Phytobacterium plantarum and application thereof in preparation of astragalus mongholicus fermentation liquor with antihypertensive effect

Abstract

The invention discloses a plant lactobacillus and application thereof in preparation of astragalus membranaceus fermentation liquor with an antihypertensive effect. The name of the lactobacillus plantarum is lactobacillus plantarum WH-P2, the lactobacillus plantarum WH-P2 has been preserved in Guangdong Microbial Culture Collection Center (GDMCC) on the fifth floor, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City on November 7, 2024, and the preservation number is GDMCC No: 65436. Experiments show that the plant lactobacillus WH-P2 can be used for fermenting an astragalus mongholicus extracting solution, and the fermented astragalus mongholicus fermentation liquor has the activity of improving hypertension, so that the plant lactobacillus WH-P2 can be used for developing functional products with the effect of improving hypertension.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial fermentation, and particularly relates to a plant lactobacillus strain and application thereof in preparing an astragalus fermentation liquid with a blood pressure-lowering effect. Background Art

[0002] Hypertension is an important risk factor for cardiovascular and cerebrovascular diseases and the leading cause of premature death worldwide. According to statistics, 7 million people die from hypertension each year worldwide. It is estimated that by 2025, the number of hypertensive patients in the world will reach 1.56 billion. Therefore, finding drugs that can prevent, control and treat cardiovascular diseases is the common wish of international biomedical scientists and patients.

[0003] As people are increasingly admiring the theory that food and medicine have the same origin, Chinese medicine uses the theory of "preventive treatment" and health care to prevent and treat hypertension in terms of diet, health care, and rehabilitation. Modern domestic and foreign research has shown that hypertension can be strictly controlled through effective dietary rehabilitation methods, and can effectively reduce the occurrence of complications such as heart, brain, and kidney.

[0004] Astragalus is a Chinese herbal medicine that is both a medicine and food. It contains polysaccharides, triterpenoid saponins, flavonoids, alkaloids, amino acids and other main active ingredients. It has anti-inflammatory, antioxidant, anti-tumor, hypoglycemic, immune-enhancing, and blood pressure-lowering pharmacological effects. In modern medicine, a large number of studies have shown that Astragalus has a blood pressure-lowering function. The clinical and animal experiments have definite efficacy and can effectively improve hypertension. Clinical trials have shown that after administration of Astragalus, it can regulate immune response and reduce the systolic and diastolic blood pressure of patients. Its antihypertensive mechanism is mainly to inhibit RAAS and promote urination. The antihypertensive effect is stable and relatively safe. However, there are still some problems with Chinese herbal medicines such as Astragalus that are both a medicine and food, such as low oral bioavailability and poor taste and flavor, which hinder their application. Existing studies have shown that Chinese herbal medicines can increase the content of active ingredients and enhance the efficacy of drugs after probiotic fermentation. It can also promote the production of new active ingredients, improve flavor and reduce the toxic and side effects of herbs. Therefore, it is of great significance to seek a probiotic that can effectively ferment Astragalus, enhance the in vivo bioavailability of Astragalus active substances and improve its activity in improving hypertension. Summary of the invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a strain of Lactobacillus plantarum.

[0006] Another object of the present invention is to provide the application of the Lactobacillus plantarum.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A strain of Lactobacillus plantarum, named Lactiplantibacillus plantarum WH-P2, with a deposit number of GDMCC No: 65436, was deposited at the Guangdong Microbiological Culture Collection Center (GDMCC) on November 7, 2024, on the 5th floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0009] The application of the plant lactobacillus in astragalus fermentation.

[0010] A method for preparing an astragalus fermented liquid having the activity of improving hypertension comprises the following steps:

[0011] S1. Drying, crushing and sieving the raw material of Astragalus to obtain Astragalus powder; then mixing the Astragalus powder with water, extracting under ultrasonic conditions, centrifuging after extraction, taking the supernatant, sterilizing, and obtaining an Astragalus extract;

[0012] S2, inoculating the above-mentioned Lactobacillus plantarum into the astragalus extract for fermentation and culture, and after the fermentation is completed, centrifuging and taking the supernatant to obtain the astragalus fermentation liquid with the activity of improving hypertension.

[0013] The sieving in step S1 is through a 60-80 mesh sieve, preferably through an 80 mesh sieve.

[0014] The solid-to-liquid ratio of the astragalus powder to water in step S1 is 1 g:5-20 mL, preferably 1 g:10 mL.

[0015] The ultrasonic conditions described in step S1 are: ultrasonic treatment at 35-45° C. and 40 kHz for 1-3 h; preferably: ultrasonic treatment at 40° C. and 40 kHz for 2 h.

[0016] The centrifugal conditions in steps S1 and S2 are: 4°C, 10000-15000 rpm, 10-20 min; preferably: 4°C, 12000 rpm, 15 min.

[0017] The sterilization conditions described in step S1 are: sterilization at 121° C. for 10 to 20 minutes; preferably: sterilization at 121° C. for 15 minutes.

[0018] In step S2, the inoculated Lactobacillus plantarum is preferably Lactobacillus plantarum seed liquid, which can be obtained by culturing according to the conventional method for culturing Lactobacillus plantarum seed liquid in the art; preferably, it is prepared by the following method: inoculating a single colony of Lactobacillus plantarum into a culture medium, culturing it at 37±1°C for 16 to 18 hours, then transferring it to a fresh liquid culture medium, and culturing it at 37±1°C for 16 to 18 hours to obtain the Lactobacillus plantarum seed liquid.

[0019] The culture medium is preferably MRS culture medium.

[0020] The inoculum size of Lactobacillus plantarum in step S2 is 2.0±0.4×10 7 CFU / mL.

[0021] The fermentation conditions in step S2 are: fermentation at 37±1°C for 12 to 36 hours; preferably: fermentation at 37°C for 24 hours.

[0022] An astragalus fermented liquid with the activity of improving hypertension is prepared by any of the methods described above.

[0023] The application of the Lactobacillus plantarum and / or Astragalus membranaceus fermentation liquid in the preparation of products for preventing or treating hypertension (blood pressure lowering products).

[0024] The products for preventing or treating hypertension include functional foods, health products or medicines for preventing and treating hypertension, improving hypertension, inhibiting angiotensin converting enzyme, etc.

[0025] The present invention utilizes Lactobacillus plantarum to ferment the edible and medicinal Chinese herbal medicine Astragalus membranaceus. Through the biotransformation of Astragalus membranaceus components by Lactobacillus plantarum, macromolecular substances in the Chinese medicine are decomposed and transformed, precursor substances are gradually generated, heavy metal substances are biointegrated, and toxic and harmful substances are modified and detoxified, so that the content of effective components in the Chinese medicine fermentation liquid is greatly improved, and the activity of improving hypertension is improved. At the same time, the active components in the Astragalus membranaceus extract can provide nutrients for the growth and metabolism of Lactobacillus plantarum, promote its growth, and thus maximize the effects of the Chinese medicine and probiotics.

[0026] Compared with the prior art, the present invention has the following advantages and effects:

[0027] 1. The astragalus fermented liquid in the present invention is prepared by fermenting an astragalus extract with Lactobacillus plantarum. Experiments have shown that the fermented liquid contains rich substances, up to 141 kinds, among which flavonoid compounds are the most numerous; the astragalus fermented liquid exhibits better in vitro antioxidant capacity than unfermented astragalus extract; the astragalus fermented liquid can increase NO content, reduce cellular oxidative stress response, reduce the expression of inflammatory factors, reduce the expression of ACE and vasoconstrictor factor ET-1, etc. in a HUVEC endothelial dysfunction model, has the activity of improving hypertension, and enriches the nutritional structure of pharmaceutical products, has good application value, and can be used to develop functional foods, health products or medicines with the effect of improving hypertension.

[0028] 2. The present invention uses probiotics to prepare astragalus fermentation liquid through a biological fermentation method, evaluates its effect on improving hypertension, broadens the biological efficacy of astragalus-related products, and further improves the application value of astragalus.

[0029] 3. The present invention selects astragalus extract as fermentation matrix under certain temperature conditions, selects superior probiotics as fermentation strains for fermentation, and can be mechanized and automated, which is conducive to the realization of obvious advantages of industrial-scale production.

[0030] 4. The present invention increases the in vivo bioavailability of astragalus active substances and improves its activity in improving hypertension through probiotic fermentation. At the same time, it provides some ideas and methods for the development and utilization of Chinese herbal medicines such as astragalus that are both medicinal and edible, promotes the inheritance, innovation and development of traditional Chinese medicine in the new biotechnology era, and also provides an effective and safe new method for improving hypertension. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a colony morphology diagram of the strain Lactobacillus plantarum WH-P2.

[0032] Figure 2 This is a graph showing the effect of different concentrations of hydrogen peroxide on HUVEC cell viability.

[0033] Figure 3 This is a graph showing the effects of different samples on NO content in the endothelial dysfunction model.

[0034] Figure 4 These are the results of the effects of different samples on oxidative stress-related indicators in the endothelial dysfunction model; A is the results of the effects on ROS content; B is the results of the effects on SOD content; and C is the results of the effects on MDA content.

[0035] Figure 5 These are the results of the effects of different samples on the inflammatory factor-related indicators in the endothelial dysfunction model; among them, A is the results of the effects on the IL-6 content; B is the results of the effects on the TNF-α content; and C is the results of the effects on the IL-10 content.

[0036] Figure 6 The figures are the results of the effects of different samples on the expression of ACE, eNOS and ET-1 mRNA in HUVEC cells; A is the result of the effects on the expression of ACE mRNA; B is the result of the effects on the expression of eNOS mRNA; and C is the result of the effects on the expression of ET-1 mRNA.

[0037] Figure 7These are the results of the effects of different samples on the expression of IL-6, IL-1β, TNF-α, and IL-10 mRNA in HUVEC cells; among them, A is the result of the effect on the expression of IL-6 mRNA; B is the result of the effect on the expression of IL-1β mRNA; C is the result of the effect on the expression of TNF-α mRNA; and D is the result of the effect on the expression of IL-10 mRNA.

[0038] Figure 8 are the base peak chromatograms of the system before and after fermentation in positive and negative ion modes; wherein, A is the base peak chromatogram of the Unfermented (unfermented Astragalus extract) group samples in positive ion mode; B is the base peak chromatogram of the Unfermented group samples in negative ion mode; C is the base peak chromatogram of the P2 (Lactobacillus plantarum fermentation) group samples in positive ion mode; and D is the base peak chromatogram of the P2 group samples in negative ion mode.

[0039] Fig. 9 These are the in vitro antioxidant results of samples of different concentrations; A is the DPPH free radical scavenging results; B is the hydroxyl free radical scavenging results; and C is the iron ion reducing ability test results. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. The test methods for which specific experimental conditions are not specified in the following examples are usually in accordance with conventional experimental conditions. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0041] Example 1 Isolation, Identification and Preservation of Lactobacillus plantarum

[0042] Take 1g of kimchi sample (purchased from a market in Guangzhou, Guangdong Province), sour soup (from Qiannan Buyi and Miao Autonomous Prefecture, Guizhou Province), jiangshui (Tianshui City, Gansu Province), infant feces and breast milk (collected from healthy infants aged 0-3 months who were exclusively breastfed / without antibiotics / without probiotics use history, from volunteers), suspend them in 9mL sterile PBS buffer (pH 7.4, containing 0.5g / L L-cysteine ​​hydrochloride), homogenize and mix them, then dilute them in sequence, spread them on the surface of MRS solid culture medium containing 2% (w / v) CaCO3, and culture them anaerobically at 37℃ for 36-48h. Pick single colonies with obvious transparent circles, smooth surfaces and round shapes, number, record and purify them at least 3 times. During the purification, the strains can be preliminarily identified and foreign bacteria can be eliminated based on their colony morphology, catalase test and Gram staining microscopy. Finally, the purified single colony was inoculated into MRS liquid culture medium and cultured at 37°C for 18 hours. The fresh bacterial solution was mixed with equal volumes of 25% (w / v) glycerol and then frozen in a -80°C refrigerator for later use. The purified strains were subjected to Gram staining and catalase experiments. The Gram staining results were Gram-positive bacteria and catalase-negative. A total of 54 strains were screened and purified, and five strains were obtained through preliminary screening through in vitro angiotensin-converting enzyme inhibition experiments. They were numbered F10, F12A, J3, J15, and P2, and were identified as Lactobacillus plantarum. Among them, the colony morphology of the P2 strain is as follows Figure 1 Its 16S rRNA sequence SEQ ID NO.1 is as follows:

[0043]

[0044] Based on the colony morphological characteristics and molecular identification results of the strain, it was named Lactiplantibacillus plantarum WH-P2 and was deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC) on the 5th floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou on November 7, 2024, with the deposit number GDMCC No: 65436.

[0045] Example 2 Preparation of Astragalus Fermentation Broth

[0046] 1. Preparation of Astragalus extract: Dry and crush Astragalus (purchased from Haozhou Kangmei Chinese Medicine City, origin: Gansu), sieve through 80 mesh, weigh a certain amount of Astragalus Chinese medicine powder and mix it with water at a solid-liquid ratio of 1:10 (g / ml), place it under 40℃, 40kHz conditions for ultrasonic treatment for 2h. Centrifuge at 12000rpm for 15min, take the supernatant, sterilize at 121℃ for 15min, and obtain Astragalus extract.

[0047] 2. Preparation of fermentation strain seed liquid: The bacteria separated and purified in Example 1 (numbered F10, F12A, J3, J15, P2) were inoculated into fresh MRS liquid culture medium at a ratio of 1:10 (v / v), and cultured at 37°C for 16 to 18 hours. After mixing, an appropriate amount of bacterial liquid was streaked on an MRS solid culture medium, sealed and cultured at 37°C for 48 hours, a single colony was picked and inoculated into a fresh MRS liquid culture medium, and cultured at 37°C for 16 to 18 hours. After mixing, it was inoculated into a fresh MRS liquid culture medium at a ratio of 1:10 (v / v), and cultured at 37°C for 16 to 18 hours to obtain an activated fermentation strain seed liquid.

[0048] 3. Preparation of Astragalus fermentation broth: The fermentation strain seed liquid (F10, F12A, J3, J15, P2) was inoculated into the Astragalus extract respectively, and the initial colony count was 2×10 7 CFU / mL, after static culture at 37°C for 24h, centrifuged at 12000rpm and 4°C for 15min, the supernatant was taken as the fermented astragalus broth (F10, F12A, J3, J15, P2). The fermented strain seed liquid was replaced with sterile water of the same volume, and the other conditions remained unchanged, and the supernatant obtained was the unfermented astragalus extract (Unfermented).

[0049] Example 3 Determination of in vitro angiotensin converting enzyme inhibition rate

[0050] 1. Experimental methods:

[0051] In this example, the pyridine benzenesulfonyl chloride method was used to determine the in vitro angiotensin converting enzyme inhibition rate. The fermented astragalus radix (F10, F12A, J3, J15, P2) and unfermented astragalus extract (Unfermented) samples prepared in Example 2 were diluted to a final concentration of 2.44 mg / mL in the enzyme reaction system, and three samples were replicated in each group, and the average value was taken. The specific experimental steps are shown in Table 1:

[0052] Table 1 In vitro angiotensin converting enzyme inhibition rate experimental steps

[0053]

[0054] The inhibition rate of angiotensin converting enzyme was calculated as follows:

[0055]

[0056] Among them: A a A is the absorbance when the sample is added; b A is the absorbance when no sample is added; c is the absorbance of the blank group.

[0057] 2. Experimental results:

[0058] The inhibitory effects of Astragalus fermentation broth (F10, F12A, J3, J15, P2) and unfermented Astragalus extract (Unfermented) on angiotensin converting enzyme activity are shown in Table 2. The inhibitory effect of Astragalus extract after fermentation by strains is better than that of unfermented Astragalus extract, indicating that fermented Astragalus can more effectively inhibit angiotensin converting enzyme activity, and the effect of P2 strain fermentation is the best.

[0059] Table 2 Angiotensin converting enzyme inhibition rate experimental results

[0060] strain Inhibition rate (%) Inhibition rate increased (%) Unfermented 51.48±6.22 / P2 79.63±5.33 28.15 F10 78.31±1.69 26.83 J3 75.98±2.97 24.50 F12A 75.58±1.78 24.10 J15 72.66±4.92 21.18

[0061] Example 4 Changes in colony count before and after fermentation

[0062] 1. Experimental methods:

[0063] In this example, the glass bead coating method was used to count the colonies. First, the fermentation strain seed solution (F10, F12A, J3, J15, P2) prepared in Example 2 and the astragalus extract were mixed (the bacteria will sink to the bottom after fermentation, so shake and mix before counting to ensure that the bacteria are evenly distributed). 6 The culture medium was diluted in a ratio of 100 μL, 100 μL of the dilution was spread on MRS solid culture medium with glass beads, and the culture was placed in a 37°C incubator for 48 hours, and then the colony counts were performed to explore the changes in the number of colonies.

[0064] 2. Experimental results:

[0065] The results are shown in Table 3. The number of colonies after fermentation increased significantly compared with the initial inoculation colony number, indicating that the dietary fiber, polysaccharides, phenolic compounds, amino acids and other compounds in the Astragalus extract can provide nutrients for the strain and maintain the normal growth and metabolism of the strain.

[0066] Table 3 Changes in colony count after fermentation

[0067]

[0068] Example 5 Construction of HUVEC endothelial dysfunction model

[0069] 1. Experimental methods:

[0070] HUVEC cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. The growth medium used contained: basic DMEM medium, 10% (v / v) fetal bovine serum (FBS), 1% double antibody solution (containing penicillin and streptomycin). HUVEC cells were inoculated in 96-well plates at 7000 cells / well, and the well plates with cells were placed in a cell culture incubator (37°C, 5% CO2) for culture. After the cells grew to 70% of the wall, each well was washed with PBS buffer and replaced with serum-free DMEM medium for continued culture for 12h, then washed with PBS, 100 μL of inducer (hydrogen peroxide solution diluted in serum-free DMEM medium, concentrations of 100, 300, 500, 700, 900, 1000 μM, respectively) was added and cultured for 1h to complete the modeling. The inducer was replaced with the same volume of serum-free DMEM medium, and the culture time was the same, which was recorded as the control group. After modeling, the culture medium was discarded, washed three times with PBS, and 100 μL of CCK-8 reagent diluted 10 times with fresh serum-free DMEM medium was added. After sufficient shaking for 10 seconds, it was placed in a 37°C cell culture incubator and incubated for 45 minutes. Finally, the absorbance of each well was read at 450nm using an ELISA reader, the cell survival rate was calculated, and the hydrogen peroxide concentration at 50% survival rate was selected as the optimal treatment concentration. The experiment was repeated three times.

[0071] 2. Experimental results

[0072] The results are as follows Figure 2 As shown in the figure, the survival rate of HUVEC cells decreased with the increase of hydrogen peroxide concentration. When treated with 900 μM hydrogen peroxide, the cell survival rate dropped to 49.80% ± 2.59%, which was significantly different from the normal group cells. Therefore, 900 μM was selected as the optimal treatment concentration for constructing the HUVEC endothelial dysfunction model.

[0073] Example 6 Determination of NO content in endothelial dysfunction model

[0074] 1. Experimental methods:

[0075] 1.1 NO detection using DAF-FM DA probe.

[0076] 1.1.1 Experimental groups were first divided into groups: blank control group (Conrtrol): without any intervention factors; experimental group: treated with 1 mg / mL of Astragalus sample (Astragalus fermentation broth F10, F12A, J3, J15, P2, and unfermented Astragalus extract prepared in Example 2) for 12 hours, and then treated with 700 μM hydrogen peroxide for 1 hour; model group (Model): first incubated with serum-free DMEM medium for 12 hours, and then treated with 700 μM hydrogen peroxide for 1 hour; positive control group (Captopril): treated with 2 mg / L captopril for 12 hours, and then treated with 900 μM hydrogen peroxide for 1 hour.

[0077] 1.1.2 HUVEC cells were cultured at 2×10 5 Inoculate 1 mL / well in a 6-well plate, and place in a 37°C carbon dioxide incubator for culture. When the cells have grown to about 70% of the bottom of the well, treat the cells in groups according to 1.1.1 above. After treating with hydrogen peroxide for 1 hour, discard the culture medium, wash twice with PBS, and then digest and collect the cells with trypsin without phenol red. Dilute the DAF-FM DA probe with a serum-free and phenol red-free culture medium at a ratio of 1:1000 (v / v) to a final concentration of 5 μM. Resuspend the cells with the prepared probe to a cell density of 1×10 6 ~2×10 7 / mL, incubate in a 37℃ cell culture incubator in the dark for 20min. Wash three times with PBS to fully remove the probes that have not entered the cells. Resuspend with PBS and detect with a fluorescent microplate reader. At the same time, take some cells for lysis and determine the protein concentration. The experiment was repeated three times.

[0078] 2. Experimental results:

[0079] NO is an important endothelial signaling molecule produced by endothelial cells, which has the function of regulating vasodilation and relaxation and is closely related to the development of hypertension. Figure 3 The results showed that compared with the normal control group, the NO secreted by the model group cells was significantly reduced (p<0.001). However, the P2 group and the Unfermented group could significantly increase the NO release, and there was a significant difference between P2 and Unfermented, which indicated that the Astragalus after P2 fermentation could more significantly stimulate the endothelial cells to release NO.

[0080] Example 7 Determination of oxidative stress-related indicators in endothelial dysfunction model

[0081] 1. Determination of ROS content:

[0082] 1.1 Experimental methods:

[0083] NO detection was performed using the H2DCFDA probe. Experimental grouping and HUVEC cell treatment were performed according to the experimental operation of Example 6, and the digested cells were collected. H2DCFDA was then diluted with serum-free culture medium at a ratio of 1:1000 (v / v) to a final concentration of 10 μM. The diluted H2DCFDA probe was then added to the HUVEC cells to a cell density of 1×10 6 ~2×10 7 / mL, incubate in a 37℃ cell culture incubator in the dark for 30min. Wash the cells 1-2 times with serum-free cell culture medium to fully remove H2DCFDA that has not entered the cells. Detect with a fluorescent microplate reader. At the same time, take some cells for lysis and determine the protein concentration. The experiment was repeated three times.

[0084] 1.2 Experimental results:

[0085] according to Figure 4 A shows that the ROS content in the model group was 150.77% ± 15.45 of the normal control group (p < 0.001). Except for F12A, which had no significant reduction in the production of ROS in the endothelial dysfunction model (p > 0.05), the other groups could significantly reduce the ROS content (p < 0.05). Compared with the ROS content of Unfermented (131.70% ± 10.00), the ROS content of J15 and P2 were 118.96% ± 5.64 and 116.96% ± 10.16 (p < 0.05), respectively, and the ROS content of J3 was 115.15% ± 2.94 (p < 0.01), indicating that most of the fermented astragalus broths can reduce the intracellular ROS level induced by hydrogen peroxide, thereby reducing the damage caused by oxidative stress, and the effects of J15, P2, and J3 are better than those of the Unfermented group.

[0086] 2. Determination of SOD activity and MDA content

[0087] 2.1 Experimental methods:

[0088] HUVEC cells were cultured at 2×10 5Each well was inoculated with 1 mL per well in a 6-well plate and cultured in a 37°C carbon dioxide incubator. When the cells were about 70% full of the bottom of the well, the experimental grouping and HUVEC cell treatment were performed according to the experimental operation of Example 6, and the digested cells were collected. The cells were then lysed with a lysate, and after sufficient lysis, the supernatant was centrifuged (10000 rpm, 10 min, 4°C) to obtain the supernatant for subsequent determination. The protein content of the supernatant was determined using the BCA protein concentration detection kit, and the content of MDA (malondialdehyde) and SOD (superoxide dismutase) in the cell culture fluid and the lysate was determined according to the kit. The experiment was repeated three times.

[0089] 2.2 Experimental results:

[0090] The results are as follows Figure 4 B and Figure 4 As shown in Figure C, compared with the normal control group, the SOD activity in the model group decreased significantly (p<0.0001), and the MDA content increased significantly (p<0.01), indicating that the damage to HUVEC cells caused by hydrogen peroxide treatment can significantly reduce the intracellular SOD activity and significantly increase the MDA content. Compared with the model group, except for the F12A and J3 groups, which had no significant effect on the SOD activity of the cells, the other groups could significantly increase the SOD activity, while for the MDA content (p>0.05), all the drug-treated groups could significantly reduce its content. Compared with the Unfermented group, J15 could significantly increase the intracellular SOD activity, and J3, J15, and P2 could significantly reduce the MDA content, indicating that the fermented Astragalus membranaceus can more effectively alleviate the oxidative damage to HUVEC cells caused by hydrogen peroxide treatment.

[0091] Based on the effects of different astragalus extracts on NO content in the endothelial dysfunction model and oxidative stress indicators including ROS content, SOD activity and MDA content, it was found that P2 had a better effect than other fermentation groups, so P2 was retained for subsequent experiments.

[0092] Example 8 Determination of Inflammatory Factor-Related Indicators in Endothelial Dysfunction Model

[0093] 1. Experimental methods:

[0094] The Astragalus fermentation broth P2 prepared in Example 2 was selected, and the experimental grouping and HUVEC cell treatment were performed according to the experimental operation of Example 6. The cell culture fluid was collected and centrifuged at 1000×g for 10 min at 4°C. The supernatant was collected and used to determine the content of IL-6, TNF-α, and IL-10 in the supernatant of the cell culture fluid according to the instructions of the kit (purchased from Xinbosheng Biotechnology Co., Ltd.).

[0095] 2. Experimental results:

[0096] The results are as follows Figure 5 As shown in the figure, the IL-6 and TNF-α contents in the model group were significantly increased compared with the normal control group, while the IL-10 content was significantly decreased (p<0.05), indicating that the damage caused by hydrogen peroxide treatment to HUVEC cells can significantly increase the production of pro-inflammatory factors such as IL-6 and TNF-α in cells and significantly reduce the content of anti-inflammatory factors such as IL-10. Compared with the model group, each drug-treated group can significantly reduce the content of IL-6 and TNF-α and significantly increase the content of IL-10. Compared with Unfermented, P2 has a significantly better effect on reducing the content of IL-6 and TNF-α than Unfermented (p<0.01, p<0.05), while there is no significant difference in the effect of increasing the content of IL-10 (p<0.05), which indicates that the fermented Astragalus extract is better than the unfermented one in reducing the production of pro-inflammatory factors in the endothelial dysfunction model.

[0097] Example 9 Determination of mRNA expression of HUVEC cell-related genes

[0098] 1. Experimental Methods

[0099] The fluorescence quantitative PCR method was used for determination. HUVEC cells were cultured at 2×10 5 Each well was inoculated with 1 mL of the solution and placed in a 37°C carbon dioxide incubator. When the cells covered about 70% of the bottom of the well, the experimental grouping and HUVEC cell treatment were performed according to the experimental operation of Example 6, and the digested cells were collected. The culture medium was fully removed from the cells, and the total RNA of the cells was extracted according to the instructions of the RNA extraction kit, and reverse transcribed to obtain cDNA, and then quantitative reaction was performed according to the instructions. The expression of mRNA was calculated according to the Ct value of qPCR, and the expression of the internal reference gene GADPH was used as a reference. According to 2 -△△Ct The relative expression of target gene mRNA was calculated by the method. Three samples were run in parallel in each group, and the average value was taken. The primer sequences used are shown in Table 5.

[0100] Table 4 PCR primer sequences

[0101] Forward Primer (5′-3′) Reverse Primer(5′-3′) GAPDH GGAAGCTTGTCATCAATGGAAATC TGATGACCCTTTTGGCTCCC ACE CAGGATCATCGGAGCTGTGC TAGCAGGGCGTTGTACTGC eNOS GACGCTACGAGGAGTGGAAG CCTGTATGCCAGCACAGCTA ET-1 TTGAGATCTGAGGAACCCGC GCTCAGCGCCTAAGACTGTT IL-6 CATCCTCGACGGCATCTCAG TCACCAGGCAAGTCTCCTCA IL-1β TTCGAGGCACAAGGCACAA TGGCTGCTTCAGACACTTGAG TNF-α CACTTTGGAGTGATCGGCCC CAGCTTGAGGGTTTGCTACAAC IL-10 GGCACCCAGTCTGAGAACAG GGCAACCCAGGTAACCCTTA

[0102] 2. Experimental results

[0103] 2.1 Expression of ACE, eNOS, and ET-1 mRNA

[0104] Angiotensin converting enzyme (ACE) plays a key role in the development of hypertension. ACE can convert angiotensin I into angiotensin II, causing strong vasoconstriction. Endothelial nitric oxide synthase (eNOS) can catalyze the synthesis of NO from L-arginine in endothelial cells. ET-1 is a vasoconstrictor factor that can induce endothelial dysfunction and atherosclerosis, causing hypertension. By measuring the transcription levels of ACE, eNOS and ET-1 mRNA in HUVEC cells, we can understand the effect of Astragalus fermentation broth on the synthesis of ACE, NO and ET-1.

[0105] according to Figure 6 It can be seen that the transcription levels of ACE and ET-1 mRNA in the model group increased significantly, and the transcription level of eNOS mRNA decreased significantly, indicating that after the action of hydrogen peroxide, it may reduce the production of NO by down-regulating the expression of eNOS, and increase the secretion of ACE and ET-1 by up-regulating the expression of ACE and ET-1, thereby leading to increased blood pressure. Figure 6 A Compared with the model group, the ACE mRNA expression in the P2 group was significantly decreased, while there was no significant difference in the Unfermented group. Figure 6 As shown in B, the expression of eNOS mRNA in Unfermented and P2 group cells increased significantly. Figure 6 C, The expression of ET-1 mRNA in the Unfermented group and the P2 group decreased significantly. The results showed that compared with the Unfermented group, the expression of ACE mRNA and ET-1 mRNA in the P2 group decreased significantly, and the expression of eNOS mRNA increased significantly. The above results indicate that P2 may improve hypertension by upregulating the expression of eNOS mRNA, promoting the synthesis of NO, downregulating the expression of ACE mRNA and ET-1 mRNA, and reducing the synthesis and secretion of ACE and ET-1, and the effect after fermentation is better than that of non-fermentation.

[0106] 2.2 Expression of IL-6, IL-1β, TNF-α, and IL-10 mRNA

[0107] Inflammation is closely related to elevated blood pressure. By measuring the expression of IL-6mRNA, IL-1βmRNA, TNF-αmRNA and IL-10 in HUVEC cells, we can understand the effect of Astragalus fermentation broth on the synthesis of IL-6, IL-1β, TNF-α and IL-10.

[0108] according to Figure 7It can be seen that compared with the blank control group, the transcription levels of IL-6mRNA, IL-1βmRNA, and TNF-αmRNA in the model group were significantly increased, and the transcription level of IL-10mRNA was significantly decreased, indicating that after the action of hydrogen peroxide, the expression of IL-6mRNA, IL-1βmRNA, and TNF-αmRNA can be upregulated, the secretion of IL-6, IL-1β, and TNF-α can be increased, and the expression of IL-10mRNA can be downregulated, thereby reducing the production of IL-10, thereby leading to vascular inflammation. Figure 7 A. Figure 7 B and Figure 7 C shows that compared with the model group, there was no significant difference in the expression of IL-1β mRNA in the Unfermented group, and the expression of IL-6 mRNA and TNF-α mRNA decreased significantly, while the expression of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA in the P2 group decreased significantly. Figure 7 D shows that compared with the model group, the IL-10 mRNA expression of the Unfermented group and the P2 group was significantly increased. Compared with the Unfermented group, the IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA expression of the P2 group cells were significantly decreased, and the IL-10 mRNA expression was significantly increased. The above results indicate that the Unfermented and P2 groups may relieve vascular inflammation and improve hypertension by down-regulating the expression of IL-6 mRNA, IL-1β mRNA, and TNF-α mRNA, reducing the synthesis and secretion of IL-6, IL-1β, and TNF-α, and up-regulating the expression of IL-10 mRNA, promoting the synthesis and secretion of IL-10, and then relieving vascular inflammation, and the fermented Astragalus membranaceus has better effect than the unfermented Astragalus membranaceus.

[0109] Example 10 Analysis of components of fermented and unfermented Astragalus extracts

[0110] 1. Experimental methods:

[0111] Liquid chromatography-mass spectrometry was used to analyze the samples of the fermented astragalus root (P2) and the unfermented astragalus root extract (Unfermented) prepared in Example 2. 500 μL of each sample to be analyzed was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was taken for detection.

[0112] The UltiMate 3000 UHPLC liquid chromatograph was used, and the chromatographic column was Thremo Hypersil gold C18 (1.9um, 2.1mm×100mm). The flow rate used for analysis was 0.3mL / min, and the injection volume was 10μL. The mobile phase was 0.1% (v / v) formic acid / acetonitrile (B)-0.1% (v / v) formic acid / water (A), and the gradient elution program of the solution was shown in Table 4. The mass spectrometer was Q-Exactive (Thermo Fisher Scientific, CA, USA) HESI source, the ion source temperature was 310°C, the capillary temperature was 320°C, the sheath gas flow rate was 30 units, the auxiliary gas flow rate was 10 units, the positive ion mode spray voltage was 3kV, and the negative ion mode spray voltage was 2.8kV.

[0113] The analysis was performed using data-dependent scanning analysis (DDA), with a loop count setting of 10, and HCD energy using step-wise normalized collision energy with setting values ​​of 10, 28, and 35 eV. The primary mass spectrometry scan range was 100-1500 m / z, the resolution was set to 70000, the AGCtarget was set to 3E6, and the injection time was set to 200 ms. The secondary mass spectrometry resolution was set to 17500, the AGCtarget was set to 1E5, and the injection time was set to 50 ms.

[0114] Table 5 Mobile phase gradient elution program

[0115] Time(min) A(％) B(％) 0 90 10 1 90 10 15 0 100 17 0 100 17.1 90 10 20 90 10

[0116] 2. Experimental results:

[0117] Base peak chromatograms of different samples in positive and negative ion modes are shown in Figure 2. Figure 8 As shown in Table 6, 138 chemical components were identified in the Unfermented sample and 141 chemical components were identified in the P2 sample. The two samples had 125 components in total. The relative quantification of each compound was performed based on the "peak area percentage". There were 72 components with increased relative content in P2 compared with Unfermented, as shown in Table 6. Among them, substances such as calycosin and pterostilbene have been reported to have antihypertensive activity. In other words, the Astragalus fermentation liquid (P2) has certain antihypertensive activity.

[0118] Table 6 Components with increased relative content

[0119]

[0120]

[0121] Example 11 Determination of in vitro antioxidant activity of fermented and unfermented Astragalus extracts

[0122] 1. Determination of DPPH free radical scavenging ability:

[0123] 1.1 Experimental methods:

[0124] Prepare the sample solution in advance, that is, dilute the fermented astragalus broth (P2) and the unfermented astragalus extract (Unfermented) prepared in Example 2 with water to a series of concentrations, and prepare a series of concentrations of vitamin C aqueous solution (positive standard, as a reference) for use. Prepare a diphenyl picroyl radical (DPPH) solution with a concentration of 0.2mmol / L with anhydrous ethanol and store it in a dark place. Take 100μL of sample solutions of different concentrations and mix them with 100μL of DPPH solution, keep it in a dark place at room temperature for 30min, and measure the absorbance (A) at 517nm. i ) 100 μL of sample solution of different concentrations was mixed with 100 μL of anhydrous ethanol solution, and the mixture was kept at room temperature in the dark for 30 min. The absorbance (A j ) 100 μL of anhydrous ethanol solution was mixed with 100 μL of DPPH solution, and the mixture was kept at room temperature in the dark for 30 min. The absorbance (A0) was measured at 517 nm. The scavenging rate of the sample for DPPH free radicals was calculated according to the following formula. Three samples were run in parallel for each group, and the average value was taken.

[0125]

[0126] 1.2 Experimental results:

[0127] The results are as follows Fig. 9 As shown in A, the scavenging effects of Unfermented and P2 on DPPH free radicals increased with the increase of concentration. It can be found that the scavenging effect of fermented Astragalus on DPPH free radicals is better than that of unfermented Astragalus.

[0128] 2. Determination of Hydroxyl Radical Scavenging Ability

[0129] 2.1 Experimental methods:

[0130] Prepare the sample solution in advance, that is, dilute the Astragalus fermented liquid (P2) and the unfermented Astragalus extract (Unfermented) prepared in Example 2 with water to a series of concentrations, and prepare a series of concentrations of vitamin C aqueous solution for use. Mix 1.0mL of sample solution or vitamin C aqueous solution with 1.0mL 8.8mmol hydrogen peroxide aqueous solution, 1.0mL 9mmol ferrous sulfate aqueous solution and 1.0mL 9mmol / L salicylic acid-ethanol solution, and incubate the reaction solution at 37°C for 30min. Using distilled water as a control, detect the absorption value of the reaction solution at 510nm, and use vitamin C as a positive control. Take sample reaction solutions of different concentrations and measure the absorbance at 510nm as A1; the control group reaction solution with distilled water instead of the sample solution is measured at 510nm as A0. Each group of samples has 3 parallels and the average value is taken. The calculation formula for the scavenging ability of the sample for hydroxyl free radicals is as follows:

[0131]

[0132] 2.2 Experimental results:

[0133] The results are as follows Fig. 9 As shown in B, the scavenging effect of Unfermented and P2 on hydroxyl radicals increased with the increase of concentration, and the scavenging effect of P2 on hydroxyl radicals was better than that of Unfermented, indicating that the scavenging effect of fermented Astragalus on hydroxyl radicals was better than that of unfermented Astragalus.

[0134] 3. Determination of iron ion reducing ability

[0135] 3.1 Experimental methods:

[0136] 10mM TPTZ solution, 20mM FeCl3 solution and acetate buffer (0.3M, pH 3.6) dissolved in 40mM HCl solution were mixed in a volume ratio of 1:1:10 to obtain FRAP working solution, and then placed at 37°C for use. Take 50μL of fermentation samples of different concentrations (preparation method is the same as above 1.1), add 150μL of FRAP solution and incubate at 37°C for 15min, and measure the absorbance at 593nm. Each group of samples has 3 parallels and the average value is taken. The reducing ability of the sample is compared by absorbance. The larger the absorbance value, the stronger the reducing ability of the sample.

[0137] 3.2 Experimental results:

[0138] The results are as follows Fig. 9As shown in C, the iron ion reducing ability of Unfermented and P2 increased with the increase of concentration, and the iron ion reducing ability of P2 was better than that of Unfermented, indicating that the iron ion reducing ability of fermented Astragalus was better than that of unfermented Astragalus.

[0139] Based on the above experimental results, whether it is DPPH free radical scavenging ability, hydroxyl free radical scavenging ability or iron ion reduction ability, the fermented Astragalus has better effects than the unfermented one, indicating that fermentation can enhance the in vitro antioxidant activity of Astragalus.

[0140] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A strain of Lactobacillus plantarum, characterized in that: The name is Lactiplantibacillus plantarum WH-P2, the preservation number is GDMCC No: 65436, and it was deposited on November 7, 2024 at the Guangdong Provincial Microbiological Culture Collection Center on the 5th floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. Application of the plant lactobacillus according to claim 1 in astragalus fermentation.

3. A method for preparing an astragalus fermented liquid having an activity for improving hypertension, characterized in that: The following steps are involved: S1. Drying, crushing and sieving the raw material of Astragalus to obtain Astragalus powder; then mixing the Astragalus powder with water, extracting under ultrasonic conditions, centrifuging after extraction, taking the supernatant, sterilizing, and obtaining an Astragalus extract; S2. Inoculating the plant lactobacillus described in claim 1 into the astragalus extract for fermentation and culturing. After the fermentation is completed, centrifuging and taking the supernatant to obtain the astragalus fermentation liquid having the activity of improving hypertension.

4. The method according to claim 3, characterized in that: The solid-to-liquid ratio of the astragalus powder to water in step S1 is 1 g: 5-20 mL; The inoculum size of Lactobacillus plantarum in step S2 is 2.0±0.4×10 7 CFU / mL.

5. The method according to claim 3, characterized in that: The ultrasonic conditions described in step S1 are: ultrasonic treatment at 35-45°C and 40kHz for 1-3h; The fermentation conditions in step S2 are: fermentation at 37±1° C. for 12 to 36 hours.

6. The method according to claim 3, characterized in that: In step S2, the inoculated Lactobacillus plantarum is a Lactobacillus plantarum seed solution, which is prepared by the following method: inoculating a single colony of Lactobacillus plantarum into a culture medium, culturing it at 37±1°C for 16-18h, then transferring it to a fresh liquid culture medium, culturing it at 37±1°C for 16-18h, and obtaining a Lactobacillus plantarum seed solution; The culture medium is MRS culture medium.

7. The method according to claim 3, characterized in that: The sieving in step S1 is sieving through a 60-80 mesh sieve; The centrifugation conditions described in steps S1 and S2 are: 4°C, 10000-15000 rpm for 10-20 min; The sterilization conditions described in step S1 are: sterilization at 121° C. for 10 to 20 minutes.

8. An Astragalus fermented liquid having activity in improving hypertension, characterized in that: It is prepared by the method according to any one of claims 3 to 7.

9. Use of the Lactobacillus plantarum according to claim 1 and / or the Astragalus membranaceus fermentation liquid according to claim 8 in the preparation of a product for preventing or treating hypertension.

10. The use according to claim 9, characterized in that: The products for preventing or treating hypertension include functional foods, health products or drugs for preventing and treating hypertension, improving hypertension and inhibiting angiotensin converting enzyme.

Images