Preparation method of Syn-CAR-T cells, the cells and applications thereof

Abstract

The present invention provides a method for preparing Syn-CAR-T cells, the cells thereof and applications. The method includes constructing a stably transfected SIN-γ-RV vector, i.e., a PSR vector, by using the PiggyBac transposon system to prepare a Syn CAR plasmid vector: expressing a SynNotch system with the PSR vector, combining a GAL4 induction vector and a UAS effector vector of the SynNotch system on one PSR vector, so that the SynNotch system is delivered by one PSR vector, and constructing a plasmid of a Syn CAR retroviral vector; and transducing T cells with the plasmid of the retroviral vector to prepare the Syn-CAR-T cells. The results of the present invention show that the induction efficiencies of the targets BCMA, CD38, and GPC3 are extremely low and are not suitable for the SynNotch system of the present invention; the target CD19 has the highest induction efficiency and is most suitable for application to the SynNotch system of the present invention.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and particularly to a method for preparing Syn-CAR-T cells, the cells and their applications. Background Art

[0002] CAR-T cell therapy is a therapy that transfers the coding gene of a chimeric antigen receptor CAR specific to an antigen into T cells, and then re-introduces the cells into a patient. The CAR expressed by the T cells recognizes the target antigen on the surface of tumor cells, activates the killing activity of the T cells, and then releases perforin, granzyme, cytokines, etc. to exert the tumor killing effect. CAR-T cells directly exert the anti-tumor killing effect without the recognition restriction of the major histocompatibility complex (MHC).

[0003] The side effects of CAR-T cell therapy include cytokine release syndrome, cytopenia, neurotoxicity syndrome, graft-versus-host disease (GVHD), "On target off tumor" toxicity, etc., among which "On target off tumor" toxicity is related to the single mechanical killing and recognition mode of CAR-T cells.

[0004] Roybal et al. newly developed a SynNotch system in 2016, which is an "AND GATE" circuit system and has been successfully applied to CAR-T cell therapy. The action mode of the SynNotch system: Two corresponding antigens need to be expressed simultaneously on the surface of tumor cells to activate the specific killing function of SynNotch CAR-T (Syn-CAR-T) cells. Therefore, Syn-CAR-T cells can achieve the goal of intelligent recognition and killing of tumors, thereby improving the safety of CAR-T cell therapy. The SynNotch system only modifies and replaces the extracellular region, intracellular region, and downstream effector element of the wild-type Notch receptor, and retains the core regulatory region of the Notch receptor. The extracellular region (input recognition signal) can be replaced with the scfv molecule of a homologous specific antibody targeting various tumor cells (such as CD19-scfv), and the downstream effector element (output transcription signal) can be replaced with antibody scfv molecules, cytokines, immune activation or inhibition molecules, fluorescent proteins, etc. The NICD required for transcriptional regulation is replaced with an artificial transcription factor Gal4-VP64, which is a new fusion protein obtained by combining two natural transcription factors. The principle of the Gal4 / VP16-UAS expression system is that after the DNA binding domain of Gal4 binds to the upstream activation sequence (UAS), it can specifically activate the transcription of target genes, and the herpes simplex virus VP16 protein can enhance gene transcription and expression. This system has been widely used in the research of gene expression regulation.

[0005] SynNotch is a synthetic Notch receptor. The mouse Notch1 receptor is modified, with its extracellular domain replaced by a single-chain antibody (scfv of antibody A), and its intracellular domain replaced by the transcriptional activation domain Gal4VP64, while only retaining the transmembrane core domain (NC) that can be recognized and cleaved by proteases. The Notch receptor protein consists of an extracellular domain fragment (NECD), a transmembrane domain fragment (TMD), and an intracellular domain fragment (NICD). When the receptor in the extracellular region binds to the ligand, its conformation changes, exposing the cleavage site, which is recognized and cleaved by metalloprotease and γ-secretase. After cleavage, the intracellular domain NICD is released. NICD can translocate into the nucleus through the nuclear localization signal NSL and act as a transcription factor, thereby activating the downstream signaling pathway.

[0006] The response program of the SynNotch system represents a strategy for reconstructing T cell responses. Taking SynNotch CAR-T cells as an example, two corresponding antigens need to be expressed simultaneously on the surface of tumor cells to activate the specific killing function of CAR-T cells. Therefore, SynNotch CAR-T cells can achieve the goal of precisely recognizing and killing tumors. However, the SynNotch system is relatively large. The system control elements include the Notch receptor core region, the intracellular transcription factor Gal4VP64, the UAS recognition sequence, and the internal promoter, which are about 2.5 kb in total. The input signal molecules (such as CD19-scfv) and output signal molecules (such as BCMA-CAR) in the editable region of the system are about 2.5 kb in total. The entire system occupies about 5 kb and needs to be delivered through two lentiviral vector plasmids, namely a GAL4 induction vector and a UAS effector vector. Therefore, when transducing target cells, not only two kinds of lentiviral vectors need to be prepared, but also dual-virus transduction of target cells is required.

[0007] The SynNotch system also faces a problem. When the UAS effector vector is not activated, it does not express effector molecules, and flow cytometry cannot detect the transduction efficiency unless an additional promoter is added to express a fluorescent protein signal alone for detecting the transduction efficiency. Using lentiviral vectors for dual-virus transduction of T cells will cause a preparation and production problem, that is, the efficiency of preparing double-positive T cells is low, and flow cytometry sorting and enrichment are required to obtain T cells with a high double-positive rate. In addition, due to the toxicity problem of the VSV-G envelope protein of lentiviral vectors and the use of the third-generation self-inactivating lentiviral vector for packaging, it can only be transiently transfected and packaged, cannot be prepared on a large scale, has a low packaging titer, and requires enrichment and purification, which greatly limits the clinical application of Syn-CAR-T cell therapy. Due to the above reasons, the application of the SynNotch system in CAR-T cell therapy is greatly limited, and further optimization of the receptor system or vector is needed.

[0008] The problem of low preparation efficiency faced by delivering the SynNotch system via lentiviral vectors can be solved by replacing the viral vectors for packaging. Commonly used viral vectors currently include γ-retroviral vectors (γ-RV). γ-RV belongs to simple retroviruses, with a diameter of about 100 nm, an envelope, and a genome consisting of two copies of positive-strand RNA. The genome size is about 8.3 kb, and the genome only includes two LTRs, Gag-Pol, and Env. γ-RV can only transduce dividing cells and cannot transduce non-dividing cells. It can integrate into the host genome, has a high packaging titer, and inserting an exogenous target gene larger than 4 kb will greatly reduce the vector packaging titer. To further improve the safety of γ-RV and reduce the generation of replication-competent RCR, the U3 promoter of the 3’LTR of γ-RV is deleted to transform it into a self-inactivating γ-retroviral vector (SIN-RV).

[0009] γ-RV vectors have a mature large-scale stable transfection and packaging method with a high production titer. However, retroviral vectors randomly integrate into the host chromatin, posing a risk of insertional mutagenesis to induce the expression of host proto-oncogenes. The U3 enhancer of SIN-RV is deleted, reducing the carcinogenic risk and greatly improving the safety of the vector. The challenge faced by SIN-RV is the difficulty of large-scale production of viral vectors. Due to the deletion of the U3 element, a stable transfection and packaging cell line cannot be constructed and can only be obtained through transient transfection and packaging, making it difficult to scale up production. Moreover, it is very difficult to screen out cell clones that stably transfect SIN-RV using traditional methods. Summary of the Invention

[0010] To solve the above problems, the present invention provides a method for preparing Syn-CAR-T cells, which includes: Step 1: constructing a stably transfected SIN-γ-RV vector, i.e., the PSR vector, using the PiggyBac transposon system; Step 2: preparing a SynCAR plasmid vector: expressing the SynNotch system using the PSR vector prepared in Step 1, combining the GAL4 induction vector and the UAS effector vector of the SynNotch system on one PSR vector, so that the SynNotch system is delivered by one PSR vector, and constructing a plasmid of the Syn CAR retroviral vector; and Step 3: transducing T cells with the plasmid of the above retroviral vector to prepare the Syn-CAR-T cells.

[0011] The PiggyBac transposon (PB) system belongs to DNA transposons. Through the "cut - and - paste" mechanism, the target gene between the ITRs can be integrated into the genome of target cells and stably expressed for a long time. In the PB system, the ends of the PB transposon are 13 - bp inverted repeat sequences (ITRs), and the PB transposase is expressed by a separate plasmid. Regarding the PB integration mechanism, after double - plasmid transfection, the PB transposase recognizes the ITRs at both ends of the vector, excises from both ends of the ITRs to become free PB transposons (carrying the target gene), the genomic TTAA site is cut to form sticky ends, and the PB transposon is inserted into the "TTAA" site of the genome for integration.

[0012] In one embodiment, the plasmid of the Syn CAR retroviral vector is the plasmid of the PSR.SynNotch vector targeting CD19 molecule, BCMA molecule, CD38 molecule, or GPC3 molecule.

[0013] In one embodiment, the plasmid of the Syn CAR retroviral vector is the plasmid of the PSR.SynNotch vector targeting CD19 molecule.

[0014] In one embodiment, in step 1, the 5’LTR, 5’UTR, and 3’SIN - LTR sequences of the SIN - γ - RV vector are sequentially inserted between the 5’ITR and 3’ITR sequences of the PB transposon in the PiggyBac transposon system; the non - coding region UTR includes the Ψ element serving as the packaging signal for the viral vector and the SD serving as the splicing donor site, and the U3 region in the 3’SIN - LTR sequence is deleted, only retaining the R region and the U5 region.

[0015] In one embodiment, all Gag and Pol coding region sequences and the start codon ATG are deleted from the 5’UTR.

[0016] In one embodiment, the effector molecule UAS tagBFP of the SynNotch system and the inducible receptor SFFV_scfv Notch Gal4VP64 are respectively inserted between the 5’LTR and 3’SIN - LTR, and the inducible receptor protein is expressed under the initiation of the SFFV promoter.

[0017] In one embodiment, the P2A - EGFP fluorescent protein is added downstream of the GAL4VP64 protein as a detection tag for the vector receptor proteins CD19 scfv, BCMA scfv, CD38 scfv, or GPC3 scfv.

[0018] In one embodiment, Syn - CAR - T cells constructed by the above - mentioned method are provided.

[0019] In one embodiment, there is provided the use of the above-mentioned Syn-CAR-T cells in the preparation of anti-tumor drugs.

[0020] In one embodiment, there is provided a pharmaceutical composition for treating tumors, which comprises the CAR-T cells as claimed in claim 8, and a pharmaceutically acceptable carrier, diluent or excipient.

[0021] In one embodiment, there is provided a method for inhibiting tumor cells in vitro, which includes contacting the tumor cells with the above-mentioned CAR-T cells or the above-mentioned pharmaceutical composition, so as to inhibit the tumor cells.

[0022] The PiggyBac transposon (PB) system belongs to DNA transposons. Through the "cut-and-paste" mechanism, the target gene between the ITRs can be integrated into the genome of target cells and stably expressed for a long time. The present invention combines the PiggyBac transposon system and SIN-RV to construct a vector (PSR) stably transfected with SIN-RV. For convenient and rapid screening of cell clones stably transfected with SIN-RV, a fluorescent protein CopGFP and a puromycin drug screening gene are inserted during vector design. Theoretically, the packaging element of the novel PSR vector designed in the present invention is only 1.1 kb, while that of the classical MFG vector is 2.6 kb, greatly improving the vector packaging capacity. Moreover, the CopGFP and puromycin drug screening genes on the PSR vector greatly improve the screening efficiency of cell clones stably transfected with SIN-RV.

[0023] The present invention uses the PSR vector to express the SynNotch system, combines the GAL4 induction vector and the UAS effector vector on one PSR vector (single vector system). Only one PSR.SynNotch vector needs to be constructed for virus packaging, and a single virus vector transduces target cells. When the UAS effector element is not activated and not expressed, the transduction efficiency can be detected by the tag of the GAL4 induction element. The PSR.SynNotch system of the present invention not only solves the problem that it is difficult to detect the transduction efficiency of downstream effector molecules in the original double-vector system, but also solves the problem of low efficiency in preparing double-positive cells by transducing target cells with double vectors. Most importantly, a stably transfected packaging cell line can be constructed for large-scale production, which is very beneficial to the application of the SynNotch system.

[0024] To further verify the induction efficiency of the SynNotch system in the PSR.Syn vector, the present invention selected 4 tumor antigens (human BCMA antigen, human CD38 antigen, human CD19 antigen, human GPC3 antigen) as targets, and constructed PSR.SynCAR vectors respectively. To facilitate the detection of the induction efficiency of the SynNotch system, the downstream effector molecule of UAS will select the fluorescent protein tagBFP. After co-culturing with the corresponding tumor cells, the activation efficiency of the SynNotch receptor in the PSR.Syn vector can be evaluated by detecting the expression efficiency of tagBFP, and the target with the optimal induction efficiency can be screened out. The results show that the induction efficiencies of the targets BCMA, CD38, and GPC3 are extremely low and are not suitable for the SynNotch system; the target CD19 has the highest induction efficiency and is most suitable for application in the SynNotch system. Because CD19-Syn-CAR-T cells recognize CD19 antigen-positive tumor cells, expose the cleavage site, and release the artificial transcription factor Gal4-VP64 by cleavage. Gal4-VP64 enters the nucleus through the nuclear localization signal NSL and binds to the upstream activation sequence UAS to activate the expression of downstream effector molecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] To more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required for the embodiments. Obviously, the drawings described below are only some embodiments recorded in the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0026] Figure 1 It is a schematic diagram of the plasmid design of the PSR vector of the present invention;

[0027] Figure 2 It is a schematic diagram of the plasmid design of the PSR.Syn.BFP of the present invention;

[0028] Figure 3 It is a result diagram of the flow cytometry detection of the transduction efficiency of Syn-CAR-T of the present invention;

[0029] Figure 4 It is a result diagram of the flow cytometry detection of the induction efficiency after the incubation of Syn-CAR-T cells and tumor cells of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all of them. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application. Example 1 Construction of PSR.SynNotch Vector

[0031] I. Experimental Materials and Methods

[0032] DH5α competent cells were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. PB transposon plasmid and PB transposase plasmid were purchased commercially. Plasmids pCDH-CMV-TNFRSF17 (human), pHR_PGK_antiCD19_synNotch_Gal4VP64, pHR_Gal4UAS_tBFP_PGK_mCherry, pCDH-CMV-TNFRSF17 (human)-EF1a-CopGFP-T2A-Puro were purchased from Wuhan Miaoling Biotechnology Co., Ltd. Other genes EGFP, WPRE, SFFV were from commercial plasmids. Pheonix-Ampho cells and PG13 cells were purchased from the American Type Culture Collection (ATCC). 293T cells were purchased from the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences & Peking Union Medical College.

[0033] Pyrobest DNA polymerase, TAKARA BIO Inc., Japan; Plasmid purification kit, QIAGEN, Germany; 50×TAE gel electrophoresis buffer; Ethidium bromide (EB) nucleic acid staining solution, Solarbio Science & Technology Co., Ltd., Beijing; 6×DNA loading buffer, TAKARA; Sodium chloride, agarose, yeast powder, tryptone, agarose, dimethyl sulfoxide (DMSO solution), Sigma-Aldrich Co., LLC, USA; Absolute ethanol, Beijing Chemical Industry Group Co., Ltd.; PCR product purification kit, Novoprotein Scientific Inc., Nanjing; DNA Assembly Mix Plus, Puromycin dihydrochloride, Beijing Lamboid Trading Co., Ltd.; Endotoxin-free midiprep plasmid extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd.; Ampicillin powder, BioRuler, USA. DMEM medium, Opti-MEM medium, fetal bovine serum (FBS), trypsin (1×EDTA), phosphate buffer (1×PBS), 100× penicillin-streptomycin solution (P / S), Gibco, USA; FuGene HD transfection reagent, Promega, USA; Retronectin (recombinant human fibronectin fragment), Takara, Japan; Trypan blue solution, Invitrogen, USA. Polybrene virus infection enhancement reagent, Solarbio Science & Technology Co., Ltd., Beijing. The reagents and raw materials used in the present invention are all from commercial reagents unless otherwise specified.

[0034] (I) Construction of PSR vector

[0035] The present invention constructs a stable transfection SIN-γ-RV vector (PSR) using the PB transposon system (PB transposon plasmid and PB transposase plasmid), which can stably produce a self-inactivating retroviral vector. The specific design schematic diagram is as Figure 1As shown in the figure. The 5' LTR of the SIN-γ-RV vector, the non-coding region UTR (the Ψ element is the packaging signal of the viral vector, and SD is the splicing donor site), and the 3' SIN-LTR sequence are inserted between the 5' ITR and 3' ITR sequences of the PB transposon. According to the description in SCHAMBACH A, MUELLER D, GALLAM, et al. Overcoming promoter competition in packaging cells improves production of self-inactivating retroviral vectors [J]. Gene Therapy, 2006, 13(21): 1524-33, the SIN-γ-RV vector was designed based on pSRS11.SF.GFP. SFFV is the internal promoter of the PSR vector. To facilitate the insertion of the target gene in the later stage, a multiple cloning site sequence (MCS) was inserted after the SFFV promoter. To improve the packaging titer of the viral vector, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence was inserted at the C-terminus of the MCS. To facilitate the screening of stable transfected cell lines, two screening tags were designed. hEF1-HTLV promoter-CopGFP-T2A-Puro was inserted after the 3' SIN-LTR element, where the Puro gene can be used for puromycin drug screening, and the CopGFP gene can be used for the later fluorescence microscopy screening of highly expressed monoclonal cells. All Gag and Pol coding region sequences and the start codon ATG were deleted from the 5' end packaging signal non-coding region (5'UTR), thereby further improving the vector packaging capacity and vector safety. The designed vector PSR.MCS was sent to Genewiz Biotechnology Co., Ltd. for gene synthesis.

[0036] (II). Design and construction of PSR.SynNotch plasmids targeting different antigens

[0037] Since the downstream effector molecule needs to be induced by the transcription factor Gal4VP64 and cannot be placed downstream of the promoter, it should be designed upstream of the internal promoter and the Gal4-induced receptor. The plasmids of the PSR.SynNotch vectors targeting CD19 molecule, BCMA molecule, CD38 molecule, and GPC3 molecule were named PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.GPC3.BFP (p170). The schematic diagrams of the four plasmid designs are as Figure 2As shown, between the 5’LTR and the 3’SIN-LTR, the effector molecule (UAS tagBFP) of the SynNotch system and the inducible receptor (SFFV_scfv Notch Gal4VP64) are inserted respectively. The inducible receptor protein is expressed under the initiation of the SFFV promoter. Additionally, a P2A-EGFP fluorescent protein is added downstream of the GAL4VP64 protein as a detection tag for the vector receptor proteins (CD19scfv, BCMAscfv, CD38 scfv, GPC3scfv).

[0038] 5’LTR (SEQ ID NO.1): ATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTaTTCCCAATAAAgCCTCTTGCTGTTTGCATCCGAATCGTGGaCTCGCTGaTCCTTGGGAGGGTCTCCTCaGAtTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0039] 5’UTR (SEQ ID NO.2): TTGGAGACCCCTGCCCAGGGACCACCGACCCCCCCGCCGGGAGGTAAGCTGGCCAGCGGTCGTTTCGTGTCTGTCTCTGTCTTTGGGCGTGTTTGTGCCGGCATCTAGTGTTTGCGCCTGCGTCTGTACTAGTTGGCTAACTAGATCTGTATCTGGCGGTCCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCCTGGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCTACCCGAGTCGGACTTTTTGGAGCTCCGCCACTGTCCGAGGGGTACGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCGCCCCCGTCTGAATTTTTGCTTTCGGTTTTACGCCGAAACCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGCGGCCCG

[0040] 3’SIN-LTR (SEQ ID NO.3): ATGAAAGACCCCACCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTGTTCtCAATAAACCCTCTTGCaGTTGCATCCGAcTCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0041] The construction of the 4 plasmids was composed of 4 target DNA fragments and a vector, which were ligated by seamless cloning. The construction of the 4 plasmids was all composed of 4 DNA fragments and a vector. Among them, 3 DNA fragments and the vector fragment were the same in each plasmid, only the template plasmid of the SFFV_scfv Notch Gal4 fragment was different. The 4 fragments of the p167 plasmid were as follows: Fragment 1 (UAS tagBFP), the template was from pHR_Gal4UAS_tBFP_PGK_mCherry (Wuhan Miaoling); Fragment 2, the template was from pHR_PGK_antiCD19_synNotch_Gal4VP64 (Wuhan Miaoling); Fragment 3 (P2A EGFP), Fragment 3 was a fusion fragment of EGFP and P2A, pBT2-4xUAS:P2A-EGFP (addgene#127591); Fragment 4 (WPRE), Fragment 8 was the vector fragment after double digestion. The SFFV_scfv Notch Gal4 of the remaining 3 plasmids were Fragment 5, Fragment 6, and Fragment 7 respectively, and the templates were replaced with anti BCMA scfv, anti CD38 scfv, and anti-GPC3-scfv respectively on the basis of Fragment 2. Among them, anti BCMA scfv was from the FDA-approved bb2121 anti-BCMA antibody; anti CD38 scfv was screened by the phage display antibody library technology of this research team and had been proven to have strong killing functions in in vitro and in vivo experiments. For details, see LI X, FENG Y, SHANG F, et al. Characterization of the Therapeutic Effects of Novel Chimeric Antigen Receptor T Cells Targeting CD38 on Multiple Myeloma[J]. Frontiers In Oncology, 2021, 11:703087; anti BCMA scfv was from the commercial antibody mouse GC33 clone. Homologous arms needed to be added to the amplification primers. Among them, the primers of Fragment 2, Fragment 5, Fragment 6, and Fragment 7 were the same. The primer sequences are shown in Table 1 below. The vector plasmid was PSR.MCS, and the restriction endonucleases were XhoI and NotI-HF. The PCR products and the enzyme-digested products were subjected to agarose gel electrophoresis and gel recovery.

[0042] Table 1 Design of PCR amplification primers for four targeted PSR.SynNotch plasmids

[0043]

[0044] Note: The underlined part is the homologous arm.

[0045] Among them, the S-16-1F sequence number is SEQ ID NO.4, the S-16-1R sequence number is SEQ ID NO.5, the S-16-2F sequence number is SEQ ID NO.6, the S-16-2R sequence number is SEQ ID NO.7, the S-16-3F sequence number is SEQ ID NO.8, the S-16-3R sequence number is SEQ ID NO.9, the S-16-4F sequence number is SEQ ID NO.10, and the S-16-1R sequence number is SEQ ID NO.11.

[0046] The preparation processes of the target fragments are as follows: PCR amplification, agarose gel electrophoresis, and gel extraction. Finally, the 4 recovered target fragments are recombinantly ligated, and the ligation reaction is carried out at 50 °C for 30 min. The ligation product is transformed into competent Escherichia coli DH5α and then spread on an LB plate, cultured overnight at 37 °C, 3 - 5 positive clones are selected for expanded culture, and the plasmid is extracted and sent to the company for sequencing. The plasmid strains with correct sequencing are selected for expanded culture, and the plasmid is extracted and concentrated.

[0047] (III). Preparation of Four Vectors PSR.Syn.BFP Self-Inactivating Retroviral Vectors

[0048] After resuscitating Pheonix-Ampho cells and PG13 cells, the cell state is good. The cell passage number is preferably within 5 generations, and when the cell confluence is approximately 80%, the cells are digested and inoculated into a six-well plate with a cell density of 5×10 5 cells / well, 2 mL per well, and 4 wells are reserved for later flow cytometry to detect the transfection efficiency. On the second day after inoculation, when the cell confluence is 70% - 80%. Remove the culture medium, and add fresh warm Opti-MEM medium drop by drop, 1.8 mL per well. Calculate the volume of the plasmid required for transfection, and add 3.3 μg of plasmid per well. The transfection plasmids are PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.GPC3.BFP (p170), which are diluted to 200 μL / well with Opti-MEM medium, gently pipetted to mix well, and incubated at room temperature for 10 min. The transfected complex after incubation is added drop by drop and evenly into the six-well plate, 200 μL per well, gently mix the six-well plate crosswise, and place it in a 37 °C, 5% CO 2 cell incubator for culture.

[0049] 24 h after transfection, remove the supernatant of the six-well plate, and replace it with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and place it at 32 °C, 5% CO 2Cultured in a cell incubator. After culturing at 32°C for 24 h, gently aspirate the supernatant (viral vector supernatant at 48 h), replace it with fresh and warm 10% FBS-DMEM medium, 2.5 ml / well, and continue to place it at 32°C, 5% CO 2 Cultured in a cell incubator. After culturing for 24 h, collect the cell supernatant (viral vector supernatant at 72 h). The collected supernatant is filtered and purified using a 0.45-μm disposable needle filter. The filtered viral vector is immediately aliquoted and stored at -80°C in a refrigerator.

[0050] (IV). Preparation of Syn-CAR-T

[0051] Collect 10 mL of healthy volunteer venous blood, extract PBMC cells, add IL-2 and OKT-3 to activate T cells, and culture them in AIM-V complete medium for 48 h. Then transduce the T cells with the above-prepared 4 kinds of retroviral vector supernatants PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), PSR.Syn.GPC3.BFP (Syn-CAR170). The transduction reagent used is retronectin.

[0052] One day before transduction, add the transduction reagent Retronetin to a Non-treated 12-well plate for incubation, that is, add 1 mL of 1×PBS solution and 10 μL of Retronetin reagent to each well, and mix well. Store it in the dark at 4°C. 48 h after T cell activation, observe the growth state of T cells. If the T cells grow in large clusters, the growth state is good and viral vector transduction of T cells can be carried out. Take out the Non-treated 12-well plate incubated with Retronetin, and recover the Retronetin supernatant in the 12-well plate. Add 2% BSA for neutralization for 30 min. Wash with 1×PBS solution to remove the PBS solution. Add 1 mL of retroviral vector supernatant (Syn-CAR167, Syn-CAR168, Syn-CAR169, Syn-CAR170) to each well, and centrifuge at 2500 rpm for 60 min at 32°C. Treat the T cells, take 5×106 cells / well, add 1 mL of retroviral vector supernatant and mix well, and centrifuge at 2500 rpm for 60 min at 32°C. After centrifugation, place it back in the cell incubator for incubation for at least 1 h. After incubation, add the retroviral vector supernatant again and centrifuge for 1 h for transduction. After centrifugation, place it back in the incubator for incubation for at least 1 h. After incubation, centrifuge the cells in each well and replace them with 1 mL of fresh AIM-V complete medium for culture, and add IL-2, 1 μL / well. Place it back in the incubator for culture. If the viral vector titer is low, transduction can be continued the next day, and the method is the same as the first day.

[0053] After transduction for 48 h, an appropriate amount of Pan-T cells were taken as blank controls, and flow cytometry was used to detect the transduction efficiency. The positive rate of EGFP was taken as the transduction efficiency.

[0054] (V). Culture of target cells

[0055] RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were resuscitated from the liquid nitrogen tank respectively. RPMI-CD19, K562-hBCMA, and RPMI cells were aseptically cultured in RPMI complete medium in a 37 °C, 5% CO2 cell incubator, and passaged with RPMI complete medium every 48 h to make the cell density 5×105 cells / mL. After culturing to the logarithmic growth phase, they were used for subsequent experiments until the end of the experiment. HepG2 cells were aseptically cultured in MEM complete medium in a 37 °C, 5% CO2 cell incubator, and passaged with MEM complete medium every 48 h to make the cell density 5×105 cells / mL. After culturing to the logarithmic growth phase, they were used for subsequent experiments until the end of the experiment.

[0056] (VI). Co-incubation culture of Syn-CAR-T cells and target cells

[0057] Observe the growth status of target cells and Syn-CAR-T cells. When the cell status is good, co-incubation culture can be carried out. The co-incubation culture is divided into 5 groups in total. Syn-CAR167 was co-cultured with RPMI-CD19 and RPMI respectively. Syn-CAR168 was co-cultured with K562-hBCMA. Syn-CAR169 was co-cultured with RPMI. Syn-CAR170 was co-cultured with HepG2. The target cells and Syn-CAR-T cells were counted. The co-incubation culture ratio of effector cells to target cells was 1:1. 5×10 5 cells were placed in a 1.5 mL centrifuge tube. Centrifuge at 300 g for 5 min. Carefully remove the supernatant and resuspend with AIM-V complete medium. Mix the effector cells and target cells in each group and supplement IL-2. Place them back in the incubator for culture. After culturing for 48 h, the cells were processed for flow cytometry detection. The flow cytometry detection was divided into 9 groups, with 5 co-incubation groups and 4 non-incubation groups.

[0058] II. Experimental results

[0059] (I) Four PSR.SynNotch plasmids targeting different antigens were successfully constructed

[0060] In this experiment, the lentiviral dual-vector of the original SynNotch system was modified into a single vector of PSR (stable self-inactivating γ-retroviral vector) for transduction, namely PSR.SynNotch. To verify the induction efficiency of the PSR.SynNotch system for different antigen targets, 4 antigen-targeted PSR.SynNotch vectors were designed, namely targeting CD19, BCMA, CD38, and GPC3 respectively, and the effector molecule after induction was the reporter gene tagBFP fluorescent protein. Since the downstream effector molecule needs to be induced by the transcription factor Gal4VP64 and cannot be placed downstream of the promoter, it was designed upstream of the internal promoter and the Gal4-inducible receptor. The 4 constructed plasmids, PSR.Syn.CD19.BFP, PSR.Syn.BCMA.BFP, PSR.Syn.CD38.BFP, and PSR.Syn.GPC3.BFP, were downloaded from the official website of the sequencing company, and the sequencing results were analyzed and compared using the biological software SnapGene. The sequencing results were correct. Therefore, 4 vector plasmids, PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.Syn.GPC3.BFP (p170), were successfully constructed in this experiment.

[0061] (II) Successfully prepared 4 types of Syn-CAR-T cells with different targets

[0062] The 4 successfully constructed plasmids were transiently transfected into Ampho cells. The viral vectors were harvested 48 h and 72 h after transfection, namely PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170). Volunteers were recruited to collect venous blood. After separating PBMC, they were activated and cultured for 48 h, and the harvested viral vectors were transduced into T cells. The transduction efficiency was detected by flow cytometry 48 h after transduction. Since P2A-EGFP was added as a molecular tag at the C-terminus of Gal4VP64, the positive rate of EGFP detected by flow cytometry could be used as the transduction efficiency of T cells. The flow cytometry results are as follows Figure 3 As shown, the transduction efficiencies of the 4 types of Syn-CAR-T were 50.0%, 30.36%, 36.36%, and 41.68% respectively. The transduction efficiency was greater than 30%, proving that 4 types of Syn-CAR-T cells were successfully prepared in this experiment.

[0063] (III) Function verification of 4 types of Syn-CAR-T cells with different targets

[0064] Resuscitate and culture the target cells RPMI-CD19, K562-hBCMA, RPMI, and HepG2 respectively. Four different antigen-targeted Syn-CAR-T cells are co-incubated with the corresponding target cells at a ratio of 1:1 for 48 h. There are a total of 5 groups of co-incubation. Syn-CAR167 is co-cultured with RPMI-CD19 and RPMI respectively, Syn-CAR168 is co-cultured with K562-hBCMA, Syn-CAR169 is co-cultured with RPMI, and Syn-CAR170 is co-cultured with HepG2 respectively. There are 4 groups without incubation, namely Syn-CAR167, Syn-CAR168, Syn-CAR169, and Syn-CAR170. The flow cytometry results are as follows Figure 4 As shown. When the 4 types of Syn-CAR-T were not co-incubated with tumor cells, there was a low background leakage expression of the effector molecule tagBFP fluorescent protein. The MFI (mean fluorescence intensity) values of the 4 types of Syn-CAR-T were 3344, 3228, 4986, and 3257 respectively, all higher than that of the Control group (2567); when the 4 types of Syn-CAR-T were co-incubated with CD19+, BCMA+, CD38+, and GPC3+ tumor cells respectively, only Syn-CAR167 had the highest induction efficiency (MFI: 17528), and the MFI value was 5.2 times that when not incubated (3344). When Syn-CAR167 was co-cultured with RPMI (CD19-), the induction efficiency was extremely low, and the MFI value was the same as that when not incubated, proving that Syn-CAR167-T cells can be specifically induced to express, and only co-incubation with CD19-positive cells can induce expression. The MFI values of the induction groups of the remaining 3 groups of Syn-CAR-T were similar to those of the non-induced groups, indicating that the induction efficiencies of the targets BCMA, CD38, and GPC3 were extremely low and not suitable for the SynNotch system. In summary, the target CD19 has the highest induction efficiency and is most suitable for application in the SynNotch system.

[0065] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A method for preparing Syn-CAR-T cells, characterized in that: The method comprises: Step 1: Use the PiggyBac transposon system to construct a stable transfection SIN-γ-RV vector, namely the PSR vector; Step 2: preparing Syn CAR plasmid vector: using the PSR vector prepared in step 1 to express the SynNotch system, combining the GAL4 inducible vector and the UAS effector vector of the SynNotch system on one PSR vector, so that the SynNotch system is delivered by one PSR vector, and constructing the plasmid of the Syn CAR retroviral vector; Step 3: transducing the plasmid of the above retroviral vector into T cells to prepare the Syn-CAR-T cells; The plasmid of the Syn CAR retroviral vector is a plasmid of a PSR.SynNotch vector targeting the CD19 molecule; The 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element for a viral vector packaging signal and a SD for a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region; The effector molecule UAS tagBFP and the inducible receptor SFFV _scfv Notch Gal4VP64 of the SynNotch system were inserted between the 5'LTR and 3'SIN-LTR, respectively. The inducible receptor protein was expressed by the SFFV promoter, and the effector molecule was upstream of the SFFV promoter and the inducible receptor.

2. The method according to claim 1, characterized in that The 5'UTR deleted all Gag and Pol coding sequences and the start codon ATG.

3. Syn-CAR-T cells constructed according to any one of claims 1-2.

4. The Syn-CAR-T cell according to claim 3, characterized in that It is a Syn-CAR-T cell targeting CD19.

5. Use of the Syn-CAR-T cells described in claim 3 in the preparation of anti-tumor drugs.

6. A pharmaceutical composition for treating tumors, characterized in that: The pharmaceutical composition contains the CAR-T cells according to claim 3, and a pharmaceutically acceptable carrier, diluent or excipient.

7. A method for inhibiting tumor cells in vitro, characterized in that: The method comprises contacting a tumor cell with the CAR-T cell according to claim 3 or the pharmaceutical composition according to claim 6, thereby inhibiting the tumor cell.

Images