Saccharomyces cerevisiae engineering strain and application thereof in production of high-anthocyanin berry wine

Abstract

The invention relates to a saccharomyces cerevisiae engineering strain and application of the saccharomyces cerevisiae engineering strain in production of high-anthocyanin berry wine, and the saccharomyces cerevisiae engineering strain is constructed by knocking out a plurality of beta-glucosidase coding genes in saccharomycetes. The invention provides a brand new thought to improve the content of anthocyanin in the fruit wine, and the method is to knock out the gene for coding beta-glucosidase in the saccharomyces cerevisiae and reduce the hydrolysis effect on the anthocyanin in the fermentation process of the fruit wine. The technology provided by the invention is an important way for improving the nutritional and health-care values of fruit wines of blueberries, mulberries, aronia melanocarpa and the like, has a very huge market demand, and can generate remarkable economic benefits and social benefits.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and more specifically to an engineering strain of brewer's yeast and application thereof in producing high-anthocyanin berry wine. Background Art

[0002] Blueberry wine and mulberry wine are emerging products in the fruit wine industry. They are easier to drink than grape wine and are more in line with the current trend of low-alcohol, healthy and fashionable drinking. Anthocyanins and other polyphenols are an important class of compounds in berry wine and are closely related to the quality of the wine. The content of anthocyanins is an important indicator for evaluating the brewing process of fruit wines such as blueberry wine. Retaining more anthocyanins is also the key to ensuring the efficacy of fruit wine. However, blueberry and other fruit wines are very likely to cause the decomposition of anthocyanins during the production process, reducing their nutritional value. Therefore, the development of new process technologies to retain the functional ingredients of anthocyanins to the greatest extent has become a research hotspot in the field of fruit wine production.

[0003] Taking blueberries as an example, during the fermentation process of blueberry wine, anthocyanins show a trend of gradual decrease overall. Studies have shown that during the main fermentation process of blueberry wine (from the 2nd day to the 8th day), the content of anthocyanins can be reduced by about half. The main reason for the rapid decrease in anthocyanin content during the brewing process of blueberry wine is the adsorption of pigments by yeast and the enzymatic decomposition of anthocyanins. The anthocyanin content in existing fermented blueberry wines is generally low, and the quality needs to be improved.

[0004] Blueberries mainly contain six different anthocyanins, including malvidin-3-O-glucoside, cyanidin-3-O-glucoside, delphinidin-3-O-glucoside, peonidin-3-O-glucoside, pelargonidin-3-O-glucoside and petunidin-3-O-glucoside. Literature reports that Saccharomyces cerevisiae has genes encoding multiple β-glucosidases, among which EXG1 and SPR1 can effectively degrade five anthocyanins, namely cyanidin-3-O-glucoside, delphinidin-3-O-glucoside, peonidin-3-O-glucoside, pelargonidin-3-O-glucoside and petunidin-3-O-glucoside. Therefore, the activity of β-glucosidase in Saccharomyces cerevisiae has an adverse effect on the retention of anthocyanins.

[0005] In the process of fruit wine brewing, the degradation of anthocyanins is a common problem faced by the industry. Existing research mainly focuses on screening new yeast strains, immobilizing yeast strains and optimizing the fermentation process. However, current reports and patents do not involve reducing β-glucosidase activity to increase anthocyanin content. Summary of the invention

[0006] The present invention provides an engineered strain of brewer's yeast and application thereof in producing high-anthocyanin berry wine. The present invention is an important way to improve the nutritional and health-care value of fruit wines such as blueberries, mulberries and berries, has a very huge market demand, and will generate significant economic and social benefits.

[0007] In a first aspect, the present invention provides an engineered strain of Saccharomyces cerevisiae, which is constructed by knocking out multiple β-glucosidase encoding genes in yeast.

[0008] Preferably, the gene sequence of the β-glucosidase encoding gene is SEQ ID NO.1 and SEQ ID NO.2.

[0009] Preferably, the engineered strain of Saccharomyces cerevisiae is Saccharomyces cerevisiae BV818 lacking the gene sequences of SEQ ID NO.1 and SEQ ID NO.2.

[0010] Preferably, the engineered strain of Saccharomyces cerevisiae is used to reduce the loss of anthocyanins during the fermentation process of fruit wine.

[0011] In a second aspect, the present invention provides a method for preparing an engineered strain of Saccharomyces cerevisiae, comprising the following steps: performing a gene knockout operation using a homologous recombination method, simultaneously transforming two recombinant knockout vector fragments containing different antibiotic markers, diluting and spreading the obtained transformed bacteria on a plate containing two antibiotics at the same time and culturing until an obvious single colony appears, and then performing the next step of transformation verification.

[0012] Preferably, a knockout fragment based on geneticin resistance and bleomycin resistance is constructed to knock out the EXG1 and SPR1 genes.

[0013] Preferably, the culture conditions are: static culture in a 28° C. incubator for 3 days.

[0014] In a third aspect, the present invention provides an application of an engineered strain of Saccharomyces cerevisiae in the fields of blueberry, mulberry and berry wine fermentation and other food fields.

[0015] In summary, the present invention has the following beneficial effects:

[0016] The present invention utilizes a method for constructing engineered yeast to knock out the target genes, namely, β-glucosidase EXG1 and β-glucosidase SPR1, to reduce the activity of β-glucosidase in engineered Saccharomyces cerevisiae. The purpose of the present invention is to provide a novel method for constructing engineered Saccharomyces cerevisiae to reduce the loss of anthocyanins during the fermentation of fruit wines such as blueberry wine.

[0017] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not intended to limit the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a diagram of the construction process of the engineering strain of Saccharomyces cerevisiae of the present invention;

[0019] Figure 2 It is a diagram of the KANR fragment that can be amplified to about 800 bp using primers A3 and A4 in Example 2 of the present invention;

[0020] Figure 3 This is a diagram of a 1600 bp fragment amplified using primers A1 and A6 in Example 2 of the present invention;

[0021] Figure 4 This is a graph showing changes in anthocyanin content in blueberries of the original strain and the engineered strain of the present invention after 8-day fermentation, wherein 1-6 represent malvidin-3-O-glucoside, cyanidin-3-O-glucoside, delphinidin-3-O-glucoside, peonydin-3-O-glucoside, pelargonidin-3-O-glucoside and petunidin-3-O-glucoside, respectively. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with the examples. It is particularly noted that if no specific conditions are specified in the following examples, the reactions are carried out according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can be obtained from common commercial sources.

[0023] Example

[0024] Example 1

[0025] Construction of gene knockout fragments

[0026] Using domestic commercial Saccharomyces cerevisiae BV818 as the target strain, the β-glucosidase EXG1 gene sequence (as shown in the nucleotide sequence SEQ ID NO.1) and the β-glucosidase SPR1 gene sequence (as shown in the nucleotide sequence SEQ ID NO.2) were found.

[0027] SEQ ID NO.1:

[0028]

[0029] SEQ ID NO.2:

[0030]

[0031] like Figure 1 As shown, according to the principle of homologous recombination, a knockout fragment based on geneticin resistance and bleomycin resistance was constructed to knock out the EXG1 and SPR1 genes. The primer sequences required for the construction process are shown in Table 1. The genomic DNA of strain BV818 was used as a template, and the upstream sequence of the EXG1 gene was amplified with primers A1 and A2, and the downstream sequence of the EXG1 gene was amplified with primers A5 and A6. The geneticin (G418) resistance gene KANR was amplified with primers A3 and A4 using plasmid pPIC9K as a template, and the three fragments were recovered and connected together by overlapping extension PCR to obtain the EXG1 knockout fragment, as shown in Sequence 1. With the same idea, the upstream sequence of the SPR1 gene was amplified with primers B1 and B2, the downstream sequence of the SPR1 gene was amplified with primers B5 and B6, and the bleomycin (Zeocin) resistance gene BLER was amplified with plasmid pPICZA as a template using B3 and B4. The three fragments were recovered and connected together by overlapping extension PCR to obtain the knockout fragment of SPR1, as shown in Sequence 2.

[0032] Table 1 Primer sequences used in the construction process

[0033] Primer Name Primer Sequence A1 CGATTATATTCTGACAGGAATG A2 CCCTCTGAACGAAACCATTTACTTCTAAAGTTTATA A3 TATAAACTTTAGAAGTAAATGGTTTCGTTCAGAGGG A4 TATATGCCACAAAATTTCAATGACATTGGTTAGGAT A5 ATCCTAACCAATGTCATTGAAATTTTGTGGCATATA A6 GTCTCCTTTCAAGCACTC B1 GAGCACGCCGTTATAATTTTAGC B2 GTTTTAAGCGAAAGCATTTTAGTTGGTAAT B3 ATTACCAACTAAAATGCTTTCGCTTAAAAC B4 AGCGGACTGAGGGCGACTTAGTTAGAAATTGTGCCAC B5 GTGGCACAATTTCTAACTAAGTCGCCCTCAGTCCGCT B6 AATTGACTTTATATTCGGGGC

[0034] Example 2

[0035] Gene knockout in yeast strains

[0036] Prepare YPD solid medium, which consists of 2% glucose, 2% peptone, 1% yeast powder and 2% agar. The yeast strain BV818 was activated by streaking on the YPD plate and cultured in a 28°C incubator for 3 days. Pick a single yeast colony into a triangular flask containing YPD liquid medium and culture it at 28°C and 160rpm for 18 hours until the BV818 strain enters the middle of the logarithmic phase and the cell concentration OD600 reaches 0.4. Take 1.5ml of culture solution and centrifuge it at 5000rpm for 5 minutes, discard the supernatant, and then wash it with sterile saline 3 times. Finally, suspend the bacteria in 1.0ml of 0.1M lithium acetate (pH 6.0) buffer and keep it in a static water bath at 28°C for 1 hour. After the water bath ends, centrifuge and discard the supernatant. Gently resuspend the cells in 200.0μl 0.1M lithium acetate (pH 6.0) buffer, add 40μl 1M lithium acetate solution, 240μl 50% PEG4000, 20μl salmon sperm DNA, mix thoroughly, add 1.5μg EXG1 knockout fragment and 1.5μg SPR1 knockout fragment, incubate at 39℃ water bath for 45min, then quickly ice bath for 20min. Centrifuge at 5000rpm to obtain yeast cells, dilute and spread on YPD plates containing 100μg / ml geneticin and 100μg / ml bleomycin, and culture for 3d until obvious single colonies grow.

[0037] Pick a single colony of the transformant on the antibiotic plate, culture it in YPD liquid medium for 24 hours, and extract genomic DNA. Figure 2 As shown, primers A3 and A4 can amplify a KANR fragment of about 800bp (lane 1 and lane 2), and primers B3 and B4 can amplify a resistance gene BleR of about 400bp (lane 3 and lane 4), indicating that the knockout fragments are inserted into the genome. PCR amplification was performed using homologous arm primers A1 and A6, B1 and B6 as primers, and the length of the amplified product was used to determine whether the resistance gene successfully replaced the EXG1 and SPR1 genes to complete the knockout. In the wild strain, the EXG1 and SPR1 genes remained intact, and a 2160bp fragment was amplified using primers A1 and A6, and a 2193bp fragment was amplified using primers B1 and B6. In the transformants, as Figure 3 As shown, primers A1 and A6 amplified a 1600 bp fragment (lane 3 and lane 4), indicating that the EXG1 gene was replaced by the KANR resistance gene; primers B1 and B6 amplified a 1200 bp fragment (lane 3 and lane 4), indicating that the SPR1 gene was replaced by the BleR resistance gene (lane 1 and lane 2). It can be seen that the engineered yeast strain knocking out EXG1 and SPR1 has been constructed.

[0038] Example 3

[0039] Fermentation technology of blueberry wine with engineered yeast and changes in anthocyanin content

[0040] The refrigerated blueberries were evenly pulped, and pectinase was added at 2% and treated at 50°C for 2 hours until the viscosity of the blueberry pulp dropped to a constant level, and then the blueberry pulp could be used as a substrate for blueberry wine fermentation. After enzymolysis, the soluble solids were adjusted to 25%, sterilized by heating in a 75°C water bath for 10 minutes, and then divided equally into two groups of sterile triangular flasks. When the temperature dropped to 35°C, 0.01% of the BV818 strain was added to one group for fermentation, and 0.01% of the engineered yeast strain (the strain with the EXG1 and SPR1 genes knocked out in the present invention) was added to the other group for fermentation. The fermentation continued for 12 days, and samples were taken on the 2nd and 8th days to determine the anthocyanin yield in the blueberry wine.

[0041] The content of anthocyanins was determined by HPLC. At the beginning of fermentation on the second day, the total content of anthocyanins was 125.8 mg / L. At the end of fermentation on the eighth day, the anthocyanin content of the original commercial strain was reduced to 57.89 mg / L, while the anthocyanin content of the engineered strain was 92.16 mg / L. Overall, 46.02% of anthocyanins were retained during the fermentation of BV818, while 73.26% of anthocyanins could be retained by the engineered yeast fermentation, and the retention amount was significantly increased. Among them, the content of malvidin-3-O-glucoside did not change much, while the contents of cyanidin-3-O-glucoside, delphinidin-3-O-glucoside and petunidin-3-O-glucoside increased significantly, reaching 8.36 mg / L, 17.32 mg / L and 19.32 mg / L, respectively.

[0042] Example 4

[0043] Fermentation technology of mulberry wine with engineered yeast and changes in anthocyanin content

[0044] The refrigerated mulberries are evenly pulped, and pectinase is added at 1% and treated at 50°C for 2 hours until the viscosity of the mulberry pulp decreases to a constant level, which can be used as a substrate for mulberry wine fermentation. After enzymolysis, the soluble solids in the mulberry pulp are adjusted to 25%, and sterilized in a 75°C water bath for 10 minutes. When the temperature drops to 35°C, sterile sucrose solution is added, and the sugar content is adjusted to 22°Bx, and the mixture is divided equally into two groups of sterile triangular bottles. One group is added with 0.01% BV818 strain for fermentation, and the other group is added with 0.01% engineered yeast strain (strains with knockout EXG1 and SPR1 genes in the present invention) for fermentation. The mixture is cultured at 28°C, and the fermentation is stopped when the alcohol concentration reaches 10% (V / V). The anthocyanin content in the mulberry wine is measured by sampling on the second day and after the fermentation is completed.

[0045] The content of anthocyanins was determined by HPLC. At the beginning of fermentation on the second day, the total content of anthocyanins was 526.31 mg / L. On the 15th day, the alcohol concentration reached 10% (V / V), and the anthocyanin content of the original commercial strain fermentation was reduced to 267.44 mg / L, while the anthocyanin content of the engineered strain fermentation was 320.68 mg / L. Overall, 50.81% of anthocyanins were retained during the BV818 fermentation process, while 60.93% of anthocyanins could be retained during the engineered yeast fermentation, and the retention amount was significantly increased. Among them, the content of malvidin-3-O-glucoside, delphinidin-3-O-glucoside and petunidin-3-O-glucoside did not change much, and cyanidin-3-O-glucoside increased significantly to 42.35 mg / L.

[0046] In summary, knocking out the EXG1 and SPR1 genes increased the content of anthocyanins in blueberry wine fermented by Saccharomyces cerevisiae by 27.24% compared with the original yeast, and the content of anthocyanins in mulberry wine fermented by Saccharomyces cerevisiae increased by 10.12% compared with the original yeast, and the improvement effect was extremely obvious. In summary, the fermentation of the engineered bacteria of Saccharomyces cerevisiae in this application can effectively increase the content of anthocyanins in blueberry wine and mulberry wine, improve the taste and quality of the wine, and is an environmentally friendly, economical and convenient fermentation method for improving the taste of blueberry berry wine. This application can also be applied to the fermentation of other fruit wines such as mulberry, sea buckthorn, raspberry, cranberry, etc.

[0047] The above is only an exemplary embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A Saccharomyces cerevisiae engineered strain, characterized in that: An engineered strain of Saccharomyces cerevisiae was constructed by knocking out multiple β-glucosidase encoding genes in yeast.

2. The engineered strain of Saccharomyces cerevisiae according to claim 1, characterized in that The gene sequences of the β-glucosidase encoding gene are SEQ ID NO.1 and SEQ ID NO.

2.

3. The engineered strain of Saccharomyces cerevisiae according to claim 1, characterized in that The engineered strain of Saccharomyces cerevisiae is Saccharomyces cerevisiae BV818 lacking the gene sequences of SEQ ID NO.1 and SEQ ID NO.

2.

4. The engineered strain of Saccharomyces cerevisiae according to claim 1, characterized in that The brewer's yeast engineered strain is used to reduce the loss of anthocyanins during the fruit wine fermentation process.

5. The method for preparing the engineered strain of Saccharomyces cerevisiae according to any one of claims 1 to 4, characterized in that: The following steps are involved: The gene knockout operation was performed using the homologous recombination method. Two recombinant knockout vector fragments containing different antibiotic markers were transformed simultaneously. The obtained transformed bacteria were diluted and spread on plates containing two antibiotics at the same time for culture until obvious single colonies appeared, and then the next step of transformation verification was carried out.

6. The method for preparing the engineered strain of Saccharomyces cerevisiae according to claim 5, characterized in that: A knockout fragment based on geneticin resistance and bleomycin resistance was constructed to knock out the genes of SEQ ID NO.1 and SEQ ID NO.

2.

7. The method for preparing the engineered strain of Saccharomyces cerevisiae according to claim 5, characterized in that: The culture conditions are: static culture at 25-28°C for 3-4 days.

8. Application of the Saccharomyces cerevisiae engineered strain obtained by the Saccharomyces cerevisiae engineered strain according to any one of claims 1 to 4 or the method for preparing the Saccharomyces cerevisiae engineered strain according to any one of claims 5 to 7 in the fields of blueberry, mulberry and berry wine fermentation and other food fields.

Images