Protease mutant NPR-M136 with improved soybean meal antigen protein degradation rate as well as coding gene and application of protease mutant NPR-M136

Abstract

The invention provides a protease mutant NPR-M136 with improved soybean meal antigen protein degradation rate as well as a coding gene and an application of the protease mutant NPR-M136. Protease belongs to a metalloproteinase family member, a protease mutant NPR-M136 is obtained after random mutation and directional screening, and compared with wild type protease, the protease mutant NPR-M136 has the advantages that the soybean meal antigen protein degradation rate is increased to 59.5% from 46% under the same enzyme activity addition amount, the improvement range is 25%-30%, and the degradation rate effect is remarkable. When the protease mutant is applied to the fields of feed, additives and the like, the degradation efficiency of soybean antigen protein can be remarkably improved, the application effect of protein feed raw materials is effectively improved, so that adverse reactions such as allergic diarrhea are reduced, the effects of reducing cost and improving efficiency are achieved, and the protease mutant has a good market application prospect.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and enzyme engineering, and particularly relates to a protease mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, a coding gene and application thereof. Background Art

[0002] Soybean antigenic proteins refer to some macromolecular proteins or glycoproteins in soybeans and their products, which can cause allergic reactions in humans or livestock and poultry. There are 32 confirmed soybean antigenic proteins, among which soybean globulin and β-conglycinin are the most immunogenic soybean antigenic proteins, accounting for 65% to 80% of the total protein in soybean seeds, and are the main antigenic proteins in soybeans. The anti-nutritional effects of soybean antigenic proteins mainly include: reducing the utilization rate of feed protein; increasing the secretion of endogenous protein, leading to increased fecal nitrogen; some sensitive animals will have allergic reactions, leading to diarrhea, decreased production performance and even death. For example, globulins and conglycinins in soybeans can cause intestinal allergies in animals such as piglets and calves, causing intestinal damage, villous atrophy, glandular crypt hyperplasia, decreased intestinal digestion and absorption capacity, and reduced number and activity of mucosal disaccharide degrading enzymes.

[0003] Proteases are a class of enzymes that catalyze the hydrolysis of peptide bonds in proteins and are widely found in animals, plants, and microorganisms. Adding protease preparations is one of the effective means to degrade soybean antigen proteins. This study screened out a protease mutant with improved degradation rate of soybean meal antigen protein through candidate gene screening and active site mutation, which will have broad application prospects in feed additives, breeding and other fields. Summary of the invention

[0004] The present invention provides a protease mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, its encoding gene and application. When the protease mutant is used in the fields of feed, additives, etc., it can improve the degradation efficiency of soybean antigen protein, effectively improve the application effect of protein feed raw materials, reduce adverse reactions such as allergic diarrhea, and play a role in reducing costs and increasing efficiency.

[0005] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: The invention provides a protease mutant NPR-M136 with improved degradation rate of soybean meal antigen protein. The amino acid sequence of the protease mutant NPR-M136 is shown in SEQ ID NO: 3, and the amino acid sequence is obtained by changing the lysine at position 184 of the protease of SEQ ID NO: 1 into arginine, the asparagine at position 223 into aspartic acid, and the phenylalanine at position 267 into leucine.

[0006] The present invention also provides a gene encoding the protease mutant NPR-M136, and the nucleotide sequence thereof is shown in SEQ ID NO:4.

[0007] The invention also provides a recombinant expression vector containing the protease mutant encoding gene.

[0008] The invention also provides a recombinant engineering bacterium containing the protease mutant encoding gene.

[0009] Furthermore, the recombinant engineered bacteria is any one of Bacillus subtilis, Bacillus licheniformis, yeast GS115, and Escherichia coli BL21.

[0010] The present invention also provides a method for preparing the protease mutant, comprising the following steps: (1) Connect the coding gene of the protease mutant NPR-M136 to the pWB980 vector to obtain a recombinant expression vector, transform it into competent cells, and use the resistance marker to screen positive clones to obtain recombinant genetically engineered bacteria; (2) subjecting the recombinant genetically engineered bacteria to shake flask fermentation and shaking culture to produce protease mutants; (3) The recombinant genetically engineered strain after shake flask fermentation is inoculated into a fermentation tank to expand the fermentation culture to obtain the fermentation liquid or spray-dried powder of the protease mutant NPR-M136.

[0011] Furthermore, the parameters of the expanded fermentation culture are: natural pH, temperature 35-40° C., stirring rate 600-800 rpm, ventilation volume 1.5 (v / v), and dissolved oxygen controlled at more than 20%.

[0012] Furthermore, the culture medium for the expanded fermentation culture comprises the following components, in percentage by mass: 5-10% soybean meal, 1-5% corn flour, 0.1-1.0% PPG-20000, 0.1-1.0% protease, 0.1-1.0% amylase, 0.2-0.5% disodium hydrogen phosphate 12-hydrate, and the remainder is water.

[0013] The present invention also provides the use of the protease mutant NPR-M136 in preparing feed additives or food additives.

[0014] Furthermore, the feed additive or food additive contains the protease mutant NPR-M136 or a recombinant bacterium containing the protease mutant NPR-M136.

[0015] Compared with the prior art, the advantages and beneficial technical effects of the present invention are as follows: the protease mutant gene provided by the present invention belongs to a member of the metalloprotease family, and after random mutation and directional screening, a protease mutant NPR-M136 is obtained, and compared with the wild-type protease, the degradation rate of soybean meal antigen protein is increased from 46% to 59.5% at the same enzyme activity addition amount, and the increase range is between 25% and 30%. Therefore, the degradation efficiency of antigen protein and the utilization rate of protein feed are improved, while saving costs and reducing environmental pollution, and it has good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the enzymatic property result of the protease mutant NPR-M136 in the present invention.

[0017] Figure 2 The protease mutant NPR-M136 of the present invention degrades soybean meal and SDS-PAGE, wherein No. M is a protein marker; No. 1-2 is a control group, No. 3-5 is other samples; No. 6-7 is an experimental group; No. 8 is a blank group (soybean meal plus water).

[0018] Figure 3 The protease mutant NPR-M136 in the present invention is used to quantitatively detect the degradation rate of soybean antigen protein by a kit method. DETAILED DESCRIPTION

[0019] In order to facilitate the understanding of the present invention, the present invention will be described in more comprehensive and detailed manner with reference to the accompanying drawings and embodiments below, but the protection scope of the present invention is not limited to the following specific embodiments.

[0020] The molecular biology experimental methods not specifically described in the following examples can be performed by referring to the specific methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook, or according to the kits and product instructions. The reagents and biological materials used in the specific examples can be obtained from commercial channels unless otherwise specified.

[0021] 1. Strains and vectors Bacillus subtilis WB600, plasmid pWB980, Escherichia coli BL21, and plasmid pET-21a(+) were purchased from Invitrogen, and T vector and DH5a Escherichia coli competent cells were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.

[0022] 2. Reagents and culture media Plasmid extraction kit, fragment purification and recovery kit, restriction endonuclease, etc. were purchased from Bao Biotechnology (Dalian) Co., Ltd.; GeneMorph II random mutation PCR kit was purchased from Stratagene; ampicillin, IPTG, etc. were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; protein marker: Blue Plus II Protein Marker (14-120 kDa) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0023] LB medium formula: 1% tryptone, 0.5% yeast extract, 1% NaCl.

[0024] Fermentation medium: soybean meal 50-80g / L, corn starch 60-100g / L, disodium hydrogen phosphate 2-4g / L, sodium carbonate 1-2g / L, natural pH.

[0025] 3. The soybean antigen protein detection kit is the soybean globulin and semi-soybean globulin kit produced by Longke Xinyu. The determination method is carried out according to the kit instructions.

[0026] Example 1: Construction of a protease mutant library by error-prone PCR Primers were designed based on the amino acid sequence of the protease derived from metalloprotease (NCBI: WP_013524383.1) (SEQ ID NO: 1) and the optimized DNA sequence (SEQ ID NO: 2). A BamH I restriction enzyme site was designed at the 5' end and a Xho I restriction enzyme site was designed at the 3' end.

[0027] Random mutation was performed using the GeneMorph II random mutation PCR kit with the gene of SEQ ID NO: 2 as a template. The primer sequences used are as follows: N36-F1: CGC GGATCC AAAGAAAGATCAATGGTTTG (SEQ ID NO:5); N36-R1: GCC CTCGAG TTAATAAACGCCAACTGCAT (SEQ ID NO: 6).

[0028] The reaction conditions were: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 1 min 30 s, for a total of 30 cycles.

[0029] The amplified random mutation PCR product was double digested with Xho I and BamH I, purified and recovered, and connected to the pET-21a (+) vector, transformed into E. coli BL21-DE3, and the positive clones were screened on an ampicillin-resistant LB plate to obtain pET-NPR0x. The synthesized original gene was connected to the pET-21a (+) vector and transformed into E. coli BL21-DE3 in the same way to obtain pET-NPR0.

[0030] The screened single colonies were inoculated into a 96-well deep-well plate. Two single colonies expressing NPR0 were inoculated into each plate as a control. 300 μL LB liquid culture medium (containing 100 μg / mL ampicillin) was placed in each well. After shaking and culturing at 37°C and 200 rpm for 4 hours, 50 μL of bacterial solution was transferred to a new 96-well plate for seed preservation. 200 μL LB-Amp culture medium containing IPTG was added to the remaining bacterial solution on the plate, so that the final concentration of IPTG was 1 mM and the final concentration of ampicillin was 100 μg / mL. The expression of protease was induced by shaking and culturing at 37°C and 200 rpm for 10 hours.

[0031] The induced bacterial liquid was repeatedly frozen and thawed to break it, and the broken cell liquid was centrifuged to take the supernatant for substrate plate verification screening, that is, an appropriate amount of fermentation liquid was spotted on a substrate plate containing 1% soybean meal powder, and cultured overnight at 37 degrees. Preliminary screening was performed based on the size of the hydrolysis circle. The larger the hydrolysis circle, the better the effect of hydrolyzing soybean meal protein. Then the activity of the protease was tested. After repeated testing, the mutant gene with a hydrolysis circle larger than the control was sequenced.

[0032] A mutant NPR-M136 with improved degradation rate of soybean meal antigen protein using NPR0 as the starting template was screened. After sequencing, the amino acid sequence of the mutant NPR-M136 was shown in SEQ ID NO: 3, and the nucleotide sequence of the encoding gene was shown in SEQ ID NO: 4, wherein the mutation site was K184R / N223D / F267L.

[0033] SEQ ID NO: 3 KERSMVWNEQWKTPSFVSGPLLKGEDAPEELVYRYLDQEKNTFQLGGQARERLSLIGKQTDELGHTVMRFEQRYHGIPVYGAVLVAHVNDGELSSLSGTLIPNLDKRTLKTEAAISVQQAEMIAKQDVADAVTKERPAAEEGKPTRLVIYPDGETPRLAYEVNVRFLTPVPGNWIYMIDAADGRVLNKWNQMDEAKPGGGQSVAGASTVGVGRGVLGDQKYIDTTYSSYYGYYYLQDNTRGSGIFTYDGRNRTVLPGSLWADGDNQLFASYDAAAVDAHYYAGVVYDYYKNVHGRLSYDGSNAAIRSTVHYGRGYNNAFWNGSQMVYGDGDGQTFLPFSGGIDVVGHELTHAVTDYTAGLVYQNESGAINEAMSDIFGTLVEFYANRNPDWEIGEDIYTPGIAGDALRSMSDPAKYGDPDHYSKRYTGTQDNGGVHTNSGIINKAAYLLSQGGVHYGVSVTGIGRDKMGKIFYRALVYYLTPTSNFSQLRAACVQAAADLYGSTSQEVNSVKQAFNAVGVY。

[0034] SEQ ID NO:4

[0035] Example 2: Expression verification of protease mutants in Bacillus subtilis The mutants NPR-M136 and NPR0 of Example 1 were respectively amplified and digested with the following primers and cloned into the Xho I and BamH I sites of the plasmid pWB980; referring to the Bacillus subtilis transformation method created by Spizizen, the above recombinant plasmids were transformed into Bacillus subtilis WB600 to obtain recombinant bacteria. After plate screening, the mutant of NPR-M136 was obtained. After the recombinant bacteria were shaken in the fermentation medium for 78 hours, the culture was centrifuged to obtain the supernatant, and the average enzyme activity of the supernatant of each mutant fermentation broth was determined. The fermentation supernatant of the transformant with the highest enzyme activity among the mutants was taken to determine its enzymatic properties.

[0036] The primer sequences used are as follows: N36-F2: CGC CTCGAG GAAAGAAAGATCAATGGTTTG (SEQ ID NO:7); N36-R2: GCC GGATCC TTAATAAACGCCAACTGCAT (SEQ ID NO:8).

[0037] Some enzymatic properties results are as follows Figure 1 The mutant NPR-M136 is relatively heat-resistant. After being treated at 75 degrees for 3 minutes, the remaining enzyme activity reaches more than 80%; it maintains more than 80% enzyme activity above pH 7.0 and has high acid resistance. Good acid resistance is more conducive to its application in feed, food and other fields.

[0038] Example 3: Fermentation and preparation of protease mutants in a 30 L fermenter The recombinant bacteria expressing protease NPR0 and protease mutant NPR-M136 in Example 2 were streaked on LB plates containing kanamycin (final concentration of 20 μg / mL) resistance, cultured at 37°C until single colonies grew, and single colonies with good growth were picked and continued to be streaked on LB plates containing kanamycin (final concentration of 20 μg / mL) resistance. The recombinant Bacillus subtilis colonies obtained by activation of three generations were inoculated in 50 mL of LB medium containing kanamycin (final concentration of 20 μg / mL), and cultured at 37°C and 200 rpm for 24 hours. 2% of the inoculum was inoculated into 1 L of LB medium containing kanamycin (final concentration of 20 μg / mL), cultured at 37°C and 200 rpm until OD600 was about 5, and used as seed liquid to inoculate the fermenter.

[0039] Fermentation production process: soybean meal 5-10%, corn flour 1-5%, PPG-20000 0.1-1.0%, protease 0.1-1.0%, amylase 0.1-1.0%, disodium hydrogen phosphate (12 water) 0.2-0.5%, natural pH, temperature 37°C, stirring rate 600rpm, ventilation volume 1.5 (v / v), dissolved oxygen controlled at more than 20%. The pH of the fermentation process is natural, and the enzyme activity is measured after 24 hours of fermentation, and it is measured every 4 hours until the end of fermentation (48 hours).

[0040] The obtained protease NPR0 and protease mutant NPR-M136 were centrifuged or spray-dried to obtain fermentation broth for subsequent experiments.

[0041] Example 4: Application of protease mutants in enzymatic hydrolysis of soybean meal (1) Enzymatic hydrolysis and fermentation of soybean meal After grinding the soybean meal and passing it through a 40-mesh sieve, take 100g of soybean meal powder in a sealed bag, and add it to the soybean meal according to the above-mentioned addition amount (10U / g) according to the activity of protease, and the final moisture content is 35-45%. Dilute the protease appropriately with deionized water, and then adjust the volume to 50 ml. After mixing, pour it into the weighed soybean meal powder, mix the soybean meal in the sealed bag with the fermentation liquid, and place it in a 37℃ incubator for anaerobic fermentation for 3 days. After the fermentation is completed, perform qualitative detection of protein gel enzymatic hydrolysis bands.

[0042] Grouping: The experimental group was protease mutant NPR-M136 and 100g soybean meal powder; the control group was protease NPR0 and 100g soybean meal powder; the blank group was 100g soybean meal powder and water.

[0043] After 3 days of fermentation, the fermented soybean meal was poured into a tray and dried overnight at 65 degrees, and ground in a grinder for 20 seconds. Each group accurately weighed 3.000g of ground soybean meal powder and extracted antigen protein for 1 hour according to the instructions.

[0044] (2) SDS-PAGE to investigate the removal of antigenic proteins Take 100 μL of the sample that has been reacted and extracted in step (1), add 100 μL of Loading Buffer, boil for 10 min, and take 20 μL for loading.

[0045] Electrophoresis conditions: voltage 80-90mv, current 30mA for stacking gel; voltage 110-120mv, current 40mA for separation gel. Stop electrophoresis when the sample is 1cm away from the edge of the gel. Strip the gel, stain for 2h, decolorize for 24h, and change the decolorizing solution during this period.

[0046] The test results are as follows Figure 2As shown: under the same conditions and with the same enzyme activity unit addition, the degradation effect of the protease mutant NPR-M136 on soybean meal was significantly better than that of the control group, and it could better degrade the macromolecular hemispheric protein.

[0047] Example 5: Quantitative detection of soybean meal hydrolysis experiment with protease mutants - kit method According to the soybean meal enzymatic hydrolysis experiment in Example 4, the supernatant after extraction was subjected to a kit method to quantitatively detect the contents of glycinin and β-conglycinin.

[0048] Experimental steps: (1) Extraction: Weigh 0.3000 g of sample and add 30 mL of 1× sample extraction working solution. Extract at 37°C with shaking for 1 h. (2) Dilution: Centrifuge at 4000 rpm for 5 min, dilute 70 times with distilled water, mix well and wait for testing; (3) Sample addition: Add 50L of calibrator / test sample and 50L of antibody working solution, and incubate at 37°C for 10 min; (4) Washing: Wash the plate 4 times with 1× washing working solution and pat dry; (5) Add enzyme: Add 100 L / well of enzyme-labeled reagent and incubate at 37°C for 10 min; (6) Washing: Wash the plate 4 times with 1× washing working solution and pat dry; (7) Color development: Add 100 L / well of color development solution and incubate at 37°C in the dark for 10 min. (8) Stop: Add 100 L of stop solution per well and read the result with the microplate reader (read as quickly as possible). (9) Calculation: Substitute data into calculation software.

[0049] The determination steps of soybean globulin and β-conglycinin are the same, and they are determined according to the solutions in the kit. After the determination, the results are as follows Figure 3 As shown, compared with the original gene NPR0, the degradation rate of soybean meal antigen protein by the protease mutant NPR-M136 increased from 46% to 59.5% at the same enzyme activity addition amount, with an increase of 25%-30%. Therefore, the degradation efficiency of antigen protein and the utilization rate of protein feed were improved, while saving costs and reducing environmental pollution, and it has good market application prospects.

[0050] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A protease mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, characterized in that: The amino acid sequence of the protease mutant NPR-M136 is shown in SEQ ID NO: 3, which is obtained by changing the 184th lysine of the protease of SEQ ID NO: 1 to arginine, the 223rd asparagine to aspartic acid, and the 267th phenylalanine to leucine.

2. The gene encoding the protease mutant NPR-M136 according to claim 1, characterized in that: The nucleotide sequence of the encoding gene is shown in SEQ ID NO:

4.

3. A recombinant expression vector comprising the coding gene according to claim 2.

4. A recombinant engineered bacterium comprising the encoding gene according to claim 2.

5. The recombinant engineered bacterium according to claim 4, characterized in that The host of the recombinant engineering bacteria is any one of Bacillus subtilis, Bacillus licheniformis, yeast GS115, and Escherichia coli BL21.

6. The method for preparing the protease mutant NPR-M136 according to claim 1, characterized in that: The following steps are involved: (1) Connect the coding gene of the protease mutant NPR-M136 to the pWB980 vector to obtain a recombinant expression vector and transform it into competent cells. Use the resistance marker to screen positive clones to obtain recombinant engineered bacteria; (2) subjecting the recombinant engineered bacteria to shake flask fermentation and shaking culture to produce protease mutants; (3) The recombinant engineered bacteria after shake flask fermentation are inoculated into a fermentation tank to expand the fermentation culture to obtain the fermentation liquid or spray-dried powder of the protease mutant NPR-M136.

7. The preparation method according to claim 6, characterized in that: The parameters of the expanded fermentation culture are: natural pH, temperature 35-40°C, stirring rate 600-800rpm, ventilation volume 1.5 v / v, and dissolved oxygen controlled at more than 20%.

8. The preparation method according to claim 6, characterized in that: The culture medium for the expanded fermentation culture comprises the following components, calculated by mass percentage: 5-10% soybean meal, 1-5% corn flour, 0.1-1.0% PPG-20000, 0.1-1.0% protease, 0.1-1.0% amylase, 0.2-0.5% disodium hydrogen phosphate 12-hydrate, and the balance is water.

9. Use of the protease mutant NPR-M136 according to claim 1 in the preparation of feed additives and / or food additives.

10. The use according to claim 9, characterized in that: The feed additive contains the protease mutant NPR-M136 or a recombinant bacterium containing the protease mutant NPR-M136.

Images