Cell line for stably expressing orthogonal aminoacyl tRNA synthetase / tRNA pair

Abstract

The invention relates to a cell line capable of stably expressing an orthogonal aminoacyl tRNA synthetase / tRNA pair, constructs an HEK293T cell line capable of stably expressing an EcTyr orthogonal aminoacyl tRNA synthetase / BsTyr tRNA pair and discloses a construction method of the cell line, and the construction method comprises the following steps: stably integrating the orthogonal EcTyr aminoacyl tRNA synthetase and BsTyr tRNA gene into an HEK293T cell genome by virtue of a PiggyBac transposon system and stable plasmid transfection; according to the constructed cell line genome, the EcTyr orthogonal aminoacyl tRNA synthetase and the BsTyr tRNA gene are integrated, so that a stable platform is provided for efficiently introducing non-natural amino acid at any site of protein. The method has the effect of further laying an experimental foundation for exploration of novel protein structures and functions and research and development of protein drugs with certain specific functions.

Description

Technical Field

[0001] The present application relates to the field of chemical biology technology, and in particular to a cell line stably expressing an orthogonal aminoacyl tRNA synthetase / tRNA pair. Background Art

[0002] In the field of modern chemical biology and technology, genetic code expansion technology is a revolutionary advancement. It expands the chemical diversity of biosynthetic proteins by introducing non-natural amino acids into organisms. The core of this technology lies in orthogonal aminoacyl tRNA synthetase / tRNA pairs, which can specifically recognize and insert non-natural amino acids without affecting the host cell's endogenous protein translation system. This orthogonality is the key to achieving genetic code expansion, because orthogonal aminoacyl tRNA synthetase / tRNA ensures that the insertion of non-natural amino acids will not interfere with the normal protein synthesis process in the cell.

[0003] The discovery and design of orthogonal aminoacyl-tRNA synthetase / tRNA pairs provide new tools for studying the relationship between protein structure and function, exploring life phenomena, and developing new biomaterials and drugs. For example, by introducing unnatural amino acids at specific sites in proteins, it is possible to study the localization, stability, folding, and interactions of proteins, and even to endow proteins with new catalytic activity or biophysical properties. In addition, this technology also shows great potential in the field of biopharmaceuticals, such as the synthesis of antibody-drug conjugates, the encoding of post-translational modifications of proteins, and the capture of protein-protein interactions.

[0004] Currently available orthogonal systems such as pyrrolysine aminoacyl tRNA synthetase / tRNA pairs show high orthogonality and efficient amber codon suppression efficiency in both prokaryotes and eukaryotes. In order to further improve the recognition ability of the pyrrolysine translation system for other types of unnatural amino acids, Lin Shixian et al. have previously developed a variety of chimeric aminoacyl tRNA synthetases / chimeric tRNA pairs through chimera design and directed evolution methods. These systems can recognize and insert different types of unnatural amino acids. For example, the chimeric phenylalanine aminoacyl tRNA synthetase system (chPheRS / chPheT) has acquired the ability to recognize a variety of phenylalanine analogs through mutations in the catalytic domain, and has shown good orthogonality in both eukaryotic and prokaryotic systems.

[0005] With respect to the above-mentioned related technologies, the inventors believe that there are the following defects: There are currently several major problems with the orthogonal aminoacyl tRNA synthetase / tRNA system. In some host cells, the orthogonal aminoacyl tRNA synthetase may cross-react with the host's endogenous tRNA or aminoacyl tRNA synthetase, affecting the specificity of the system; especially in eukaryotic cells, prokaryotic orthogonal tRNAs usually show low expression levels, and require the use of specific eukaryotic promoters to improve their transcription efficiency; in addition, the read-through efficiency of the stop codon may be inconsistent in different cell types, resulting in low efficiency in the introduction of unnatural amino acids. The existence of these defects makes it challenging to construct a stable, efficient, orthogonal aminoacyl tRNA synthetase / tRNA system in different host cells. Summary of the invention

[0006] In order to improve the problem that orthogonal aminoacyl tRNA synthetase may cross-react with the host's endogenous tRNA or aminoacyl tRNA synthetase or the introduction efficiency of unnatural amino acids is low, the present application provides a cell line that stably expresses an orthogonal aminoacyl tRNA synthetase / tRNA pair.

[0007] The present application provides a cell line that stably expresses an orthogonal aminoacyl tRNA synthetase / tRNA pair using the following technical solution:

[0008] A cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA, the cell line carrying an EcTyr aminoacyl tRNA Synthetase gene and BsTyr tRNA Gene , cell lines can be used to introduce unnatural amino acids at any site in a protein.

[0009] By adopting the above technical scheme, the EcTyr orthogonal aminoacyl-tRNA synthetase gene (whose gene sequence is shown in SEQ ID NO: 1) and the BsTyr tRNA gene (whose gene sequence is shown in SEQ ID NO: 2) are integrated into the genome of HEK293T cells through the PiggyBac transposon system, and the green fluorescent protein gene with a 191TAG mutation is used as a reporter gene for screening cell lines and detecting the insertion of unnatural amino acids. Finally, a HEK293T cell line stably expressing the EcTyr orthogonal aminoacyl-tRNA synthetase / BsTyr tRNA pair is obtained, and the integration sites of the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene are identified by whole genome sequencing.

[0010] Preferably, the cell line is constructed by the following steps:

[0011] S1. The EcTyr aminoacyl-tRNA synthetase gene, the green fluorescent protein gene with the 191TAG mutation, and the puromycin resistance gene were connected to the plasmid pUC19-PB carrying the PiggyBac transposon element to obtain the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro;

[0012] S2, co-transfecting the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro and the plasmid pB-Transposon carrying the PiggyBac transposase gene into HEK293T cells, and obtaining a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene through puromycin resistance screening;

[0013] S3, 12 copies of BsTyr tRNA gene and hygromycin resistance gene were connected to the plasmid pUC19-PB carrying the PiggyBac transposon element to obtain the plasmid pUC19-PB-12*BSTyrT-Hygro;

[0014] S4, co-transfecting the plasmid pUC19-PB-12*BSTyrT-Hygro and the plasmid pB-Transposon carrying the PiggyBac transposase gene into a stable cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene, selecting single clones with green fluorescence by flow cytometry after hygromycin resistance screening, and expanding the culture to obtain a stable cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene;

[0015] S5. Identify the integration sites of the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene by whole-genome sequencing.

[0016] By adopting the above technical scheme, we achieved efficient integration and stable expression of EcTyr aminoacyl-tRNA synthetase gene and multi-copy BsTyr tRNA gene in HEK293T cells through the PiggyBac transposon system. At the same time, combined with the specific expression of the green fluorescent protein gene with the 191TAG mutation, we achieved accurate encoding and efficient incorporation of non-natural amino acids, and constructed a stable genetically modified cell line with fluorescent labeling function, which provided a repeatable and reliable cell model for studying the functional application of non-natural amino acids and protein synthesis.

[0017] Preferably, the cell line is HEK293T.

[0018] By adopting the above technical scheme, the stable integration and efficient expression of EcTyr aminoacyl tRNA synthetase gene, BsTyr tRNA gene and green fluorescent protein gene carrying 191TAG mutation in HEK293T cells were achieved, and a cell line capable of specifically incorporating unnatural amino acids was constructed, providing an efficient and reliable platform for precise protein labeling, unnatural amino acid research and functional protein synthesis.

[0019] Preferably, the aminoacyl-tRNA synthetase is an EcTyr aminoacyl synthetase gene, the sequence of which is shown in SEQ ID NO: 1.

[0020] By adopting the above technical scheme, the EcTyr aminoacyl-tRNA synthetase gene and related gene elements shown in SEQ ID NO:1 were accurately integrated into HEK293T cells, and a cell line that can specifically recognize TAG codons and incorporate unnatural amino acids was successfully constructed, providing a stable and efficient platform for precise protein labeling, function expansion and unnatural amino acid research.

[0021] Preferably, the insertion sites of the aminoacyl-tRNA synthetase gene are Chr1:195962277, Chr1:49891692, Chr1:63286698 and Chr13:66690728.

[0022] By adopting the above technical scheme, the EcTyr aminoacyl tRNA synthetase gene was precisely inserted into the four sites of Chr1:195962277, Chr1:49891692, Chr1:63286698 and Chr13:66690728 of HEK293T cells, and a stable expression system with specific gene integration sites was constructed. It can efficiently recognize TAG codons and incorporate non-natural amino acids, providing a reliable cell model for protein-directed modification and functional research of non-natural amino acids.

[0023] Preferably, the tRNA is BsTyr tRNA, and the sequence is shown in SEQ ID NO:2.

[0024] By adopting the above technical scheme, the BsTyr tRNA gene (SEQ ID NO: 2) was introduced into HEK293T cells and stably expressed, and it synergized with the EcTyr aminoacyl-tRNA synthetase to accurately recognize the TAG stop codon and incorporate unnatural amino acids. A stable cell line with specific gene integration and functional optimization was constructed, which provides an efficient tool and platform for protein-directed modification, unnatural amino acid incorporation and synthetic biology research.

[0025] Preferably, the tRNA copy number is 12.

[0026] By adopting the above technical scheme, we achieved the stable expression of 12 copies of BsTyr tRNA in HEK293T cells, which synergized with EcTyr aminoacyl tRNA synthetase to effectively improve the recognition efficiency of TAG stop codon and the incorporation efficiency of unnatural amino acids, and constructed a stable cell line that can efficiently synthesize specific modified proteins.

[0027] Preferably, the insertion sites of the tRNA gene are ChrX:809749, Chr1:87795827 and Chr1:189472218.

[0028] By adopting the above technical solution, we achieved the stable integration of 12 copies of BsTyr tRNA genes at specific sites of ChrX:809749, Chr1:87795827 and Chr1:189472218 in HEK293T cells, ensuring the efficient expression and functional stability of the tRNA gene, and synergizing with EcTyr aminoacyl tRNA synthetase to significantly improve the accurate recognition and efficient incorporation of non-natural amino acids for the TAG stop codon.

[0029] Preferably, the codon encoding the unnatural amino acid is UAG.

[0030] By adopting the above technical scheme, it is possible to use EcTyr aminoacyl tRNA synthetase and BsTyr tRNA system in HEK293T cells to specifically recognize the UAG stop codon and insert unnatural amino acids, thereby achieving precise modification and functionalization of the target protein.

[0031] Preferably, the encoded unnatural amino acid is O-methyl-L-tyrosine (OmeY).

[0032] By adopting the above technical scheme, the UAG stop codon was specifically translated into O-methyl-L-tyrosine (OmeY) in HEK293T cells through the EcTyr aminoacyl tRNA synthetase and BsTyr tRNA system, thereby achieving site-specific modification and precise functionalization of the target protein.

[0033] In summary, the present application includes at least one of the following beneficial technical effects:

[0034] 1. A HEK293T cell line that stably expresses the EcTyr orthogonal aminoacyl-tRNA synthetase / BsTyr tRNA pair provides a highly stable mammalian cell model for the efficient introduction of unnatural amino acids at specific sites of proteins, and also lays a certain experimental foundation for simulating post-translational modifications of proteins in vivo. It also has broad application potential in the exploration and development of new protein functions, drug screening and other fields.

[0035] 2. A HEK293T cell line that stably expresses the EcTyr orthogonal aminoacyl-tRNA synthetase / BsTyr tRNA pair. The integration sites of the aminoacyl-tRNA synthetase gene and tRNA gene in the cell line were identified by whole genome sequencing, which has important reference value for the subsequent construction of various cell lines that stably express other orthogonal aminoacyl-tRNA synthetase / tRNA pairs. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the HEK293T cell line stably expressing the EcTyr orthogonal aminoacyl tRNA synthetase / BsTyr tRNA pair of the present application;

[0037] Figure 2 The plasmid map used in this application;

[0038] Figure 3 Schematic diagram of the process for constructing and screening cell lines that stably express orthogonal aminoacyl-tRNA synthetase / tRNA pairs;

[0039] Figure 4 is the structural formula of the non-natural amino acid used in the present invention;

[0040] Figure 5 To sort cells that efficiently express green fluorescent protein by flow cytometry;

[0041] Figure 6 To identify and validate the cell lines stably expressing orthogonal aminoacyl tRNA synthetase / tRNA, Figure A: gel electrophoresis of EcTyr orthogonal aminoacyl tRNA synthetase gene and BsTyr tRNA gene amplified by PCR, Figure B: sequence alignment of EcTyr orthogonal aminoacyl tRNA synthetase gene and BsTyr tRNA gene amplified by PCR, Figure C: flow cytometry detection of amber suppression activity of cells under the condition of adding / subtracting unnatural amino acids;

[0042] Figure 7 Identification of integration sites of the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene for whole-genome sequencing. DETAILED DESCRIPTION

[0043] The following is combined with Figure 1-7 This application is described in further detail.

[0044] In the present application, unless otherwise specified, all percentages are by weight, the equipment and raw materials used are commercially available or commonly used in the art, and the methods in all embodiments are conventional methods in the art unless otherwise specified.

[0045] The present application example discloses a cell line that stably expresses an orthogonal aminoacyl tRNA synthetase / tRNA pair, referring to Figure 1-Figure 7 The primer sequences used in the process of constructing the vector in the specific examples of this application are shown in Table 1:

[0046] Table 1: Primer sequences for constructing vectors

[0047]

[0048]

[0049] Reference Figure 2 The plasmid maps in are all used in this application.

[0050] The invention strategy of constructing a cell line stably expressing an orthogonal aminoacyl tRNA synthetase / tRNA pair in this application is referred to Figure 3 As shown in , the specific method is described below with examples.

[0051] Example 1

[0052] Construction of plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro carrying the EcTyr orthogonal aminoacyl-tRNA synthetase gene, the green fluorescent protein gene with the 191TAG mutation, and the puromycin resistance gene;

[0053] The sequence of the EcTyr orthogonal aminoacyl-tRNA synthetase gene in this example is shown in SEQ ID NO: 1:

[0054] (1) designing primers OMeYRS-F and OMeYRS-R, and using an existing plasmid containing an EcTyr orthogonal aminoacyl-tRNA synthetase gene as a template to amplify an EcTyr orthogonal aminoacyl-tRNA synthetase gene fragment;

[0055] (2) designing primers Puro-F and Puro-R, and using the existing plasmid containing the puromycin resistance gene as a template to amplify the puromycin resistance gene fragment;

[0056] (3) designing primers EGFP-191TAG-F and EGFP-191TAG-R, and using the existing plasmid containing the green fluorescent protein gene with the 191TAG mutation as a template to amplify the green fluorescent protein gene fragment with the 191TAG mutation;

[0057] (4) using restriction endonucleases EcoRI and NotI to digest the plasmid carrying the PiggyBac transposon element to obtain a vector;

[0058] (5) The EcTyr orthogonal aminoacyl-tRNA synthetase gene fragment, the puromycin resistance gene fragment, the green fluorescent protein gene fragment with the 191TAG mutation, and the vector were recovered from agarose gel and assembled using Gibson. The fragments were transformed into DH5α competent cells, and single clones were selected and sequenced to obtain the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro. The plasmid map is shown in Figure 2. Figure 2 As shown in A;

[0059] The implementation principle of Example 1 is as follows: using molecular cloning technology, the EcTyr orthogonal aminoacyl-tRNA synthetase gene, the green fluorescent protein gene with the 191TAG mutation, and the puromycin resistance gene are amplified by PCR, and then digested, assembled, and connected with the plasmid backbone carrying the PiggyBac transposon element to construct the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro, thereby realizing the integration of the target gene and the selection marker gene on the same expression vector for subsequent precise insertion and functionalization studies of specific non-natural amino acids in HEK293T cells.

[0060] Example 2

[0061] This example is the construction of a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene:

[0062] (1) Transfected cells: In the experimental group, the plasmids pUC19-PB-EGFP-191TAG-OMeYRS-Puro and pB-Transposon were transfected into HEK293T cells at a ratio of 2:1 according to the standard plasmid transient transfection procedure. In the control group, the HEK293T cells were treated according to the standard plasmid transient transfection procedure but no plasmid was added;

[0063] (2) 24 h after cell transfection, the culture medium was removed and complete culture medium containing 2 μg / mL puromycin was added;

[0064] (3) After all cells in the control group without plasmid transfection died, the surviving cells in the experimental group were collected as a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene, and the cell line was subsequently cultured in a complete medium containing 1 μg / mL puromycin.

[0065] The implementation principle of Example 2 is as follows: based on the plasmid co-transfection technology, the constructed plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro containing the EcTyr aminoacyl-tRNA synthetase gene, the green fluorescent protein gene and the puromycin resistance gene is co-transfected with the plasmid pB-Transposon carrying the PiggyBac transposase gene into HEK293T cells, and the puromycin resistance is screened to enable the successfully transfected cells to survive during the culture process and establish a stable cell line. By removing the culture medium 24 hours after transfection and using a culture medium containing puromycin for screening, HEK293T cells integrating the EcTyr aminoacyl-tRNA synthetase gene are finally screened out, and these cell lines can be further analyzed and applied in subsequent experiments.

[0066] Example 3

[0067] This example is the construction of the plasmid pUC19-PB-12*BSTyrT-Hygro carrying 12 copies of the BsTyr tRNA gene and the hygromycin resistance gene;

[0068] The sequence of the BsTyr tRNA gene in this example is shown in SEQ ID NO: 2:

[0069] (1) using restriction endonucleases EcoRI and XhoI to digest an existing plasmid containing 12 copies of the BsTyr tRNA gene to obtain a 12-copy BsTyr tRNA gene fragment;

[0070] (2) designing primers Hygro-F and Hygro-R, and using the existing plasmid containing the hygromycin resistance gene as a template to amplify the hygromycin resistance gene fragment;

[0071] (3) using restriction endonucleases EcoRI and NotI to digest the plasmid carrying the PiggyBac transposon element to obtain a vector;

[0072] (4) The BsTyr tRNA gene fragment containing 12 copies, the hygromycin resistance gene fragment and the vector were recovered from agarose gel and assembled using Gibson. The fragments were transformed into DH5α competent cells and single clones were selected for sequencing to obtain the plasmid pUC19-PB-12*BSTyrT-Hygro. The plasmid map is shown in Figure 2 As shown in B.

[0073] The implementation principle of Example 3 is: through molecular cloning technology, restriction endonuclease cutting and Gibson assembly method, a plasmid containing 12 copies of BsTyr tRNA gene, hygromycin resistance gene and PiggyBac transposon element is constructed into the target plasmid pUC19-PB-12* BSTyrT-Hygro;

[0074] First, EcoRI and XhoI were used to digest the plasmid containing 12 copies of the BsTyr tRNA gene to obtain the target gene fragment;

[0075] Next, specific primers were designed to amplify the hygromycin resistance gene and cloned into the vector of the PiggyBac transposon element to ensure that all components could be effectively combined;

[0076] All fragments were precisely assembled using the Gibson assembly method to construct a complete plasmid;

[0077] Finally, the plasmid was transformed into DH5α competent cells, and after screening and sequencing verification, the constructed plasmid pUC19-PB-12 was obtained. * BSTyrT-Hygro provides the necessary plasmid vector for subsequent stable cell line construction.

[0078] Example 4

[0079] This example is the construction of a cell line integrating the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene;

[0080] (1) Transfected cells: The experimental group used the standard plasmid transient transfection procedure to transfect the plasmids pUC19-PB-12*BSTyrT-Hygro and pB-Transposon at a ratio of 2:1 into the stable cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene. The control group used the standard plasmid transient transfection procedure but did not add any plasmid to treat the stable cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene.

[0081] (2) 24 h after cell transfection, the culture medium was removed and complete culture medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin was added;

[0082] (3) After all cells in the control group without plasmid transfection died, the surviving cells in the experimental group were collected as the cell line integrating the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene, and then cultured with complete medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin.

[0083] The implementation principle of Example 4 is as follows: construct a stable cell line integrating the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene by plasmid transfection and dual resistance screening; first, the plasmids pUC19-PB-12*BSTyrT-Hygro and pB-Transposon are transfected into the stable cell line that has integrated the EcTyr aminoacyl tRNA synthetase gene at a ratio of 2:1; the standard plasmid transient transfection process is used to ensure the efficient introduction of the plasmid during the transfection process, and 24 hours after transfection, the culture medium is removed and replaced with a complete culture medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin, and dual resistance selection is implemented to ensure that only cells that have successfully integrated the BsTyr tRNA gene can survive; after the cells in the control group are completely dead due to the lack of plasmid transfection, the surviving cells are screened from the experimental group, and these cells have successfully integrated the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene; after screening and verification, the obtained cell line continued to grow in a culture medium containing antibiotics, and eventually a stable gene-integrated cell line was established, providing a reliable cell model for further experiments. Through precise resistance screening and transfection technology, the effective integration and stable expression of the target gene were ensured.

[0084] Example 5

[0085] This example is to screen for stable cell lines that integrate EcTyr aminoacyl tRNA synthetase gene and BsTyr tRNA gene and can efficiently introduce unnatural amino acids.

[0086] (1) 0.5 mM O-methyl-L-tyrosine was added to the culture medium of the cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene obtained in Example 4. The structural formula of O-methyl-L-tyrosine is as follows: Figure 4 As shown in;

[0087] (2) After 36 h of culture, the culture medium was removed and 1x PBS was added to wash away the remaining culture medium;

[0088] (3) Remove 1x PBS solution, digest with trypsin, neutralize with DMEM, centrifuge (200 g, 2 min), discard the supernatant, and resuspend the cells with 1x PBS solution containing 2% FBS;

[0089] (4) HEK293T cells were used to set the forward scatter and side scatter gates of the flow cytometer, and cells expressing green fluorescent protein were used to set the parameters and gates of the FITC channel;

[0090] (5) Monoclonal FITC-positive cells were sorted by flow cytometry and cultured in complete medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin.

[0091] The experimental results of Example 5: Figure 5 The figure shows a flow chart for sorting cells that efficiently express green fluorescent protein by flow cytometry. The experimental results show that the sorted cells all have obvious green fluorescent signals.

[0092] Example 6

[0093] This example is the verification of the EcTyr orthogonal aminoacyl tRNA synthetase gene and BsTyr tRNA gene sequences in a stable cell line;

[0094] (1) using a mammalian cell whole genome extraction kit to extract the genome of the cell line integrated with the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene screened in Example 5;

[0095] (2) designing primers pUC19-RS-F and pUC19-RS-R to amplify the EcTyr aminoacyl-tRNA synthetase gene fragment using the genome extracted in step (1) as a template;

[0096] (3) designing primers pUC19-tRNA-F and pUC19-tRNA-R to amplify the BsTyr tRNA gene fragment using the genome extracted in step (1) as a template;

[0097] (4) The fragments amplified in steps (2) and (3) are identified by agarose gel electrophoresis to determine the size of the fragments, and the gene sequences are identified by sequencing after recovery from the agarose gel.

[0098] Experimental results: The experimental data are as follows Figure 6 A and 6B show that the fragments amplified by primers pUC19-RS-F and pUC19-RS-R have a target band at around 900 bp ( Figure 6 A), which is consistent with the size of the EcTyr aminoacyl tRNA synthetase gene fragment, and the sequencing results are completely consistent with the EcTyr aminoacyl tRNA synthetase gene sequence ( Figure 6 B), the fragment amplified by primers pUC19-tRNA-F and pUC19-tRNA-R has a target band at around 300 bp ( Figure 6 A), which is consistent with the size of the BsTyr tRNA gene fragment, and the sequencing results are completely consistent with the BsTyr tRNA gene sequence ( Figure 6 B).

[0099] Example 7

[0100] Verification of amber suppressor activity in cell lines integrating EcTyr aminoacyl tRNA synthetase gene and BsTyr tRNA gene;

[0101] (1) The cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene selected in Example 5 was divided into two groups, and a complete medium containing 0.5 mM O-methyl-L-tyrosine, 1 μg / mL puromycin and 400 μg / mL hygromycin was added to the experimental group for culture, and a complete medium containing 1 μg / mL puromycin and 400 μg / mL hygromycin was added to the control group for culture;

[0102] (2) After 36 h of culture, the culture medium was removed and 1x PBS was added to wash away the remaining culture medium;

[0103] (3) Remove 1x PBS solution, digest with trypsin, neutralize with DMEM, centrifuge (200g, 2min), discard the supernatant, and resuspend the cells with 1x PBS solution;

[0104] (4) HEK293T cells were used to set the forward scatter and side scatter gates of the flow cytometer, and cells expressing green fluorescent protein were used to set the parameters and gates of the FITC channel;

[0105] (5) The cells in the experimental group and the control group were measured, and 50,000 cells were collected for each sample. The data were analyzed using the FlowJo software.

[0106] Experimental results: The experimental data are as follows Figure 6 C shows that the full-length green fluorescent protein can be detected only after the addition of unnatural amino acids, indicating that the obtained cell line has good amber suppression activity.

[0107] Example 8

[0108] Identification of the Integration Sites of EcTyr Aminoacyl-tRNA Synthetase Gene and BsTyr tRNA Gene

[0109] (1) taking the cells integrated with the EcTyr aminoacyl tRNA synthetase gene and the BsTyr tRNA gene selected in Example 5, and extracting whole genomic DNA;

[0110] (2) Select high-quality DNA samples that pass the test (main band > 30 kb);

[0111] (3) randomly fragmented into fragments (15-18 kb) using a Covaris ultrasonic disruptor;

[0112] (4) Enrich and purify large DNA fragments using magnetic beads;

[0113] (5) Fragmentation, damage repair, and end repair of DNA;

[0114] (6) Connect stem-loop sequencing adapters to both ends of the DNA fragments and use exonucleases to remove the fragments that failed to connect;

[0115] (7) The constructed library was sequenced using the Pacbio Sequel II / Pacbio Sequel IIe platform;

[0116] (8) Perform bioinformatics analysis on the sequencing results.

[0117] Experimental results: The experimental data are as follows Figure 7 A and B show that the EcTyr aminoacyl tRNA synthetase gene is inserted near 195962277 of Chr1, with 2 reads supporting it; it is inserted near 49891692 of Chr1, with 5 reads supporting it; it is inserted near 63286698 of Chr1, with 2 reads supporting it; it is inserted near 66690728 of Chr13, with 7 reads supporting it; the BsTyr tRNA gene is inserted near 809749 of ChrX, with 10 reads supporting it; it is inserted near 87795827 of Chr1, with 3 reads supporting it; it is inserted near 189472218 of Chr1, with 12 reads supporting it; Figure 7 Among them, S1 is the EcTyr aminoacyl tRNA synthetase gene fragment, and S2 is the BsTyr tRNA gene fragment.

[0118] Sequence Listing

[0119] SEQ ID NO:1

[0120] DNA

[0121] ATGGACTACAAGGACGACGACGACAAGGCAAGCAGTAACTTGATTAAACAATTGCAAGAGCGGGGGCTG

[0122] GTAGCCCAGGTGACGGACGAGGAAGCGTTAGCAGAGCGACTGGCGCAAGGCCCGATCGCGCTCGTGTGC

[0123] GGCTTCGATCCTACCGCTGACAGCTTGCATTTGGGGCATCTTGTTCCATTGTTATGCCTGAAACGCTTC

[0124] CAGCAGGCGGGCCACAAGCCGGTTGCGCTGGTAGGCGGCGCGACGGGTCTGATTGGCGACCCGAGCTTC

[0125] AAAGCTGCCGAGCGTAAGCTGAACACCGAAGAAACTGTTCAGGAGTGGGTGGACAAAATCCGTAAGCAG

[0126] GTTGCCCCGTTCCTCGATTTCGACTGTGGAGAAAACTCTGCTATCGCGGCGAACAACTATGACTGGTTC

[0127] GGCAATATGAATGTGCTGACCTTCCTGCGCGATATTGGCAAACACTTCTCCGTTAACCAGATGATCAAC

[0128] AAAGAAGCGGTTAAGCAGCGTCTCAACCGTGAAGATCAGGGGATTTCGTTCACTGAGTTTTCCTACAAC

[0129] CTGTTGCAGGGTTATAGCATGGCCTGTCTGAACAAACAGTACGGTGTGGTGCTGCAAATTGGTGGTTCT

[0130] GACCAGTGGGGTAACATCACTTCTGGTATCGACCTGACCCGTCGTCTGCATCAGAATCAGGTGTTTGGC

[0131] CTGACCGTTCCGCTGATCACTAAAGCAGATGGCACCAAATTTGGTAAAACTGAAGGCGGCGCAGTCTGG

[0132] TTGGATCCGAAGAAAACCAGCCCGTACAAATTCTACCAGTTCTGGATCAACACTGCGCGTGCCGACGTT

[0133] TACCGCTTCCTGAAGTTCTTCACCTTTATGAGCATTGAAGAGATCAACGCCCTGGAAGAAGAAGATAAA

[0134] AACAGCGGTAAAGCACCGCGCGCCCAGTATGTACTGGCGGAGCAGGTGACTCGTCTGGTTCACGGTGAA

[0135] GAAGGTTTACAGGCGGCAAAACGTATTACCGAATGCCTGTTCAGCGGTTCTTTGAGTGCGCTGAGTGAA

[0136] GCGGACTTCGAACAGCTGGCGCAGGACGGCGTACCGATGGTTGAGATGGAAAAGGGCGCAGACCTGATG

[0137] CAGGCACTGGTCGATTCTGAACTGCAACCTTCCCGTGGTCAGGCACGTAAAACTATCGCCTCCAATGCC

[0138] ATCACCATTAACGGTGAAAAACAGTCCGATCCTGAATACTTCTTTAAAGAAGAAGATCGTCTGTTTGGT

[0139] CGTTTTACCTTACTGCGTCGCGGTAAAAAGAATTACTGTCTGATTTGCTGGAAAGGGCCCGTTTAA

[0140] SEQ ID NO:2

[0141] DNA

[0142] GGTGGGGTAGCGAAGTGGCTAAACGCGGCGGACTCTAAATCCGCTCCCTTTGGGTTTCGGCGGTTCGAAT

[0143] CCGTCCCCCACCA

[0144] The above are all preferred embodiments of the present application, and the protection scope of the present application is not limited thereto. Therefore, any equivalent changes made according to the structure, shape, and principle of the present application should be included in the protection scope of the present application.

Claims

1. A cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA, characterized in that: The cell line carries the EcTyr aminoacyl synthetase gene and the BsTyr tRNA, and the cell line can be used to introduce unnatural amino acids into any site of a protein.

2. A cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 1, characterized in that: The cell line was constructed by the following steps: S1. The EcTyr aminoacyl-tRNA synthetase gene, the green fluorescent protein gene with the 191TAG mutation, and the puromycin resistance gene were connected to the plasmid pUC19-PB carrying the PiggyBac transposon element to obtain the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro; S2, co-transfecting the plasmid pUC19-PB-EGFP-191TAG-OMeYRS-Puro and the plasmid pB-Transposon carrying the PiggyBac transposase gene into HEK293T cells, and obtaining a stable cell line integrating the EcTyr aminoacyl-tRNA synthetase gene through puromycin resistance screening; S3, 12 copies of BsTyr tRNA gene and hygromycin resistance gene were connected to the plasmid pUC19-PB carrying the PiggyBac transposon element to obtain the plasmid pUC19-PB-12*BSTyrT-Hygro; S4, co-transfecting the plasmid pUC19-PB-12*BSTyrT-Hygro and the plasmid pB-Transposon carrying the PiggyBac transposase gene into a stable cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene, selecting single clones with green fluorescence by flow cytometry after hygromycin resistance screening, and expanding the culture to obtain a stable cell line integrated with the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene; S5. Identify the integration sites of the EcTyr aminoacyl-tRNA synthetase gene and the BsTyr tRNA gene by whole-genome sequencing.

3. The construction of a cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 2, characterized in that: The cell line is HEK293T.

4. The construction of a cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 2, characterized in that: The aminoacyl-tRNA synthetase is an EcTyr aminoacyl synthetase gene, and its sequence is shown in SEQ ID NO:

1.

5. The construction of a cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 2, characterized in that: The insertion sites of the aminoacyl-tRNA synthetase genes are Chr1:195962277, Chr1:49891692, Chr1:63286698 and Chr13:66690728.

6. The construction of a cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 2, characterized in that: The tRNA is BsTyr tRNA, and the sequence is shown in SEQ ID NO:

2.

7. The construction of a cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 2, characterized in that: The tRNA copy number is 12.

8. The construction of a cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 2, characterized in that: The insertion sites of the tRNA genes are ChrX:809749, Chr1:87795827 and Chr1:189472218.

9. A cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 1, characterized in that: The codon encoding the unnatural amino acid is UAG.

10. A cell line stably expressing an orthogonal aminoacyl-tRNA synthetase / tRNA according to claim 1, characterized in that: The encoded unnatural amino acid is O-methyl-L-tyrosine (OmeY).

Images