Genetically engineered bacterium for producing and preparing valerolactone as well as preparation method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for producing and preparing valerolactone as well as a preparation method and application of the genetically engineered bacterium. According to the invention, carboxylic acid reductase and acyl coenzyme A dehydrogenase in an original strain are inactivated at the same time to obtain a genetically engineered bacterium; the genetically engineered bacterium is inoculated into a culture medium taking sterol as a substrate for fermentation culture, and the genetically engineered bacterium can be used for converting the sterol to generate the valerolactone. The genetic engineering strain for producing and preparing the valerolactone can stably accumulate products, the accumulation amount of by-products is reduced, the highest molar yield of the obtained valerolactone (HIL) reaches 90.68%, the purity of the HIL can reach 99% or above, and the molar conversion rate of raw materials is higher than 90%; 21.98 g / L of valerolactone can be obtained by taking 50 g / L of sterol as a substrate, and the method has important application value and significance.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and biochemical engineering, and specifically relates to a genetic engineering strain for producing glutathione, and a preparation method and application thereof. Background Art

[0002] Steroidal compounds (abbreviated as steroids, Steroids), also known as steroid compounds, are lipid compounds with cyclopentane polyhydrophenanthrene as the parent nucleus, which are widely present in animals, plants and microorganisms. The parent nucleus of the steroid molecule is composed of three closed six-membered rings (A, B, C rings) and a five-membered ring (D ring). The parent nucleus usually contains multiple substitution sites, and the substituents, double bond positions or stereo configurations at different positions are diverse, so that steroid compounds can have a series of unique physiological functions. Steroid drugs have broad application prospects and are currently widely used in the treatment of tumors, inflammation, allergies and other diseases. Steroid hormone drugs have become the second largest class of drugs after antibiotics.

[0003] At present, the popular process of steroid drug synthesis tends to first use microbial metabolism to produce steroid drug intermediates, and then synthesize the final drug through chemical modification. Phytosterols are widely used as raw materials for microbial metabolism of steroids due to their low cost and easy availability. At present, there are many studies on the production of steroid side chain degradation intermediates by microbial metabolism regulation, but there are relatively few studies on key intermediates of steroid nucleus ring-opening metabolism, such as 3aα-H-4α-(3′-propionic acid)-7aβ-methylhexahydro-1,5-indanedione (HIP) and 3aα-H-4α-(3'-propionic acid)-5α-hydroxy-7aβ-methylhexahydro-1-indanedione-δ-lactone (valley lactone or HIL). Their special ring-opening structure is crucial for the synthesis of various steroid drugs with or without α-methyl at the C10 position.

[0004] HIL, CAS No. 64053-02-7, is a 3aα-H-4α-(3'-Propionic acid)-5α-hydroxy-7aβ-methylhexahydro-1-indanone-δ-lactone (hereinafter referred to as HIL, CAS No. 64053-02-7). Figure 1 It is an important C10-demethylated steroid drug intermediate. HIL can be used as a precursor to synthesize steroid hormone drugs without β-methyl at C10, such as progesterone and estradiol.

[0005] At present, there are few studies on the degradation of steroid nucleus ring opening. There is no efficient microbial transformation of important intermediates of steroid nucleus ring opening, such as the A-ring opening product glutamic acid lactone (HIL), and the key genes of steroid nucleus ring opening degradation need to be further identified. Therefore, it is an urgent need for the steroid pharmaceutical industry to construct efficient and specific strains that can convert sterols to produce glutamic acid lactone (HIL). Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a genetically engineered Mycobacterium fortuitum and its use and method for producing 3aα-H-4α-(3'-propionic acid)-5α-hydroxy-7aβ-methylhexahydro-1-indanone-δ-lactone (valerolactone or HIL) to solve the problems in the prior art.

[0007] To achieve the above objectives and other related objectives, the present invention is achieved through the following technical solutions.

[0008] In a first aspect of the present invention, a genetically engineered bacterium is provided, wherein the genetically engineered bacterium is a glutamylactone-producing actinomycete in which carboxylic acid reductase and acyl-CoA dehydrogenase are inactivated.

[0009] In certain embodiments, the genetically engineered bacteria are glutamylactone-producing actinomycetes in which the carboxylic acid reductase encoding gene and the acyl-CoA dehydrogenase encoding gene are knocked out.

[0010] In certain embodiments, the carboxylic acid reductase encoding gene includes a carboxylic acid reductase car1 gene and a carboxylic acid reductase car2 gene.

[0011] In certain embodiments, the acyl-CoA dehydrogenase encoding gene includes an acyl-CoA dehydrogenase fadE30 gene, an acyl-CoA dehydrogenase fadE31 gene, an acyl-CoA dehydrogenase fadE32 gene, and an acyl-CoA dehydrogenase fadE33 gene.

[0012] In certain embodiments, the sequence of the carboxylic acid reductase car1 gene is:

[0013] A1) the nucleotide sequence shown in SEQ ID NO.1 or its degenerate sequence;

[0014] A2) A nucleotide sequence that has more than 60% homology with SEQ ID NO.1 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.1.

[0015] In certain embodiments, the sequence of the carboxylic acid reductase car2 gene is:

[0016] B1) the nucleotide sequence shown in SEQ ID NO.2 or its degenerate sequence;

[0017] B2) A nucleotide sequence that has more than 60% homology with the nucleotide sequence shown in SEQ ID NO.2 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.2.

[0018] In certain embodiments, the sequence of the acyl-CoA dehydrogenase fadE30 gene is:

[0019] C1) the nucleotide sequence shown in SEQ ID NO.3 or its degenerate sequence;

[0020] C2) A nucleotide sequence that has more than 60% homology with SEQ ID NO.3 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.3.

[0021] In certain embodiments, the sequence of the acyl-CoA dehydrogenase fadE31 gene is:

[0022] D1) the nucleotide sequence shown in SEQ ID NO.4 or its degenerate sequence;

[0023] D2) A nucleotide sequence that has more than 60% homology with SEQ ID NO.4 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.4.

[0024] In certain embodiments, the sequence of the acyl-CoA dehydrogenase fadE32 gene is:

[0025] E1) the nucleotide sequence shown in SEQ ID NO.5 or its degenerate sequence;

[0026] E2) A nucleotide sequence that has more than 60% homology with the nucleotide sequence shown in SEQ ID NO.5 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.5.

[0027] In certain embodiments, the sequence of the acyl-CoA dehydrogenase fadE33 gene is:

[0028] F1) the nucleotide sequence shown in SEQ ID NO.6 or its degenerate sequence;

[0029] F2) A nucleotide sequence that has more than 60% homology with the nucleotide sequence shown in SEQ ID NO.6 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.6.

[0030] The term "homology" in the present invention refers to the percentage of identity between two nucleotides. Homology refers to the degree of identity with a given nucleotide sequence and can be expressed as a percentage. In the disclosure of the present invention, homologous sequences having the same or similar activity as a given nucleotide sequence can be represented by "homology %". The homology between sequences from one part to another can be determined by techniques known in the art. For example, standard software for calculating parameters such as scores, identity and similarity can be used. For example, the 60% homology used in the present invention refers to a sequence identical to the 60% sequence identity determined by a clear algorithm, and thus the homologs of a given sequence have greater than or equal to 60% sequence identity over the length of the given sequence. Among them, the homology referred to in the present invention includes but is not limited to inserting, replacing, deleting one or more nucleotide fragments in a nucleotide sequence; the homology can also be more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 96%, more than 97%, more than 98% or more than 99%.

[0031] In certain preferred embodiments, the actinomycetes are Rhodococcus, Nocardia or Mycobacterium.

[0032] In a preferred embodiment, the starting strain of the genetically engineered bacteria is Mycobacterium fortuitum.

[0033] In a preferred embodiment, the starting strain of the genetically engineered bacteria is Mycobacterium fortuitum ATCC 6842.

[0034] In certain embodiments, the inactivation is to inhibit the activity of genes and / or proteins by using gene and / or protein inhibitors. For example, gene inhibitors refer to molecules that have an inhibitory effect on genes. Having an inhibitory effect on genes includes: inhibiting the expression or activity of genes. Wherein inhibiting gene activity refers to reducing the activity of genes and reducing the biological function of genes. Preferably, the activity of genes decreases by at least 10% compared to before inhibition, for example, by at least 30%, 50%, 70% or 90%.

[0035] Inhibiting gene expression may be inhibiting the transcription or translation of the gene. Specifically, it may mean: preventing the gene from being transcribed, or reducing the transcriptional activity of the gene, or preventing the gene from being translated, or reducing the translation level of the gene.

[0036] Those skilled in the art can use conventional methods to regulate gene expression, such as one or more of gene knockout, homologous recombination or interfering RNA. Preferably, the method is homologous recombination.

[0037] The present invention also provides a method for preparing the aforementioned genetically engineered bacteria, which comprises knocking out the carboxylic acid reductase gene and the acyl-CoA dehydrogenase gene of a starting strain of the genetically engineered bacteria to prepare the aforementioned genetically engineered bacteria.

[0038] In certain embodiments, the preparation method comprises the following steps:

[0039] 1) PCR amplified the upstream and downstream homology arm fragments of carboxylic acid reductase and acyl-CoA dehydrogenase genes, connected the upstream and downstream homology arm fragments with the knockout vector, and constructed a recombinant knockout plasmid;

[0040] 2) The above-mentioned recombinant knockout plasmid is introduced into the starting strain, and the obtained strain is verified by resistance screening and PCR to be the genetically engineered bacteria as described above.

[0041] In certain embodiments, the primer sequences involved in the PCR amplification include one or more of the following:

[0042] car1,2-up-F:gaatacataggatccgtcgacgtgatcgtgctgtcctgc (SEQ ID NO.7);

[0043] car1,2-up-R:ctgcggtacggaacacgtcgggcacgtctacggaggcg (SEQ ID NO.8);

[0044] car1,2-down-F:cgcctccgtagacgtgcccgacgtgttccgtaccgcag (SEQ ID NO.9);

[0045] car1,2-down-R:gttgccattgctgcagcttaaggttgaccggcccgctg (SEQ ID NO. 10);

[0046] fadE30-up-F:aatacataggatccgtcgacagccctcactgtcgatcgcg (SEQ ID NO. 11);

[0047] fadE30-up-R:atggtgtccgatcgcgagaaccccggtccacccaggccct (SEQ ID NO. 12);

[0048] fadE30-down-F:agggcctgggtggaccggggttctcgcgatcggacaccat (SEQ ID NO. 13);

[0049] fadE30-down-R:agcttaagactagtcacgtgggacaatgtcgtcggatcga(SEQ ID NO.14);

[0050] fadE31-up-F:agaatacataggatccgtcgacaggcgattcgggtgaggt(SEQ ID NO.15);

[0051] fadE31-up-R:aggccttcggtccagtggtcctgctcgaaaccctcaa(SEQ ID NO.16);

[0052] fadE31-down-F:ttgagggtttcgagcaggaccactggaccgaaggcct(SEQ ID NO.17);

[0053] fadE31-down-R:tgccattgctgcagcttaagcgaacagctttcgtgccg(SEQ ID NO.18);

[0054] fadE32-up-F:cgtcgaccacgtgactagtccgcgacttcctggcggcgaacc(SEQ ID NO.19);

[0055] fadE32-up-R:gtgttcctgggtgaacccgatggcgcccggtccggtgtca(SEQ ID NO.20);

[0056] fadE32-down-F:tgacaccggaccgggcgccatcgggttcacccaggaacac(SEQ ID NO.21);

[0057] fadE32-down-R:ttgccattgctgcagcttaagtgccgtcggtgccccggcg(SEQ ID NO.22);

[0058] fadE33-up-F:ccgtcgaccacgtgactagtccgagttggtcgaccactggaccg(SEQ IDNO.23);

[0059] fadE33-up-R:tcccaggtgatcgcgataccccacagcttctcgtcgtagccgc(SEQ IDNO.24);

[0060] fadE33-down-F:gcggctacgacgagaagctgtggggtatcgcgatcacctggga(SEQ IDNO.25);

[0061] fadE33-down-R:gttgccattgctgcagcttaagccgccccgttgggtgtcg (SEQ ID NO. 26).

[0062] The present invention also provides the use of the aforementioned genetically engineered bacteria in producing glutamic acid lactone:

[0063] The invention also provides the use of carboxylic acid reductase and acyl-CoA dehydrogenase inhibitors in improving the glutamate lactone production of actinomycetes.

[0064] In certain embodiments, the carboxylic acid reductase and acyl-CoA dehydrogenase are carboxylic acid reductase and acyl-CoA dehydrogenase in actinomycetes.

[0065] In certain embodiments, the inhibitors of carboxylic acid reductase and acyl-CoA dehydrogenase include agents that inhibit the expression of carboxylic acid reductase and acyl-CoA dehydrogenase genes and / or proteins; for example, they may inhibit the transcription or translation of genes, specifically, they may mean: preventing the gene from being transcribed, or reducing the transcriptional activity of the gene, or preventing the gene from being translated, or reducing the translation level of the gene.

[0066] In certain embodiments, the inhibitor includes a constructed vector of a knockdown or knockout system of carboxylic acid reductase and acyl-CoA dehydrogenase encoding gene, a small molecule compound, dsRNA, shRNA, microRNA, siRNA, etc.

[0067] The fourth aspect of the present invention provides a method for preparing glutolactone, comprising the following steps: using the genetically engineered bacteria as described above to convert sterols into glutolactone.

[0068] In certain specific embodiments, the preparation method comprises: inoculating the seed liquid of the genetically engineered bacteria as described above into a fermentation medium for fermentation culture to obtain glutathione.

[0069] In certain embodiments, the seed liquid of the genetically engineered bacteria as described above is obtained by inoculating the genetically engineered bacteria as described above into a seed culture medium for cultivation.

[0070] In certain embodiments, the culture conditions for inoculating into the seed culture medium are 30-40° C., 200-300 rpm and culturing for 1-3 days.

[0071] In certain embodiments, the seed culture medium components include: 2-8 g / L yeast powder, 5-15 g / L sodium chloride, 5-15 g / L peptone, and 1-3 g / L Tween; the yeast powder content can also be 3-7 g / L, or 2, 3, 4, 5, 6, 7 or 8 g / L; the sodium chloride content can also be 8-12 g / L, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 g / L; the peptone content can also be 8-12 g / L, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 g / L; the Tween content can also be 1.5-2.5 g / L, or 1, 1.5, 2, 2.5 or 3 g / L.

[0072] In certain embodiments, the Tween may be Tween 20, Tween 40, Tween 60 or Tween 80.

[0073] In certain embodiments, the pH value of the seed culture medium is 6.8-7.2, such as 6.8, 6.9, 7.0, 7.1 or 7.2.

[0074] In certain embodiments, the inoculation amount is 5-15% (v / v), can also be 8-12% (v / v), can also be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15% (v / v).

[0075] In certain embodiments, the fermentation temperature is 25-40°C, or 30-37°C; the fermentation temperature can also be 28°C, 30°C, or 32°C.

[0076] In certain embodiments, the fermentation culture rotation speed is 100-300 rpm, and can also be 150-250 rpm; and can also be 160 rpm, 180 rpm, 200 rpm, 220 rpm or 240 rpm.

[0077] In certain embodiments, the fermentation culture time is 80 to 240 hours, and can also be 100 to 200 hours, or can be 80 hours, 100 hours, 120 hours, 140 hours, 160 hours, 180 hours, 200 hours, 220 hours or 240 hours.

[0078] In certain embodiments, the pH of the fermentation medium is 6-8, or 7-8; or 6, 6.5, 7, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.

[0079] In certain embodiments, the fermentation medium composition includes sterols.

[0080] In certain embodiments, the sterol is selected from one or both of cholesterol and phytosterol.

[0081] In certain embodiments, the fermentation medium composition includes: carbon source 10-30g / L, nitrogen source 5-20g / L, inorganic salt 0-10g / L and sterol 1-50g / L. For example, the content of the carbon source can also be 15-25g / L, or 10, 15, 20, 25 or 30g / L; the content of the nitrogen source can also be 10-15g / L, or 5, 10, 15 or 20g / L; the content of the inorganic salt can also be 0.5-8g / L, or 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10g / L.

[0082] In certain embodiments, the sterol is present at a concentration of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 g / L.

[0083] In some more specific embodiments, the carbon source is selected from one or more of glucose, xylose and molasses.

[0084] In some more specific embodiments, the nitrogen source is selected from one or more of beef extract, beef powder and peptone.

[0085] In some more specific embodiments, the inorganic salt is selected from one or more of sodium chloride, sodium nitrate, diammonium hydrogen phosphate, potassium dihydrogen phosphate, disodium hydrogen phosphate and magnesium sulfate heptahydrate.

[0086] In some more specific embodiments, the concentration of sodium nitrate is 0 to 9 g / L; it can also be 0.1, 1, 2, 3, 4, 5, 6, 7, 8 or 9 g / L.

[0087] In some more specific implementations, the concentration of diammonium phosphate is 0-1 g / L; 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1 g / L.

[0088] In certain embodiments, the fermentation medium further comprises an emulsifier, and the emulsifier is Tween and hydroxypropyl β-cyclodextrin.

[0089] In certain embodiments, the mass ratio of Tween to sterol is 0.05-0.5:1; it may also be 0.1-0.3; it may also be 0.05:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1 or 0.5:1.

[0090] In certain embodiments, the concentration of Tween is 0.05-25 g / L.

[0091] In certain embodiments, the mass ratio of hydroxypropyl β-cyclodextrin and sterol is (0.5-4):1; it can also be 1-3:1; it can also be 3-4:1; it can also be 2-3.5:1; it can also be 0.5:1, 1:1, 1.5:1, 2:1, 2.5:1, 3:1, 3.5:1 or 4:1.

[0092] In certain embodiments, the concentration of the hydroxypropyl β-cyclodextrin is 0.5 to 200 g / L.

[0093] Beneficial effects:

[0094] The invention provides a genetically engineered bacterium for producing 3aα-H-4α-(3'-propionic acid)-5α-hydroxy-7aβ-methylhexahydro-1-indanone-δ-lactone (valley lactone or HIL). The genetically engineered bacterium is obtained by simultaneously inactivating carboxylic acid reductase and acyl-CoA dehydrogenase in a starting strain; and then the genetically engineered bacterium is inoculated into a culture medium with sterol as a substrate for fermentation culture, so that the genetically engineered bacterium can convert sterol to produce 3aα-H-4α-(3'-propionic acid)-5α-hydroxy-7aβ-methylhexahydro-1-indanone-δ-lactone (valley lactone or HIL). The genetically engineered strain used for producing and preparing HIL of the present invention can stably accumulate products and reduce the accumulation of by-products. The molar yield of the obtained glutamic acid lactone (HIL) can reach up to 90.68% at the highest, the purity of HIL can reach more than 99%, and the molar conversion rate from raw materials to final products is higher than 90%. 21.98g / L glutamic acid lactone can be obtained by taking 50g / L phytosterol as a substrate, which has important application value and significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] Figure 1 Shown is the structural formula of the product glutolactone HIL of the present invention.

[0096] Figure 2 Shown are the gas chromatography detection results of metabolites obtained by fermenting phytosterols by the wild-type M. fortuitum ATCC 6842 of the present invention and the genetically engineered bacteria ΔcarΔfadE30, ΔcarΔfadE30-31, ΔcarΔfadE30-32, and ΔcarΔfadE30-33 obtained in Example 3, respectively.

[0097] Figure 3Shown are the gas chromatography detection results of the metabolites obtained by fermenting phytosterols by the genetically engineered bacteria ΔcarΔfadE30-31-32, ΔcarΔfadE30-31-33, ΔcarΔfadE30-32-33, and ΔcarΔfadE30-31-32-33 obtained in Example 3 of the present invention.

[0098] Figure 4 It is a curve chart showing the change of the yield of glutamic acid HIL obtained by fermenting different concentrations of phytosterols by the genetically engineered bacteria in Example 4 of the present invention over time. DETAILED DESCRIPTION

[0099] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0100] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0101] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0102] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques are well described in the literature, see Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; these series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATINSTRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.

[0103] Example 1: Construction of gene knockout plasmid using homologous recombination

[0104] In this example, gene homologous recombination was used to perform gene editing on Mycobacterium.fortuitum ATCC 6842. The specific principle is described in the literature “Parish T, Stoker NG. Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology. 2000, 146: 1969-75”.

[0105] In order to simplify the knockout plasmid construction steps, the inventors first combined the plasmids p2NIL and pGoal19 into a knockout plasmid pKADel. For details of the specific steps, please refer to the patent document: CN 202310039555.6.

[0106] The genes encoding carboxylic acid reductase (car1 and car2) are shown in SEQ ID NO:1 and SEQ ID NO:2, and the genes encoding acyl-CoA dehydrogenase (fadE30, fadE31, fadE32 and fadE33) are shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.

[0107] SEQ ID NO:1(car1):

[0108] atgaccaccgaaacgcgtgaagaccggttgcaacgccggatcgcacacctgtatgaagccgactcacagttcgccgcggcccgtcccagcgagg

[0109] ctgtcaacaccgccgtcgccgagcccgagctgcggttgccggctgtcgtcaaaggcgtgttcgccggctacgccgaccgtcccgcgctgggaca

[0110] gcgcgccgtcgagtacgtcaccgacgccgacggccgcacgtcggcccagctgctcccccggttcgacaccatcacgtaccgccagttgggcgac

[0111] cgcgtccaagcggtgaccaacgcctggcacaaccacccggtgaagcccggcgaccgcgtcgccatcctggggttcaccagcgtcgactacacca

[0112] ctgtcgacaccgcgctgatcgaactcggtgccgtatcggtgccgctgcagaccagtgcgccggtaaccaccctgcgccccatcgtcgccgagacg

[0113] gaaccgaccgtgatcgcggcgagcatcgacttcctcgacgacgcggtcgaactggtgaagtccggccctgcaccccggcgcctggtggtgttcga

[0114] ctaccgcccgcgggtcgacgctcagcgtgaagccttcgaagccgccaaggccgcactggccggcaccgatgtcgtcgtcgaaccgctggccga

[0115] cgtcctcgaccgcggccgctcactggccgacgcaccgctgtacacccccggtcagcccgacccgctgaccatgctgatctacacctccggcagca

[0116] ccggcacccccaagggcgcgatgtacccggagagcaaggtcgccaacatgtggcagctggccaccaaggccacctgggacgagaatcaggcg

[0117] gcgctgccggcgatcaccctcaacttcatgccgatgagccacgtcatgggccgcggcatcttgatcggcacgctgagctccggtggcaccgcgtat

[0118] ttcgctgcgcgcagcgacctttcgaccttcctggaggacctagccctggtccggcccacgcagctgagcttcgtgccccggatctgggacatgctgt

[0119] ttcaggagtaccagagccggttggatcgcagcggagcaccggaagacgaagtcctcgccgaggttcgccaggacctgctgggcgggcggttcgt

[0120] ctccgcgatgaccggttccgcgccgatctcggcggagatgaagaactgggtggagcgcctgctcgacatgcacctgctggagggctacggctcc

[0121] accgaggcaggttcggtcttcgtcgacggccacatccagcgcccgccggtgatcgactacaagttggtcgacgtgccggacctgggctacttcctt

[0122] accgaccggccccacccgcgtggtgagctgctggtgaagtccgagcagatgttccccgggtactacaagcgcccggagatcaccgccgagatgt

[0123] tcgacgaggacggctactaccgcaccggtgacatcgtcgccgaactcggaccagaccaggtcgaatacctcgaccggcgcaacaacgtgctgaa

[0124] gctctcgcagggcgaattcgtcaccgtctccaagctggaggccgtcttcggagacagcccgctggtacggcagatcttcgtctacggcaacagcgc

[0125] ccgctcgtatctgctggccgtcgtggtgccgaccgatccgtccctgtcgaagcaggcgatcggcgattcactgcaggacgccgcgcgggccgcg

[0126] ggtctgcagtcctacgagatcccacgcgatttcatcgtcgagacaacgcccttcagcctggagaacggcctgctgaccggcatccgcaagctggct

[0127] cggccgaatctgaaggcctactacggcgatcggttggagcagctttacacggagctggccgagggtcaggccaatgaactgagcgagctgcggc

[0128] gcaacggcgcccaggccccggtgctcgacacggtgagccgggccgcaggtgccctgctgggtgccgcggcatccgacctcgcccccgaggcc

[0129] cacttcaccgatctgggtggagattcgttgtcggccttgaccttcggaaacctcctgcaggagatcttcgacgtcgaggtgccggtgtcggcgatcgt

[0130] cagcccggcctcggatcttcggaccatcgccgagtacatcgaggctcaacgctcgggcgccgatgtgcggccgaccttcacgtcggtgcacggc

[0131] cgcaacgcgaccgaagtccacgcatccgatctgacgctggacaaattcatcgacgccgcgacattggccgccgcaccgagcctgccgggcccg

[0132] gtcagtgagatccgtaccgtactgctcaccggcgcaaccggattcctgggtcgctacttggccctggagtggctggaacggatggacctggtcgac

[0133] ggcaaggtcatctgcctggtgcgcgcgaagtcggacgaggaagcccgcgcgcggctcgacaagaccttcgacagcggcgaccccaagctgtgg

[0134] gcgcactaccagaaactggccgccgaccatctcgaagtgatcgccggcgacaagggcgaggccgatctcgggctcgaccaagtgacctggcag

[0135] cgtctggccgacaccgtcgatttcatcgtcgacccggccgcactggtcaaccacgtgctgccctacagcgaactgttcggccccaacgcacttggc

[0136] actgctgagctcatccggatcgcgctcaccacgcgcatcaagccgttcgcgtacgtgtcgacgatcggcgtgggcggcggtatcgagccaggaaa

[0137] gttcgtggaggccggggatattcgagccatcagtccggttcgacgcgtcgacgacggctacgccaacggctacggcaacagcaagtgggccggc

[0138] gaggtgctactgcgcgaagcgcacgatctggccgggctgccggtgacggtgttccgctgcgacatgatcctggcggacaccacctacgccgggc

[0139] agttgaacctgccggacatgttcacccgcatgatgttcagcctcgtcgccaccggtgtcgcaccgaagtccttcaaccagctcgacgccgacggca

[0140] accgacagcgctcgcactacgacgggctgcccgtcgagttcatcgccgaggccatctcaaccctgggcgcccacgtccaggacggcttcgagac

[0141] gtaccacgtgatgaacccgcacgacgacggcatcggcatggacgagttcgtcgactggctcatcgaggccggctacccgatccagcgagtggag

[0142] gactaccaggagtggttggcccgcttcgagaccacgctgcgggcactgcccgacaagcaacgtcaggcctcgctgctgccgctgctgcacaacta

[0143] ccagcagcccggcgtgccggtgaacggcgcgatggcaccgaccgacgtgttccgtaccgcagtgcaggacgcgaagatcgggcccgacaaggacatcccccatgtcagccgggaggtcatcgtcaagtacatcagcgatctgaaactgctcggattgctgtaa;

[0144] SEQ ID NO:2(car2):

[0145] atgtcgtttgatactcgcgatgagcaactggcgacccgtatcgccgatctgaccgccaccgatccacagttcgccgccgcgataccgagcgacacc

[0146] gtcaccgcctccgtagacgtgcccggcctgcttctgcccgagatcgtgcagagggttctggagggctacgccgaacggcccgcgctcggcgagc

[0147] gcgcgctcgaattcgtggccgaccctgccacggggcgcaccactgctcgcctgctcccccggttcgacaccatcagctacggccaggtgtgggac

[0148] cgggtgcgcgccctcgccgcagcgctgcacgcctcgggcgtcgcagccggcgaccgggtcgcgatcctgggtttcaccagtgctgactacaccg

[0149] tgatcgacacggcgctcggccagatcggcgcggtgtcggtgcccctgcagaccagctcctcgcccgaggcgctggcgccgatcgtgaccgaga

[0150] ccgagcctcgggtgatcgcggcgagtgtcgaccacctcgccgatgccgtcgagctcgcgctcaccgctcacgctccggcccaactcgtcgtcttc

[0151] gaccaccaccccgagatcgatgaccatcgcgaggccgtggcatcggccgccgagaggatcaccgcagcaggcgcatccatcgccgtcgacacg

[0152] ctggccggactgctggaccgcggaagcaacctcccggcacccgaggcgcccaaggcggacggctccgaccccttggcgttgctgatctacacct

[0153] ccggcagcaccggcgctcccaagggcgcgatgtacctgcagagcgccgtggccaagttctggcgtcgcaacagcaaggcctggctcgggccgg

[0154] tcagctcggcgatcaacctgagcttcatgccgatgagccacgtgatgggccgcggcatcctgtatgcctcgctcgccgccggcggcacctgctact

[0155] tcgccgcccgcagcgacctgtcgacactgctggaggacctcgccctgacgcggcccaccgagctgaatttcgtcccacgcgtctgggagatgatc

[0156] cacagcgaatatcagagccgggtcgatcagcgtctggccgagggcggccgggaccgtgaggccgtcgaagcggaggtgttggccgaggtccg

[0157] cgacaaggtgctcggcggccgcttcgtcgccgccatgaccggctcggcacccatctcagccgagctcaagacctggacccaggacatgctcggc

[0158] atccacctgctggagggctacggctcgaccgaagccggcatggcactgttcgacggtgtcgtgcagcgtccgccggtgatcgactacaagttggtc

[0159] gacgtcccggacctcgggtacttcggcaccgaccagcctcacccgcgcggcgagttgctgatcaagaccgagaacctgttccccggctactacaa

[0160] gcgtcccgaggtcaccgcgtcggtgttcgacgaggacggcttctaccgcaccggtgacgtcgtcgcagagatcggcccggaccagctgcgctac

[0161] gtcgaccggcgcaacaacgtgctcaagctcgcccagggcgagttcgtcaccctggccaagctggaagccgtgttcggcaacagtccactggtgca

[0162] acagatctacgtctacggcaacagcgcccagccctacctgctggccgtcgtggtacccacggatccgagcgtttccaaagaggcgatcgccgagt

[0163] ccctgcaagaggtggcccgggaggccgacctgcagtcctacgagatcccgcgcgacttcatcgtggagacaacaccgttcagcctcgagaacgg

[0164] tctgctgaccggtatccgcaagctggcgtggccgaagttgaaggcgcactacggcgagcggctcgagcagctgtatgccgagctggccgagacg

[0165] caggccgccgaacttcgcgagttgcgttcggcgagtgccgacgcccccgtggtggaaaccgtcagccgggctgccggtgccctgctgggcgcc

[0166] gcggcatccgacctggggcctgacgcccacttcaccgacctgggtggggattccttgtcggcgttgaccttcggcaacctgcttcgggagatcttcg

[0167] atgtggatgtgccggtgggcgtgatcgtcagcccggccaccgacctggccggcatcgccgagtacatcgagacccagcgcagcggatccaagc

[0168] gcccgacctacgcgtcggtgcacggcaggcacgccgccgaagtcagtgcggccgacctgaccctggacaagttcctcgacgccgacaccctgg

[0169] ccgccgcaccgaacctgcccaaggcaggcagcgaggttcggaccgtgctgctcaccggcgccaccggcttcctcggccgctacttggcgctgga

[0170] atggctggagcgcatggacctggtcgacggcaaggtcatcgcgctggtgcgcgccaagtccgacgaggaggcccggacccggctcgacgccac

[0171] cttcgacagcggtgacgcgaaactccttgcgcactaccagaatctggccgctgaccacctcgaagtggttgccggcgacaagggcgaggagaac

[0172] ctcggcctggatcagcagacctggcagcggctcgccgacgaggtcgacctgatcgtcgacccggccgcactggtcaaccacgtgctgccctaca

[0173] gcgaactgttcggccccaacgcactgggcaccgccgagctgatcaagatcgcgctcaccacgaagatcaagccgtacacctacgtgtcgaccatc

[0174] ggcgtcggcgatcagatcgagcccgggaagttcgtcgagaacgtcgacgtccgggagatgagtgcggtccgcaagatcaacgatgggtacgcca

[0175] acggttacggcaacagcaagtgggcgggtgaggttttgctgcgcgaggccaacgatctgtgcgggctgccggtcgcggtgttccgctgcgacatg

[0176] atcctggccgacacctcctactcgggccagctgaacttgccggacatgttcacccgcatgatgctgagcctcgtcgccagcggtatcgcgccgaag

[0177] tccttctacgagctggattccgaaggcaaccgccagcgctcacattacgacggtctgcccgtcgagttcatcgccgagtcgatctcgacgttgggcg

[0178] ggcaatcggtcgagagcttcgagacctaccacgtgatgaacccgtacgacgacggcctcggcatggacgagttcgtcgactggctcatcgaggcc

[0179] ggctacccgatcgagcgcatcgaggattacgggcagtgggtccagcgcttcgagagcaccttgcgcgccctgccggacaagcagcgtcaggcgt

[0180] cgctgttgccgctgctgcacaactaccagaagcccgagcggccgatgctgggcgccctggcgcccacggaccacttccgtgcggcggtgcaggaagccaagatcgggcccgacaaggacattccccatgtcagcccggcagtgatcgtcaagtacatcaccgacctgcagcagctcggcctgctctag;SEQ ID NO:3(fadE30):

[0181] Gtgatagaggtccaggagttccgggccgaggtccggcagtggctcgcagacaatctcgttggcgaattcgcagcgctcaagggcctgggtggac

[0182] cggggcgtgaacacgaagccttcgaagagcgtcgggcgtggaatcagcatctggccgcggcggggctgacctgcctcggctggccggtggagc

[0183] acggcggccgcgggctgtcggtcgcgcatcgcgtcgccttctatgaggagtacgcgcgcgcgaacgcacccgacaaggtcaaccacctgggcg

[0184] aggaactgctcgggccgacgctcatcgagtacggcaccccggagcagcagcagcggttcctgcccaagatcctcgacgtcaccgagctgtggag

[0185] ccagggttactcggagcccaacgcgggcagtgacctggccaacgtggcgacgacggccgagctggtcggcgacgaatgggtgatcaacggtca

[0186] gaaggtgtggacgtcgctcgcgcactgggcgcagtggtgcttcgtggtggcgcggacggagaagggctccaagcggcacgccgggctgtcctat

[0187] ctgctggtaccgctggatcagccgggcgtcgagatccgcccgatcatccagctgaccggggactccgagttcaacgaggtgttcttcgacgacgct

[0188] cgtaccgaggcctcgctcgtggtaggccagcccggtgacggctggcgcgtggcaatgggcacgctgacgttcgagcgcggcgtatccacgctcg

[0189] gccagcagatccgctatgcccgtgagcactcgaacctggtcgagctggccaagcgcaccggcgcggccgacgatccgctgatccgccaaaagct

[0190] gaccgagtcgtggaccggcctgcaggccatgcggtcctatgcactggccacgatggacgtcgagcagcccggccaggacaacgtgtcgaagct

[0191] gttgtgggccaactggcatcgcgaactcggcgagatcgccatggacgtgcagggcatggccgggctgacgctgcccgagggcgagttcgacga

[0192] gtggcagcggctgtacctgttctcgcgatcggacaccatctacggcgggtccaacgaaatccagcgcaacatcatcgccgagcgcgtgctcggtctaccccgagaggcaaagggatga;

[0193] SEQ ID NO:4(fadE31):

[0194] Atggacctgacattcgatgacgagaccgaggcctttcgggccgaggtccgcgacttcctggcggcgaaccgggaacacttcccgacgaagtcct

[0195] acgacactcttgagggtttcgagcagcatcgccgttgggacaaggtgcttttcgacgcaggcctgtcggtgatcgcctggcccaaggagtacggcg

[0196] gccgtgacgccaccctgctgcagtgggtggtgttcgaggaggagtacttccacgccggcgctcctgggcgggccagtgccaacggcaccgccat

[0197] gctggcgccgaccctgttcgcgcacggcaccgaagagcagctccagcgcgtgctgccgaagatggccagcggcgaggagatctgggcccagg

[0198] cctggtccgagcccgagtcgggcagcgacctggcctcgctgcgctcaacggccaccaaggtcgacggcggctggaagctcaacggccagaaga

[0199] tctggagctcccgcgcgccgttcggtgagcgcggcttcggacttttccgctccgaccccgaggcccagcgccacaagggtctgacctacttcatgtt

[0200] cgatctgaaggctcccgggatcaccgtgcgcccgatcgctcagctcggcggcgacaccggcttcggcgagatcttcctcgacgacgtgttcgtgcc

[0201] cgacaacgacgtgatcggtggcgtgcacgacggctggcgcgcggccatgagcacgtcgagcaacgagcgcggcatgtcgctgcgcagcccgg

[0202] cgcgcttcctggcgcctgccgaacgtcttgtcgcacagtggaagtccaacccggacccggtcttcaccgatcgcgtcgccgacgcctggatcaag

[0203] gcccaggcctaccggctgcacaccttcggcaccgtcacccgcctggccaatggtggcgagctgggcgccgagtcctcggtgaccaaggtgttctg

[0204] gtctgacctggacgtcgccctgcaccagaccgcgctcgatatgcagggccctgacgccgagttggtcgaccactggaccgaaggcctgctgttcgcccttggcggcccgatctacgcgggcaccaacgagattcagcgcaacatcattgccgagcgccttctcggcctgccccgggagccgaagtga;SEQ ID NO:5(fadE32):

[0205] Gtgaatttcgagattgacgaacagcagcgggacttcgcggccagcatcgatgcggcgctgagcgccgccgacgttccggccgccgtgcgagcct

[0206] ggggcgagggtgacaccggaccgggccgcaaggtgtgggcacagctgaccgacctcggggtgaccgcactgctggtgcccgagaagtacgac

[0207] ggtatcgacgccagccctgtcgatctcgtcgtcgccttggagcgcttgggctattgggccgtcccgggcccggtgaccgaatcgatcgccgtcgca

[0208] ccgattctgctcgccgatgacgaacgggccggcggcctggcctccggcgagctcatcgccaccgtggccatgccgccgcaggcaccgcgcgcc

[0209] gtcaacgccgatttcgccggactgacgctgctggccgccgacggacaggtcggcgacgcgaccgccggagctgctcacgattccgtcgacccgg

[0210] cacgaaagctgttcgacgtcaccgcatccggtgacactcaggctgccgacaccacgcgggcctacgagttcggtgtcctggccaccgccgccca

[0211] gttggtgggcgccggccaggcgatgctggaccagtccgtcgaatacgccaagcagcgcgcgcagttcggccggatcatcggctcgtatcaggcc

[0212] atcaagcacaagctggccgacgtgctgatcgccgtcgagctggcccgcccgctggtctacggcgcggcgctgtcgctggcagagggctcgcccg

[0213] acaccgcacgtgacatcagcgccgccaaggtggccgccgccgatgccgcgctgctggccgcccgttccgcgctgcagacgcacggcgccatcg

[0214] ggttcacccaggaacacgacctgtccctgtcactgctgcgcgtgcaggccctgcgcagcgcctggggcgatccgaccgcacaccgtcgtcgactgctggaggccatctcgtga;

[0215] SEQ ID NO:6(fadE33):

[0216] Gtgagtgaagaacgccaactgctacgcgaaaccgtcgccgcgctggtcgacaaacatgcctcacccgaggccgtgcgcgccgcgatggaatcc

[0217] gagcgcggctacgacgagaagctgtggggcctgctgtgcgagcaggtcggtgcggccgcgctggtggtacccgaggaactcggcggtgccgg

[0218] aggcgaactcgctgacgccgcagtggttctcgaagaactcggcaaggccctggtgccgaccccgctgctgggcaccacactggcagagctcgct

[0219] ctgctggccgccgacgaccacgaaccgctcgaagctctcgccgagggcacctcgatcggcaccgtcgtcttcgacgccgactatgtcgtcaacgg

[0220] agacatcgccgacgtcgtcatcgccgccgacggcgagaacctttcccggtggaccaccttcaccgccacgcccaaatccaccatggatctgaccc

[0221] gccggttgtccgcggtgatccccggtgacaccgctgtcctgggcgccgatcccgggctggccgacaccgcggccctgctgttggccgccgagca

[0222] gatcggtgctgcgtctcgctgcctcgatctcaccgtcgcctacaccaaggaccgggtgcagttcggccggcccatcggcagtttccaggcgctcaa

[0223] gcaccggatggcagatctgtacgtcaaggtgtccgccgcgcgcgcagtcgtcaacgacgccatcgcagatccgtcgcccacgtcggcgtcgctg

[0224] gcgcgctacttcgccagtgaggcgctgtccgcggtgaccgcagaagccatccagatgcacggcggtatcgcgatcacctgggaaagcgacat ccagctgtacttcaagcgcgcgcacggcagtgctcagctgctgggtccgccgcgtcagcatctgcgccggctcgaagccgaggtgttctag.

[0225] The genome of the starting strain Mycobacterium fortuitum ATCC 6842 was used as a template for PCR amplification, and knockout plasmids for inactivating CAR1, CAR2, FadE30, FadE31, FadE32, and FadE33 were constructed as follows:

[0226] The genome of Mycobacterium.fortuitum ATCC 6842 was used as a template for PCR amplification. The upstream and downstream homology arm fragments of the gene to be knocked out were amplified by up-F / R and down-F / R, respectively, and then the amplified upstream and downstream homology arm fragments were connected by Overlap PCR, and finally the connected homology arm large fragment was inserted into the AlfII restriction site of the knockout plasmid pKADel and the connection product was transformed into E.coli DH5α competent cells, coated with Kan and Apr double resistance LB plates (tryptone: 10g / L, yeast extract: 5g / L, sodium chloride: 10g / L, agar: 1.5%, Kan: 50μg / ml, Apr: 50μg / ml), and cultured at 37°C overnight. Single clone colonies were picked for colony PCR to verify the correct bands, and then the plasmids were cultured and extracted for sequencing to ensure that there were no mutations in the plasmid construction. Finally, the knockout plasmids pKAdelΔcar1, car2, pKAdelΔfadE30, pKAdelΔfadE31, pKAdelΔfadE32, and pKAdelΔfadE33 of the car1, car2, fadE30, fadE31, fadE32, and fadE33 genes were obtained.

[0227] The primer sequences used to construct pKAdelΔcar1,car2 are as follows:

[0228] car1,2-up-F:gaatacataggatccgtcgacgtgatcgtgctgtcctgc (SEQ ID NO.7);

[0229] car1,2-up-R:ctgcggtacggaacacgtcggggcacgtctacggaggcg(SEQ ID NO.8);

[0230] car1,2-down-F:cgcctccgtagcgtgcccgacgtgttccgtaccgcag(SEQ ID NO.9)

[0231] car1,2-down-R:gttgccattgctgcagcttaaggttgaccggcccgctg(SEQ ID NO.10);

[0232] Remove the pKAdelΔfadE30 bucket list:

[0233] fadE30-up-F:aatacataggatccgtcgacagccctcactgtcgatcgcg(SEQ ID NO.11);

[0234] fadE30-up-R:atggtgtccgatcgcgagaccccggtccacccaggccct(SEQ ID NO.12);

[0235] fadE30-down-F:agggcctgggtggaccggggttctcgcgatcggacaccat(SEQ ID NO.13);

[0236] fadE30-down-R:agcttaagactagtcacgtgggacaatgtcgtcggatcga(SEQ ID NO.14)!

[0237] Remove the pKAdelΔfadE31 bubble bath:

[0238] fadE31-up-F:agaatacataggatccgtcgacaggcgattcgggtgaggt(SEQ ID NO.15);

[0239] fadE31-up-R:aggccttcggtccagtggtcctgctcgaaccctcaa(SEQ ID NO.16);

[0240] fadE31-down-F:ttgagggtttcgagcaggaccactggaccgaaggcct(SEQ ID NO.17);

[0241] fadE31-down-R: tgccattgctgcagcttaagcgaacagctttcgtgccg (SEQ ID NO.18);

[0242] The primer sequences used for constructing pKAdelΔfadE32 are as follows:

[0243] fadE32-up-F: cgtcgaccacgtgactagtccgcgacttcctggcggcgaacc (SEQ ID NO.19);

[0244] fadE32-up-R: gtgttcctgggtgaacccgatggcgcccggtccggtgtca (SEQ ID NO.20);

[0245] fadE32-down-F: tgacaccggaccgggcgccatcgggttcacccaggaacac (SEQ ID NO.21);

[0246] fadE32-down-R: ttgccattgctgcagcttaagtgccgtcggtgccccggcg (SEQ ID NO.22);

[0247] The primer sequences used for constructing pKAdelΔfadE33 are as follows:

[0248] fadE33-up-F: ccgtcgaccacgtgactagtccgagttggtcgaccactggaccg (SEQ ID NO.23);

[0249] fadE33-up-R: tcccaggtgatcgcgataccccacagcttctcgtcgtagccgc (SEQ ID NO.24);

[0250] fadE33-down-F: gcggctacgacgagaagctgtggggtatcgcgatcacctggga (SEQ ID NO.25);

[0251] fadE33-down-R: gttgccattgctgcagcttaagccgccccgttgggtgtcg (SEQ ID NO.26).

[0252] Example 2: Construction and Screening of Knockout Strains

[0253] The constructed knockout plasmid was electroporated into competent cells of M. fortuitum ATCC 6842 strain, incubated with shaking at 37°C for 2 h, then spread on Kan and Apr double-resistant LB plates (tryptone: 10 g / L, yeast extract: 5 g / L, sodium chloride: 10 g / L, agar: 1.5%, Kan: 50 μg / ml, Apr: 50 μg / ml, X-Gal 400 μg / ml), and cultured overnight at 37°C for 72 h. A single blue colony was picked from the solid culture dish, and colony PCR verification was performed using primers up-F / down-R of the corresponding knockout gene. The single clone showing one long and one short double PCR band was transferred to 2 ml LB liquid culture medium (tryptone: 10 g / L, yeast extract: 5 g / L, sodium chloride: 10 g / L, Tween 80: 2 g / L) and cultured at 37°C with shaking for 24 h. Then, a portion of the bacterial liquid was streaked on LB solid culture medium containing 20% ​​sucrose and 400 μg / ml X-gal for a second screening. Pick white colonies on the sucrose plate and perform colony PCR verification using up-F / down-R primers of the corresponding knockout genes (for example, car1,2-up-F / car1,2-down-R are used for the verification primers for knocking out car1,2, fadE30-up-F / fadE30-down-R are used for the verification primers for knocking out fadE30, fadE31-up-F / fadE31-down-R are used for the verification primers for knocking out fadE32, fadE32-up-F / fadE32-down-R are used for the verification primers for knocking out fadE33, and fadE33-up-F / fadE33-down-R are used for the verification primers for knocking out fadE33). Transfer the single clone that shows a single short PCR band to liquid LB medium and culture at 37°C for 36 hours before taking out part of the bacterial solution for storage.

[0254] If the gene knockout is successful, the PCR product should be a short single fragment of about 2.5 kbp. For the strains with single gene knockout, the next gene was knocked out step by step according to the above steps, and the intermediate strains ΔcarΔfadE30, ΔcarΔfadE30-31, ΔcarΔfadE30-32, ΔcarΔfadE30-33, ΔcarΔfadE30-31-32, ΔcarΔfadE30-31-33, ΔcarΔfadE30-32-33 were obtained, and finally the gene deletion strain ΔcarΔfadE30-31-32-33 with all two carboxylic acid reductases (CAR1, CAR2) and four acyl-CoA dehydrogenases (FadE30, FadE31, FadE32, FadE33) knocked out was obtained.

[0255] Example 3: Shake flask fermentation verification of gene-deficient strains

[0256] The starting strain Mycobacterium fortuitum ATCC 6842 and the modified strain obtained in Example 2 were cultured in LB solid medium at 37° C. for 72 hours to activate the strains, and colonies with better growth status were selected from the activation plate and inoculated into the seed medium, and cultured at 180 rpm and 37° C. for 2 days to obtain seed liquid; the seed liquid was transferred to a 250 mL baffle bottle containing 30 mL of fermentation medium at an inoculum amount of 10% (v / v), and cultured at 200 rpm and 30° C. for aerobic fermentation, and samples were taken for detection every 24 hours, and the fermentation culture was carried out for 168 hours.

[0257] After 168 h of incubation, the final metabolites were processed and analyzed by GC and GC-MS:

[0258] GC analysis was performed using a gas chromatograph (GC-2010 Plus, Shimadzu, Japan) equipped with an Rtx-5 capillary column (30 m × 0.32 mm × 0.25 μm) and a flame ionization detector (FID). Nitrogen was used as a carrier gas with a flow rate of 6.5 mL / min. The injector and detector temperatures were set to 280 ° C and 300 ° C, respectively. The column temperature was maintained at 220 ° C for 10 minutes, then increased to 270 ° C at a rate of 20 ° C / min and maintained for 7 minutes.

[0259] GC-MS analysis was performed using an Agilent 7890A-5975C system equipped with an HP-5MS column (30.0 m × 250 μm × 0.25 μm). The initial column temperature was maintained at 150 °C for 5 min, then increased to 250 °C at a rate of 5 °C / min, and further increased to 290 °C at a rate of 40 °C / min and maintained for 10 min. The vaporizer temperature was 250 °C. The transmission line temperature was 300 °C. Helium was used as a carrier gas with a flow rate of 1.0 mL / min, a split ratio of 10:1, and an injection volume of 1 μL. Mass spectrometry was performed under the following conditions: an electron ionization (EI) source with an electron energy of 70 eV, an ion source temperature of 230 °C, a quadrupole temperature of 150 °C, and a mass scan range set to 35-500 u.

[0260] Seed culture medium: yeast powder 5g / L, sodium chloride 10g / L, peptone 10g / L, Tween 80 2.0g / L, initial pH value adjusted to about 7.0, high pressure sterilization at 115℃ for 15min.

[0261] Fermentation medium: corn syrup powder 15g / L, glucose 10g / L, diammonium phosphate 0.7g / L, sodium nitrate 6g / L, phytosterol 10g / L, hydroxypropyl β-cyclodextrin added at a mass ratio of 3:1 to phytosterol, Tween 80 added at a mass ratio of 0.2:1 to phytosterol. The initial pH value was adjusted to 7.7-7.8, and autoclaved at 115°C for 15min. During the preparation process, phytosterol and hydroxypropyl β-cyclodextrin should be mixed evenly with a small amount of culture medium at a mass ratio of 1:3, stirred for 20min, ultrasonically dissolved for 30min, and then packaged and sterilized.

[0262] Table 1 Relative purity of metabolic intermediates accumulated by mutants of M. fortuitum ATCC 6842

[0263]

[0264] The final metabolites were processed and analyzed by GC and GC-MS. The relative purity of each component is shown in Table 1 and the gas chromatogram is shown in Figure 2 and Figure 3 shown.

[0265] The results showed that the wild-type M. fortuitum ATCC 6842 strain could completely degrade plant sterols to produce carbon dioxide and water without accumulating any detectable products. In contrast, the ΔcarΔfadE30 strain produced 63.09% pure glutamic acid HIL as the main product with a retention time of 5.2 minutes, in addition to three by-products with retention times of 2.6, 3.6 and 4.5 minutes, respectively. These by-products accounted for 23.41% ± 0.47, 2.57% ± 0.21 and 10.93% ± 0.67 of the total metabolites.

[0266] The three fadE genes were knocked out individually and in combination in the strain ΔcarΔfadE30, and strains ΔcarΔfadE30-31, ΔcarΔfadE30-32, ΔcarΔfadE30-33, ΔcarΔfadE30-31-32, ΔcarΔfadE30-31-33, and ΔcarΔfadE30-32-33 were constructed. Then, 10 g / L of phytosterols were converted in each experimental group. The final metabolites were detected by gas chromatography, and the peak shape of the mutant strain was almost the same as that of ΔcarΔfadE30, with a slight increase in the amount of the main product and a slight decrease in the by-product. Finally, the strain ΔcarΔfadE30-31-32-33 was obtained by simultaneously knocking out fadE31, fadE32, and fadE33 in the strain ΔcarΔfadE30, that is, in this case, all four ACADs related to HIL degradation were inactivated. The metabolite samples were tested by GC and no impurities were found. This shows that only when all four ACADs involved in HIL degradation are completely inactivated can the accumulation of by-products be completely avoided and the target product HIL with high purity be obtained. Through the above genetic modification, a strain that can efficiently metabolize plant sterols to accumulate glutamic acid HIL was constructed. When 10g / L of plant sterols is converted, glutamic acid with a purity greater than 99% can be produced.

[0267] Example 4: Evaluation of the production capacity of the glutolactone-producing strain ΔcarΔfadE30-31-32-33

[0268] In order to evaluate the ability of ΔcarΔfadE30-31-32-33 to convert phytosterols into glutamic acid, the inventors carried out fermentation with 10, 20, 30, 40 and 50 g / L of phytosterol feed respectively based on the same operation as in Example 3. The curve of glutamic acid HIL yield obtained by fermenting different concentrations of phytosterols by the genetically engineered bacteria in this example over time is shown in FIG. Figure 4 As shown; Table 2 shows the conversion effect under different plant sterol concentrations.

[0269] Specifically, 4.84 g / L, 9.70 g / L, 14.24 g / L, 19.45 g / L and 21.98 g / L of glutamic acid HIL were accumulated from 10 g / L, 20 g / L, 30 g / L, 40 g / L and 50 g / L of phytosterol bioconversion, with the highest molar yields of 90.2%, 90.49%, 88.52%, 90.68% and 81.97%, respectively. The strain ΔcarΔfadE30-31-32-33 was able to completely metabolize 10 g / L of phytosterols to produce glutamic acid within 3 days, with almost no substrate residue, and the phytosterol substrate concentration that could be metabolized was as high as 50 g / L; when the substrate concentration was 50 g / L, the maximum space-time yield of 3.66 g / L / d was achieved.

[0270] Table 2 Conversion effect of different phytosterol concentrations

[0271]

[0272] in:

[0273] The maximum yield (g / L) was calculated by substituting the GC detection peak area into the HIL (0.1 g / L to 4 g / L) standard curve and taking the average of the maximum yields of the three parallel test groups.

[0274] The maximum molar yield (%) was calculated as follows: the ratio of the maximum yield to the theoretical yield*100%, where 53.62% of the substrate concentration was the theoretical yield.

[0275] The space time yield (g / L / d) was calculated as the ratio of the maximum yield to the number of days required to reach the maximum yield.

[0276] The calculation method of the molar conversion rate (%) is: the ratio of the amount of phytosterol consumed in the conversion process to the total amount of phytosterol input*100%.

[0277] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria are glutamic acid lactone-producing actinomycetes in which carboxylic acid reductase and acyl-CoA dehydrogenase are inactivated.

2. The genetically engineered bacterium according to claim 1, characterized in that The genetically engineered bacteria are glutamic acid-producing actinomycetes with carboxylic acid reductase encoding genes and acyl-CoA dehydrogenase encoding genes knocked out.

3. The genetically engineered bacterium according to claim 2, characterized in that: The carboxylic acid reductase encoding gene includes a carboxylic acid reductase car1 gene and a carboxylic acid reductase car2 gene; and / or, The acyl-CoA dehydrogenase encoding genes include acyl-CoA dehydrogenase fadE30 gene, acyl-CoA dehydrogenase fadE31 gene, acyl-CoA dehydrogenase fadE32 gene and acyl-CoA dehydrogenase fadE33 gene.

4. The genetically engineered bacterium according to claim 3, characterized in that: The sequence of the carboxylic acid reductase car1 gene is: A1) the nucleotide sequence shown in SEQ ID NO.1 or its degenerate sequence; A2) a nucleotide sequence having a homology of more than 60% with SEQ ID NO.1 and having the same or similar function as the nucleotide sequence shown in SEQ ID NO.1; and / or, The sequence of the carboxylic acid reductase car2 gene is: B1) the nucleotide sequence shown in SEQ ID NO.2 or its degenerate sequence; B2) a nucleotide sequence having a homology of more than 60% with SEQ ID NO.2 and having the same or similar function as the nucleotide sequence shown in SEQ ID NO.2; and / or, The sequence of the acyl-CoA dehydrogenase fadE30 gene is: C1) the nucleotide sequence shown in SEQ ID NO.3 or its degenerate sequence; C2) a nucleotide sequence having a homology of more than 60% with SEQ ID NO.3 and having the same or similar function as the nucleotide sequence shown in SEQ ID NO.3; and / or, The sequence of the acyl-CoA dehydrogenase fadE31 gene is: D1) the nucleotide sequence shown in SEQ ID NO.4 or its degenerate sequence; D2) a nucleotide sequence having more than 60% homology with SEQ ID NO.4 and having the same or similar function as the nucleotide sequence shown in SEQ ID NO.4; and / or, The sequence of the acyl-CoA dehydrogenase fadE32 gene is: E1) the nucleotide sequence shown in SEQ ID NO.5 or its degenerate sequence; E2) a nucleotide sequence having a homology of more than 60% with SEQ ID NO.5 and having the same or similar function as the nucleotide sequence shown in SEQ ID NO.5; and / or, The sequence of the acyl-CoA dehydrogenase fadE33 gene is: F1) the nucleotide sequence shown in SEQ ID NO.6 or its degenerate sequence; F2) A nucleotide sequence that has more than 60% homology with the nucleotide sequence shown in SEQ ID NO.6 and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.

6.

5. The genetically engineered bacterium according to any one of claims 1 to 4, characterized in that: The actinomycetes are Rhodococcus, Nocardia or Mycobacterium; Preferably, the starting strain of the genetically engineered bacteria is Mycobacterium fortuitum; Preferably, the starting strain of the genetically engineered bacteria is Mycobacterium fortuitum ATCC 6842.

6. The method for preparing the genetically engineered bacteria according to any one of claims 1 to 5, characterized in that: The preparation method comprises knocking out the carboxylic acid reductase gene and the acyl-CoA dehydrogenase gene of the starting strain of the genetically engineered bacteria, thereby obtaining the genetically engineered bacteria according to any one of claims 1 to 5.

7. Use of the genetically engineered bacteria according to any one of claims 1 to 5 in the production of glutolactone.

8. Use of carboxylic acid reductase and acyl-CoA dehydrogenase inhibitors in increasing the production of glutathione by actinomycetes.

9. A method for preparing valproate, characterized in that: The preparation method comprises converting sterols into glutolactone using the genetically engineered bacteria as described in any one of claims 1 to 5; Preferably, the preparation method comprises: The seed liquid of the genetically engineered bacteria according to any one of claims 1 to 5 is inoculated into a fermentation medium containing sterols for fermentation culture to obtain glutamic acid.

10. The preparation method according to claim 9, characterized in that: The seed liquid of the genetically engineered bacteria according to any one of claims 1 to 5 is obtained by inoculating the genetically engineered bacteria according to any one of claims 1 to 5 into a seed culture medium for cultivation; Preferably, the inoculation into the seed culture medium is cultured at a temperature of 30-40°C; and / or the culture speed is 200-300 rpm; and / or the culture time is 1-3 days; Preferably, the inoculation amount is 5 to 15 v / v%; Preferably, the fermentation temperature is 25-40°C; and / or the fermentation speed is 100-300 rpm; And / or, the fermentation culture time is 100 to 240 hours; Preferably, the concentration of sterols in the fermentation medium is 1-50 g / L; Preferably, the sterol comprises one or both of cholesterol or phytosterol; Preferably, the fermentation medium also includes an emulsifier; Preferably, the emulsifier comprises Tween and hydroxypropyl β-cyclodextrin; Preferably, the mass ratio of Tween to sterol in the fermentation medium is 0.05-0.5:1; Preferably, the mass ratio of hydroxypropyl β-cyclodextrin to sterol in the fermentation medium is 0.5 to 4:1.

Images