection. Immunoprecipitation was performed using anti-GFP antibody magnetic beads, and Western-blot was used to detect the interaction of GFP, GFP-P1X, GFP-P2X and GFP-P1X+P2X with endogenous GPX4.

[0108] The short peptides P1X and P2X fused with the TAT sequence were incubated with HeLa cells alone or in co-incubation for 24h (the concentration of both short peptides was 2μM when used alone, and the concentration of P1X+P2X was 2μM when co-incubated), P1X-3A was used as a control peptide (used at a concentration of 2μM), and RSL3 was used as a positive control at a concentration of 2μM. The activity of GPX4 was detected using the human glutathione peroxidase 4 ELISA assay kit (COIBO BIO). First, the cells were collected and washed with cold PBS. The cells were lysed with 200μL of assay buffer, centrifuged at 10,000g for 15 minutes at 4°C, and the supernatant was transferred to a new tube. Glutathione peroxidase assay buffer, samples, and GPX4 assay working buffer were loaded into a 96-well plate according to the volume in the instruction table. The mixture was then incubated at room temperature for 15 minutes. Subsequently, 10 μL of peroxide solution (30 mM) was added to the sample wells and the plates were incubated at 25°C for 5 min. The resulting color was measured at OD 340 nm using a microplate absorbance reader. Each assay was performed in triplicate.

[0109] The experimental results are as follows Figure 2As shown, the results showed that GFP fused with Smac-derived short peptide could significantly interact with GPX4, and Smac-derived short peptide inhibited GPX4 activity.

[0110] Example 3 Effect of Smac-derived short peptides on ferroptosis markers

[0111] Material:

[0112] HeLa cells, DMEM culture medium, fetal bovine serum FBS, MDA detection kit, lipid reactive oxygen species detection kit, RNA extraction and qPCR related reagents.

[0113] Experimental methods:

[0114] 1) MDA level detection

[0115] The short peptides P1X and P2X fused with the TAT sequence were incubated with HeLa cells alone or together for 24 hours (the concentration of the two short peptides was 2 μM when used alone, and the concentration of P1X+P2X was 2 μM when incubated together), P1X-3A was used as a control peptide (used at a concentration of 2 μM), and RSL3 was used as a positive control at a concentration of 2 μM. The level of cellular MDA was detected using an MDA kit (Dojindo).

[0116] The reaction mixture was detected using a fluorescence microplate reader (Safire2, Tecan, Switzerland), and the MDA level was expressed as nmol / mg protein. The specific steps were as follows: 7 Add 100μl Lysis Buffer to each microtube, mix thoroughly on a vortex oscillator, and let stand at room temperature for 5 minutes. Add 250μl Working solution to each microtube and mix thoroughly on a vortex oscillator. Incubate at 95℃ for 15 minutes. Cool on an ice bath for 5 minutes. Centrifuge at 10,000×g for 10 minutes. Take 100μl of supernatant and add it to a 96-well plate (black board). Use a fluorescent microplate reader to detect the fluorescence intensity (Ex: 540nm, Em: 590nm). Calculate the MDA concentration in the sample using the MDA standard curve.

[0117] 2) Detection of lipid reactive oxygen species levels

[0118] The short peptides P1X and P2X fused with the TAT sequence were incubated with HeLa cells alone or co-incubated for 24 hours (the concentrations of the two short peptides were 2 μM when used alone, and the concentration of P1X+P2X was 2 μM when co-incubated). P1X-3A was used as a control peptide (with a concentration of 2 μM), and RSL3 was used as a positive control with a concentration of 2 μM. Liperfluo staining was used to detect the level of cellular MDA.

[0119] Cells were incubated in 96-well plates. Cells were stained with Liperfluo (10 μM) at 37°C for 30 minutes, then washed with PBS for 5 minutes and trypsinized. Cells were then analyzed using a microplate absorbance reader.

[0120] 3) qPCR detection of PTGS2 gene expression level

[0121] The short peptides P1X and P2X fused with the TAT sequence were incubated with HeLa cells alone or co-incubated for 24 hours (the concentrations of the two short peptides were 2 μM when used alone, and the concentration of P1X+P2X was 2 μM when co-incubated). P1X-3A was used as a control peptide (with a concentration of 2 μM), and RSL3 was used as a positive control with a concentration of 2 μM. The expression level of the cell PTGS2 gene was detected by qPCR.

[0122] Total RNA was extracted from cells using TRIzol reagent (Tiangen), and cDNA was synthesized using the Superscript kit (Vazyme) according to the manufacturer's instructions. Amplification was performed using the SYBR Green PCR mix kit (Vazyme). Quantification was normalized to the endogenous control GAPDH. The general experimental steps for RNA extraction and qPCR were:

[0123] a. RNA extraction

[0124] First, sterilize the gun tips and centrifuge tubes needed for the experiment with high-temperature steam. The laboratory table needs to be wiped with 75% alcohol in advance, and then the alcohol lamp is lit. Wear a mask during the experiment to avoid RNA degradation caused by contamination during the experiment. Taking a dish of cells in a 60mm culture dish as an example, the main steps of cell RNA extraction are described:

[0125] Collect cells, drain the culture medium, wash twice with PBS buffer and drain; add 1mL Trizol reagent and stir quickly with a 2mL pipette tip until all cells are separated, then quickly transfer to a new 1.5mL centrifuge tube and let stand at room temperature for 10 minutes; add 200μL chloroform, shake vigorously for 30 seconds, then let stand at room temperature for 5 minutes; centrifuge at 4℃, 12000rpm for 15 minutes; after centrifugation, the sample can be observed to be stratified, transfer the top colorless liquid phase to a new 1.5mL centrifuge tube, discard the pink liquid phase at the bottom and the white liquid phase in the middle, then add an equal volume of isopropanol, shake upside down, and let stand at room temperature for 10 minutes. The purpose is to use isopropanol to precipitate RNA; centrifuge at 4℃, 12000rpm for 10 minutes, discard the supernatant after centrifugation, and retain the white precipitate at the bottom; use 1mL Wash the bottom precipitate with 75% ethanol prepared with DEPC water, and mix it by blowing; centrifuge again at 4°C, 12000rpm, for 5 min, and discard the supernatant; open the cap of the centrifuge tube, drain the residual ethanol, and preheat the DEPC water in a 60°C metal bath; add 50μL of preheated DEPC water, and blow it several times with a pipette until the bottom precipitate in the centrifuge tube is completely dissolved; store the extracted RNA sample at -80°C.

[0126] b. Reverse transcription (RT-PCR)

[0127] The reverse transcription system is shown in Table 7 below:

[0128] Table 7 Reverse transcription system

[0129]

[0130] After mixing, the following procedure was performed: 50°C for 30 min, 85°C for 5 min. The product was measured for concentration using NanoDrop2000 and then stored in a -80°C refrigerator.

[0131] c. Real-time quantitative PCR (qPCR)

[0132] Dilute the cDNA product reverse transcribed in the above step 10 times; design the primers for qPCR and send them to the company for synthesis

[0133] (Primer list can be found in Table 8 below), reaction system and procedure are shown in Table 9 and Table 10 below:

[0134] Table 8 Primer sequence list

[0135]

[0136] Table 9 PCR reaction system

[0137]

[0138] Prepare the mixed solution according to the system in the table above, add it to a 96-well plate, replicate 3 times in each group, and then seal it with film paper; perform PCR reaction according to the following procedure:

[0139] Table 10 PCR reaction program

[0140]

[0141]

[0142] The experimental results are shown below Figure 3 The results showed that Smac-derived short peptides could significantly increase the levels of lipid peroxidation, MDA, and PTGS2 mRNA expression, and promote ferroptosis.

[0143] Example 4 Effects of Smac-derived short peptides on cell proliferation and cell clone formation ability

[0144] Material:

[0145] H1299 cells, DMEM medium, fetal bovine serum FBS, CCK-8 detection kit, crystal violet staining kit.

[0146] Experimental methods:

[0147] The short peptides P1X and P2X fused with the TAT sequence were co-incubated with H1299 cells for 72 h (using a concentration of 2 μM), P1X-3A was used as a control peptide (using a concentration of 2 μM, repeated twice), and RSL3 was used as a positive control at a concentration of 2 μM. The degree of cell ferroptosis and the proportion of cell death were detected using an optical microscope and a CCK-8 detection kit. Cell viability was determined using a cell counting kit-8 (CCK-8). 10,000 cells / well were seeded in a 96-well plate one day before treatment. After treatment with the peptide drug, the culture medium in each well was replaced with fresh culture medium containing the CCK-8 reagent. After incubation at 37 ° C for 1 hour, the resulting color was measured at OD450 nm using a microplate absorbance reader (Bio-Rad). Each assay was performed in triplicate.

[0148] The short peptides P1X and P2X fused with the TAT sequence were co-incubated with H1299 cells for 5 days (using a concentration of 2 μM), P1X-3A was used as a control peptide (using a concentration of 2 μM, repeated twice), and RSL3 was used as a positive control at a concentration of 2 μM. Crystal violet staining was used to detect cell clone formation and statistics were performed. H1299 cells were cultured at 1×10 4The cells were cultured in 6-well plates at a density of 1.50 μg / mL and incubated with the above short peptides. After 5 days of incubation, the cells were fixed with 4% paraformaldehyde for 15 minutes and stained with Giemsa dye for 20 minutes (Solarbio, China). Each assay was performed in triplicate.

[0149] The experimental results are as follows Figure 4 As shown. The results showed that Smac-derived short peptides could significantly inhibit cell proliferation and cell clone formation ability. Taking RSL3 as a comparative example, the results showed that Smac-derived short peptides were superior to the existing technology in inhibiting GPX4 activity and inducing ferroptosis.

[0150] Example 5 Effect of the combined use of Smac-derived short peptide and AVPI mimetic peptide

[0151] The Smac-derived short peptide was used in combination with an AVPI-mimicking peptide (such as Xevinapant) at a total mass ratio of 1:1, the concentration of P1X+P2X in the Smac-derived short peptide was 20 μM, and the concentration of Xevinapant was 1 μM. After treating H1299 cells for 48 hours, the cell viability was detected by the CCK-8 method, and the cell clone formation ability was detected by the clone formation experiment. The experimental steps for detecting the cell viability and cell clone formation here are consistent with those described in the above Example 4.

[0152] The test results are as follows Figure 5 As shown. The results showed that the combined use of drugs can significantly inhibit the growth of tumor cells, and the effect is better than that of single drugs. The control group without Smac-derived short peptide was used as a comparative example. The results showed that the Smac-derived short peptide had a significant ferroptosis induction effect, while the control group had no obvious effect.

[0153] The present invention reveals that Smac / DIABLO (second mitochondrial-derived caspase activator) not only promotes apoptosis through its AVPI fragment under chemotherapy-induced mitochondrial stress, but also specifically binds to glutathione peroxidase 4 (GPX4) through its short peptide fragment (126-134 and 212-220 amino acid sequences), inhibits the antioxidant activity of GPX4, and thus promotes ferroptosis. The specific technical effects are as follows:

[0154] Dual-targeted synergistic effect: Through the dual effects of Smac / DIABLO, it can not only promote apoptosis by binding to inhibitor of apoptosis proteins (IAPs) through the AVPI fragment, but also inhibit its activity by binding to GPX4 through the short peptide fragment, significantly enhancing the anti-tumor effect of chemotherapy drugs (cell death rate increased by 40-50%).

[0155] Overcoming chemotherapy resistance: In tumor cells with p53 mutation or deletion, the limitations of traditional apoptosis pathways are overcome by activating the ferroptosis pathway, increasing the tumor cell mortality rate to more than 90%.

[0156] Highly selective GPX4 inhibitor: The optimized peptide (P1X / P2X) designed based on the Smac short peptide fragment has a 3-fold higher binding affinity with GPX4 than the natural fragment, solving the problem of the lack of small molecule binding pockets on the surface of GPX4. It inhibits its function of reducing lipid peroxides by competitively binding to the active center of GPX4 (Cys73 and Sec46), with an IC50 value of 50nM.

[0157] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A polypeptide composition, characterized in that: The polypeptide composition comprises a P1 peptide segment and / or a P2 peptide segment; the amino acid sequence of the P1 peptide segment is shown as SEQ ID NO.1; the amino acid sequence of the P2 peptide segment is shown as SEQ ID NO.

2.

2. The polypeptide composition according to claim 1, characterized in that: The polypeptide composition also includes a cell-penetrating peptide, which is connected to the N-terminus of the P1 / P2 peptide segment; the amino acid sequence of the cell-penetrating peptide is shown in SEQ ID NO.

3.

3. Use of the polypeptide composition according to claim 2 in the preparation of a GPX4 inhibitor.

4. A GPX4 inhibitor, characterized in that The active ingredient of the GPX4 inhibitor comprises the polypeptide composition according to any one of claims 1-2.

5. The GPX4 inhibitor according to claim 4, characterized in that The inhibitor also includes one or more pharmaceutically acceptable carriers or excipients.

6. Use of the polypeptide composition according to any one of claims 1 to 2 or the polypeptide inhibitor according to any one of claims 4 to 5 in the preparation of a product for treating cancer.

7. The use according to claim 6, characterized in that: The product is a drug for treating cancer.

8. The use according to claim 7, characterized in that: The cancer includes lung cancer, cervical cancer, triple-negative breast cancer or pancreatic cancer.

9. The use according to claim 7, characterized in that: The medicine also includes one or more pharmaceutically acceptable carriers or excipients.

10. The use according to claim 7, characterized in that: The dosage form of the drug is selected from injection, solution, emulsion, suspension, suppository, ointment, cream, spray, drop, powder, granule, granule, capsule, pill, tablet, patch or sustained-release preparation.

Images