Specific probe, primer, kit and method for insect-resistant and herbicide-resistant transgenic maize LD05

Abstract

The invention provides a probe, a probe and primer combination, a standard substance, a detection kit, a Real-time PCR (polymerase chain reaction) detection method and application of the real-time PCR detection method in detection of corn LD05.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a probe, a probe and primer combination, a standard product, a Real-time PCR detection kit and a detection method for quantitatively detecting an LD05 sample. Background Art

[0002] The corn transformant LD05 is a corn transgenic material that is resistant to insects and resistant to glufosinate herbicides. It has excellent resistance to lepidopteran pests such as the fall armyworm and corn borer, and good tolerance to glufosinate. This transformant can be used to cultivate insect-resistant and herbicide-resistant corn varieties.

[0003] The detection of transformant specificity mainly uses the common PCR method, but its disadvantages are low sensitivity, inability to monitor the PCR process in real time, and inability to quantify. With the development of molecular biology technology, Real-time PCR (real-time fluorescence quantitative PCR) has been widely used in transgenic detection. Compared with conventional PCR technology, it has the characteristics of short time consumption, simple operation, good specificity, and high sensitivity. The process can be monitored in real time, the results can be directly observed, and quantitative detection can be performed.

[0004] Real-time PCR methods can be divided into two types: dye method and probe method. The fluorescent dye in the dye method Real-time PCR can bind to double-stranded DNA to emit fluorescence, and its binding is non-specific. The primer dimer and DNA template in the system will bind to it, so the specificity of the dye method is not high. The probe in the probe method can specifically bind to the template, and its amplification curve reflects the accumulation of specific products. It does not contain non-specific amplification components, and its sensitivity is 10 times higher than that of the dye method. In addition, the dye method only supports single-channel reactions. If multi-channel tests are required, or different targets of the same sample are detected, the probe method is the most commonly used. The use of the probe method to develop a method for quantitatively detecting the maize transformant LD05 can provide an effective detection method for the identification and supervision of genetically modified organisms, and provide technical support for the safety management of agricultural genetically modified organisms.

[0005] A patent has been applied for the maize transformant LD05 and its detection method, with application number 2023101327522. The detection method used is ordinary PCR, and the length of the PCR product between the designed detection primers is too large (554bp and 1185bp), which is not suitable for direct use in real-time PCR. Summary of the invention

[0006] To solve the above problems, the present invention provides a probe, a probe and primer combination, a standard substance, a detection kit, and a Real-time PCR detection method for detecting LD05 samples. The above LD05 sample can be the genomic DNA of a corn LD05 transformant, or the genomic DNA of a LD05 transformant derivative line, or the genomic DNA of a mixed corn material containing LD05 transformants, or a nucleic acid sample containing LD05 identity information separated from the above sample by PCR amplification or the like. Since the sequence shown in SEQ ID NO.1 is a specific sequence for confirming the identity information of the LD05 transformant, any sample containing a nucleic acid molecule of the sequence shown in SEQ ID NO.1 can be detected by the method provided by the present invention.

[0007] The present invention can accurately identify corn LD05 transformants by designing highly sensitive and specific probes, upstream primers and downstream primers, and can separate them from conventional corn and other transgenic corn materials that do not contain LD05. The detection method has the advantages of high specificity, sensitivity and convenient operation, which makes up for the shortcomings of the conventional PCR method, which has a complicated process and low detection sensitivity.

[0008] The present invention provides a probe, characterized in that the nucleotide sequence of the probe is 5'-TTGTCGTTTCCCGCCTTCAGTTT-3'.

[0009] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group. When the probe is in a free state, the fluorescence emitted by the fluorescent group will be absorbed by the quencher group; during the PCR amplification process, the fluorescent group at the 5' end of the probe tightly bound to the template will be cleaved by the Taq enzyme, thus away from the quencher group at the 3' end, and the fluorescence emitted by the fluorescent group can be received by the instrument, and the generated fluorescence signal is proportional to the amount of amplified product in the sample.

[0010] In some embodiments, the fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL or MGB;

[0011] In some embodiments, the fluorescent group / quencher group combination is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2;

[0012] In the test of randomly selected fluorescent groups and quenching groups, the probes labeled with the above fluorescent groups and quenching groups can obtain specific detection results. At the same time, the probe labeled with FAM at the 5' end and BHQ1 at the 3' end has the lowest labeling cost and can be used as the most preferred probe labeling scheme.

[0013] The present invention also provides a primer and probe combination, characterized in that: it comprises the probe according to claim 1 and two primers, the nucleotide sequences of the primers are

[0014] 5'-CAGCCTGAATGGCGAATGC-3' and

[0015] 5'-GTGTGATTCGTTCATAAAGGTGTG-3';

[0016] The above-mentioned probes and probe and primer combinations were selected through software design, experimental screening and verification, and were located at the downstream boundary of the exogenous insertion sequence of the LD05 transformant.

[0017] The present invention also provides a standard product, characterized in that: the standard product is one or more nucleic acid samples with a concentration of not less than 16 copies / μL; the nucleic acid sample contains a nucleic acid molecule with a sequence shown in SEQ ID NO.1;

[0018] In some embodiments, the standard is 6 LD05 genomic DNA samples with concentrations of 20,000 copies / μL, 4,000 copies / μL, 800 copies / μL, 160 copies / μL, 32 copies / μL and 16 copies / μL, respectively; the DNA sample contains the nucleic acid molecule shown in SEQ ID NO.1;

[0019] In some embodiments, the standard is prepared by taking a LD05 genomic DNA sample with a concentration of 500 ng / μL and diluting it 10 times, 50 times, 250 times, 1250 times, 6250 times, and 12500 times, respectively.

[0020] The present invention also provides a detection kit, characterized in that: the detection kit comprises the above-mentioned probe and primer combination and the above-mentioned standard product;

[0021] In some embodiments, the detection kit comprises:

[0022] Primer 1, sequence: 5′-CAGCCTGAATGGCGAATGC-3′;

[0023] Primer 2, sequence: 5′-GTGTGATTCGTTCATAAAGGTGTG-3′;

[0024] probe, sequence: 5′-TTGTCGTTTCCCGCCTTCAGTTT-3′;

[0025] Standards, which are 6 LD05 genomic DNA samples with concentrations of 20000 copies / μL, 4000 copies / μL, 800 copies / μL, 160 copies / μL, 32 copies / μL and 16 copies / μL, respectively; the DNA samples contain nucleic acid molecules with the sequence shown in SEQ ID NO.1;

[0026] The 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ1.

[0027] The present invention also provides a real-time PCR detection method, characterized in that: the real-time PCR detection is performed using the above detection kit, wherein the final concentrations of primer 1 and primer 2 in the PCR reaction system are both 0.4 μM, and the final concentration of the probe is 0.2 μM.

[0028] The present invention also provides the use of the above-mentioned probe, probe and primer combination, standard product, detection kit, and detection method in detecting LD05 samples; wherein the LD05 sample contains a nucleic acid molecule with a sequence shown in SEQ ID NO.1.

[0029] The beneficial effects of the present invention are as follows: after software design and multiple test screenings, a combination of 1 probe and 2 primers is obtained from 8 sets of probe-primer combinations, on this basis, a Real-time PCR detection method is established and optimized using standard products with a suitable concentration gradient, and the use of the above-mentioned probes, probe and primer combinations, standard products, detection kits, and Real-time PCR detection methods can specifically detect nucleic acid samples containing SEQ ID NO.1 with a concentration of not less than 10 copies / μL, and can effectively distinguish LD05 materials from other corn materials that do not contain LD05, with extremely high sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Other features, objects and advantages of the present application will become more apparent by reading the detailed description of non-limiting embodiments made with reference to the following drawings:

[0031] Figure 1 PCR amplification curve of primer / probe screening.

[0032] Figure 2 Comparison results of the optimal probe / primer combinations at the 5' and 3' ends.

[0033] Figure 3 Amplification curve of the specificity test of probe / primer combination 6.

[0034] Figure 4 Amplification curve of PCR reaction system optimization.

[0035] Figure 5 Limit of detection (LOD) test results.

[0036] Figure 6 Draw a standard curve.

[0037] 1: Standard product S1 (40,000 copies); 2: Standard product S2 (8,000 copies); 3: Standard product S3 (1,600 copies); 4: Standard product S4 (320 copies); 5: Standard product S5 (64 copies); 6: Standard product S6 (32 copies).

[0038] Figure 7 Quantitative PCR profile of internal standard gene zSSIIb,

[0039] 1: Standard product S1; 2: Standard product S2; 3: Standard product S3; 4: Standard product S4; 5: Standard product S5;

[0040] 6: LD05 (5%); 7: LD05 (2%); 8: LD05 (0.5%).

[0041] Figure 8 Specific sequence quantitative PCR profile of LD05 transformants

[0042] 1: Standard product S1; 2: Standard product S2; 3: Standard product S3; 4: Standard product S4; 5: Standard product S5;

[0043] 6: LD05 (5%); 7: LD05 (2%); 8: LD05 (0.5%); 9: limit of quantification (100 copies). DETAILED DESCRIPTION

[0044] The present invention will be further described below in conjunction with the accompanying drawings. The following examples are only used to illustrate the present invention but do not limit the scope of the present invention.

[0045] The term "corn" refers to maize (Zea mays) and includes all plant varieties that can be crossed with maize, including wild maize species.

[0046] The term “including” means “including but not limited to”.

[0047] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present invention and are therefore at least partially composed of transgenic cells.

[0048] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences before the coding sequence (5' non-coding sequences) and regulatory sequences after the coding sequence (3' non-coding sequences). "Native gene" refers to a gene found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a natural gene, which contains regulatory and coding sequences that are not found in nature. "Endogenous gene" refers to a natural gene that is located in its natural location in the genome of an organism. "Foreign gene" is a foreign gene that is now present in the genome of an organism and did not exist originally, and also refers to a gene introduced into a recipient cell through a transgenic step. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. "Transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be called an "insertion site" or "target site."

[0049] Transformation procedures that cause random integration of foreign DNA can result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are usually not changed. Transformants will also contain a unique junction between a segment of heterologous insert DNA and genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. "Joint" is the point where two specific DNA fragments connect. For example, the junction is present at the position where the insert DNA connects to the flanking DNA. Junction points are also present in transformed organisms, where two DNA fragments are connected together in a manner found in natural organisms. "Joint DNA" refers to the DNA that contains a junction point.

[0050] LD05 transformants are plants and seeds comprising transgenic corn LD05 and plant cells or regenerable parts thereof, plant parts of the LD05, including but not limited to cells, pollen, ovules, flowers, shoots, roots, stems, leaves and products from corn LD05, such as corn cobs, stover, cornmeal, corn flour and biomass left in corn crop fields.

[0051] The term "probe" is a separate nucleic acid molecule to which a conventional detectable label or reporter molecule is bound, for example, a radioisotope, a ligand, a chemiluminescent agent or an enzyme. Such a probe is complementary to a strand of a target nucleic acid. In the present invention, the probe is complementary to a DNA strand from the genome of transgenic maize LD05, whether the genomic DNA is from transgenic maize LD05 or seeds or from plants or seeds or extracts of transgenic maize LD05 and other derivative strains, or a nucleic acid molecule containing LD05 identity information isolated from LD05. The probe of the present invention includes not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0052] The term "primer" is a separate nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forms a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pair of the present invention relates to its use in amplification of a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0053] Example 1 Design and screening of probes / primers

[0054] The specific detection method of transformants requires the design of primers and probes at the border sequences upstream or downstream of the insertion site, and the PCR amplification product needs to include the exogenous sequence and the maize genome sequence. Therefore, first, the primers and probes should be designed according to the border sequences of the maize LD05 insertion site.

[0055] 1. Design probe / primer combinations

[0056] A portion of the upstream or downstream border sequence of the insertion site (100-600 bp) is input as a template into the software (such as Primer Premier 5). The template sequence must contain both the maize genome sequence (at least 50 bp in length) and the exogenous insertion sequence (at least 50 bp in length). The two templates SEQ ID NO.2 and SEQ ID NO.3 are shown below (lowercase letters are exogenous sequences, uppercase letters are genome sequences):

[0057] Maize transformant LD05 upstream border template SEQ ID NO.2:

[0058] GTATATATAAAACCCTTTTTTTTTGCACAAAAGAAGAAGAGGAGCAAAACTTTATAAAACTAAACCCCACAAATAAACA

[0059] AGGTCGAAGTAAGGGATTTTAACAGTAGTCAGAAGAATGGAGTAAGGAATTTATTAACAGTAGTCAAGATGAATGCTTC

[0060] ACACGGCAACAAACAGAGAAGCTGTCGTCGTGGCCGGGTCGACGGATTACCTCTGCACCAAGAGATGGACAACGCAAGC

[0061] ACAACCGCGCAGCACAAGTGTCCCAGCCTCAGTGCTACTACCATGGCgtaaacaaattgacgcttagacaacttaataa

[0062] cacattgcggacgtttttaatgtactgaattaacgccgaattaattcgggggatctggattttagtact

[0063] Maize transformant LD05 downstream boundary template SEQ ID NO.3:

[0064] ttggcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatc

[0065] cccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcga

[0066] atgctagagcagcttgagcttggatcagattgtcgtttcccgccttcagtttaaactatcagtgttAGTTGTGTGGATG

[0067] ATCTCACACCTTTATGAACGAATCACACTACTGGGGGCTGGGGCTTCAGCGACAACGGCACACTGGTGGGAAGAAATGG

[0068] CCTGCAGCATGCTCGCTGAGAAACATATGGGATGCAGTGCAGATGCTATTTATGTCGTGGAATGCGATTCCAAGAACCA

[0069] ATTGGATGGGAATGGGATCGGAGCTGTGTTCTGGAACCTGGAGC

[0070] Set the relevant parameters in the software as follows:

[0071] ① The length of the primer is between 18 and 26 bp, and the length of the probe is between 18 and 30 bp;

[0072] ②The Tm value of the primer is between 58 and 60°C, and the Tm value of the probe is 8-10°C higher than that of the primer;

[0073] ③ Avoid generating complementary sequences of more than 3 bases inside the probe, inside the primer, or between the probe and the primer;

[0074] ④The first base at the 5' end of the probe is not G;

[0075] ⑤The upstream primer and downstream primer are located in the corn genome and the exogenous insertion sequence respectively.

[0076] ⑥The length of the PCR product between the upstream primer and the downstream primer is between 80-200bp.

[0077] Finally, 8 probe / primer groups with higher software scores were selected as candidate combinations for further screening. The candidate combinations are shown in Table 1. Combinations 1-4 are probes / primers inserted into the 5' end of the sequence, and combinations 5-8 are probes / primers inserted into the 3' end of the sequence.

[0078] Table 1 8 candidate probe / primer groups with higher software design scores

[0079]

[0080] F: upstream primer; R: downstream primer; P: probe.

[0081] 2. Probe / Primer Screening

[0082] The probes / primers in Table 1 were synthesized, and real-time fluorescence quantitative PCR reaction was performed using 1% LD05 genomic DNA as a template. Three replicates were set for each probe / primer combination.

[0083] The screening steps are as follows: select the probe / primer combinations with the strongest amplification signals at the 5' end and the 3' end, respectively, and then select the combination with the strongest amplification signal and the smallest Ct value from the two best probe combinations with the strongest amplification signals for subsequent experiments. The reaction system and reaction procedure are shown below.

[0084] Realtime PCR reaction system:

[0085]

[0086] Reaction procedure:

[0087] Denaturation at 95°C for 5 min (first stage); denaturation at 95°C for 15 s, annealing and extension at 60°C for 60 s, cycle number ≥ 40 (second stage, fluorescence signal collection during annealing and extension).

[0088] Real-time fluorescence quantitative PCR amplification curve is shown in Figure 1 and Figure 2 The Ct values ​​of the amplification curves are shown in Table 1. Figure 1 The results showed that the strongest amplification signals were obtained in combination 4 and combination 6 at the 5' end and 3' end, respectively. Figure 2 The results showed that the amplification signal of combination 6 was stronger than that of combination 4; the results in Table 1 showed that the Ct value of combination 6 was the smallest.

[0089] Therefore, probe / primer combination 6 was selected to continue the subsequent experiments.

[0090] Table 2 Primer / probe screening amplification experiment results

[0091]

[0092] The probe / primer combinations screened are as follows:

[0093] LD05-qF:CAGCCTGAATGGCGAATGC

[0094] LD05-qR:GTGTGATTCGTTCATAAAGGTGTG

[0095] LD05-qP: FAM-TTGTCGTTTTCCCGCCTTCAGTTT-BHQ1

[0096] The probe and primer of combination 6 are located at the downstream boundary of the exogenous insertion sequence, and the specific positions are as follows (lowercase letters are vector sequences, uppercase letters are genome sequences, shading represents primers, and boxes represent probes):

[0097]

[0098] III. Specificity test of probe / primer combination 6

[0099] Different crops and their main commercial transformants were selected to conduct specificity tests on the probe / primer combination 6 screened in Example 1, and the acceptance criteria set was to obtain the expected amplification only in positive samples.

[0100] The specificity verification samples are as follows:

[0101] (1) Negative control (non-GM corn);

[0102] (2) Positive control (1% concentration of transgenic corn LD05, mass fraction);

[0103] (3) GM corn mixture (Bt11, Bt176, MON810, MON863, GA21, NK603, T25, TC1507, MON89034, MON88017, 59122, MIR604, 3272, MON87460, DAS40278-9, 4114, MON87427, 5307, 1% each, with non-GM corn as filler);

[0104] (4) genetically modified soybean mixture (GTS40-3-2, MON89788, A5547-127, A2704-12, 356043, 305423, CV127, MON87701, MON87708, MON87769, MON87705, FG72, DAS81419-2, 1% each, with non-genetically modified soybean as filler);

[0105] (5) GM cotton mixture (MON1445, MON531, MON15985, LLCOTTON25, MON88913, GHB614, COT102, 1% each, with non-GM cotton as filler);

[0106] (6) GM rapeseed mixture (MS1, MS8, RF1, RF2, RF3, T45, Oxy235, Topas19 / 2, MON88302, 73496, 1% each, with non-GM rapeseed as filler);

[0107] (7) A mixture of genetically modified rice (TT51-1, KF-6, KMD-1, M12, KF-8, KF-2, G6H1, T1C-19, 1% each, with non-genetically modified rice as filler).

[0108] The experimental results showed that except for the 1% transgenic corn LD05 sample, no amplification was obtained in other samples ( Figure 3 ), indicating that probe / primer combination 6 is highly specific.

[0109] Example 2 Preparation of Standards

[0110] To quantitatively analyze the initial template amount of a sample using real-time PCR, it is necessary to use a standard sample with a known copy number to make a standard curve, then obtain the Ct value of the sample to be tested through PCR, and finally calculate the copy number of the sample from the standard curve. Therefore, first of all, it is necessary to prepare a suitable standard sample, and the preparation method is as follows:

[0111] 1. Extraction of genomic DNA from corn LD05:

[0112] The CTAB method was used for extraction. The specific steps are as follows:

[0113] 1) Take 0.1 g of corn LD05 sample leaves, grind into powder, add 500-800 μL CTAB, and warm at 65°C for 0.5-1 h;

[0114] 2) Add 700 μL of chloroform or chloroform:isoamyl alcohol (24:1), shake slowly, centrifuge at 12000 rpm for 15 min, and take 400-700 μL of the supernatant;

[0115] 3) Add 1 mL of pre-cooled anhydrous ethanol or isopropanol, mix thoroughly, centrifuge at 12000 rpm for 10 min, and discard the supernatant;

[0116] 4) Wash the precipitate with 75% alcohol, centrifuge at 12000 rpm for 5 min, discard the alcohol, and invert to absorb water and dry;

[0117] 5) Dissolve the DNA in 50 μL ddH2O, take 3-5 μL for electrophoresis, and use a UV spectrophotometer to determine the DNA concentration to be 1 μg / μL.

[0118] 2. Preparation of a series of concentration gradient standards

[0119] When performing real-time fluorescence quantitative PCR, the template concentration needs to be expressed in copies / μL.

[0120] Calculation formula: Template copies / μL = Avogadro constant × number of template moles, where Avogadro constant = 6.02 × 10 23 copies / mol, template molecular weight = template DNA length (number of bases) × 660 (average molecular weight of bases).

[0121] According to the above formula, the LD05 of 1 μg / μL genomic DNA solution is 6.02×10 23 copies / mol×(1×10 - 6 g / μL) / (2300*10 6 × 660 g / mol), which is 400,000 copies / μL.

[0122] Take 1 μL of the above solution and dilute it 20 times, 100 times, 500 times, 2500 times, 12500 times, 25000 times and 62500 times respectively to obtain the standard products S1-S7 (Table 3) with the concentration of 20000, 4000, 800, 160, 32, 16 and 6.4 copies / μL. The standard products were stored at -20°C for future use.

[0123] Table 3 DNA quantity and copy number in standard products

[0124]

[0125]

[0126] Example 3 Establishment and Optimization of Probe Method Real-time PCR Reaction System

[0127] The present invention obtains usable probes and primers through the operation of Example 1, and obtains a series of standard products with concentration gradients through Example 2. However, whether the specific Real-time PCR reaction system can have a better effect is also affected by factors such as the concentration of primers and probes. Therefore, in order to obtain efficient and accurate quantitative results, the PCR reaction system needs to be further optimized.

[0128] 1. Establish a preliminary Real-time PCR reaction system

[0129] The reaction system was established by diluting the primer and probe combination 6 screened in Example 1, adding deionized water to dilute the concentration to a working solution of 10 μM, and performing probe method Real-time PCR amplification.

[0130] Real-time PCR reaction system is:

[0131]

[0132] The reaction procedure was as follows: denaturation at 95°C for 5 min (first stage); denaturation at 95°C for 15 s, annealing and extension at 60°C for 60 s, and the number of cycles was ≥ 40 (second stage, collecting fluorescence signals during the annealing and extension period).

[0133] 2. Optimizing the Real-time PCR Reaction System

[0134] The probe and primers were set at 5 concentration gradients, where the final concentration of the primers was set at 0.1, 0.2, 0.3, 0.4 and 0.5 μM, and the corresponding probe concentration was 1 / 2 times the primer concentration. The real-time PCR test results of each combination are shown in Figure 2. Figure 4 And as shown in Table 4.

[0135] Table 4 Test results of different primer and probe concentrations

[0136]

[0137]

[0138] The results showed that the Ct value of concentration gradient 3 was the smallest and the fluorescence signal value was the highest. Therefore, the final concentration of the primer in the subsequent test reaction system was determined to be 0.4 μM and the final concentration of the probe was 0.2 μM.

[0139] The optimized reaction system is:

[0140]

[0141] Example 4 Sensitivity Test

[0142] The minimum copy number of a sample that can be detected by a sensitivity test is the limit of detection (LOD). When Real-time PCR is used to detect standards of different concentrations, if a certain concentration of the standard can form an amplification curve but the Ct value is >38, it is considered that the concentration of the standard exceeds the detection limit of the PCR system.

[0143] Using the probe / primer combination 6 described in Example 1, the reaction system optimized in Example 3, and the standard of Example 2 as a template (three replicates per concentration), ddH2O as a blank control, Real-time PCR amplification was performed to determine the detection limit of the detection method of the present invention. The test results are shown in Table 5. When the concentration of the standard was 16 copies / μL and 6.4 copies / μL, the Ct values ​​of the amplification curve were 34.22 and 36.72, respectively. Therefore, the detection limit of Real-time PCR is between 16 copies / μL and 6.4 copies / μL.

[0144] Table 5 Sensitivity test results

[0145]

[0146] Furthermore, the concentration of transgenic corn LD05 genomic DNA was diluted to 10 copies / μL (i.e., a concentration of 0.05%) for detection limit testing, with 60 replicates. The experimental results showed that a typical amplification curve could be obtained for all 60 replicates ( Figure 5 ), the detection limit was determined to be 10 copies / μL, corresponding to a concentration of 0.05% (calculated based on the addition of 100 ng of DNA template into the PCR reaction system).

[0147] Example 5 Drawing a standard curve

[0148] Real-time PCR is performed using multiple standards with gradient concentrations as templates and the Ct values ​​are recorded. A standard curve is drawn based on the initial template amount (logarithm of the copy number) and the Ct value to obtain a standard equation. When the initial template of the sample to be tested needs to be quantified, only the amplification curve needs to be obtained, the Ct value needs to be read, and the initial template amount of the sample to be tested can be calculated by inserting it into the standard equation.

[0149] Real-time PCR amplification was performed using the standard of Example 2 as a template (three replicates for each concentration), ddH2O as a blank control, probe / primer combination 6 of Example 1, and the reaction system optimized in Example 3.

[0150] Draw a standard curve with the logarithm of the standard concentration as the horizontal axis and the Ct value as the vertical axis. Figure 6 . Experimental results analysis: In the two repeated experiments, the amplification efficiency of the standard curve was 95.814% and 95.188%, the slope was -3.427 and -3.443, and R 2 The linearity of the method was 0.996 and 0.999, respectively, which met the relevant requirements of the quantitative standard, indicating that the method had good linearity in the range of copy number 40000 to 32. The detailed test results are shown in Table 6.

[0151] Table 6 Standard curve linearity determination data statistics

[0152]

[0153] Example 6 Real-time PCR kit

[0154] A kit for detecting maize LD05 was prepared according to the following composition: 2×TaqMan reaction buffer, 10 μM upstream primer, 10 μM downstream primer, 10 μM probe, the standard of Example 2, and ddH2O.

[0155] The primers and probes were the combination 6 described in Example 1.

[0156] The reaction system of the kit can be: 12.5 μL of 2×TaqMan reaction buffer, 1 μL of 10 μM upstream primer (LD05-qF), 1 μL of 10 μM downstream primer (LD05-qR), 0.5 μL of 10 μM probe (LD05-qP), 2 μL of template DNA, 8 μL of ddH2O, and the total reaction volume is 25 μL.

[0157] The reaction program of the kit for real-time PCR is: denaturation at 95°C for 5 min (first stage); denaturation at 95°C for 15 s, annealing and extension at 60°C for 60 s, and the number of cycles is ≥ 40 (second stage, collecting fluorescence signals during the annealing and extension period).

[0158] When the kit is used to detect samples, an amplification curve is obtained through the fluorescent signal detected by the instrument, and the sample copy number is calculated based on the standard equation established by the standard and the Ct value of the sample to be tested.

[0159] Example 7 Accuracy and Precision

[0160] The transgenic maize LD05 genomic DNA was mixed with the non-transgenic maize genomic DNA to prepare samples with concentrations of 5%, 2% and 0.5% as test samples, and the accuracy and precision of the quantitative PCR method were tested using the probe / primer combination 6 described in Example 1, the standard prepared in Example 2, the reaction system optimized in Example 3 and the kit described in Example 6. The primer / probe for the internal standard gene zSSIIb used the sequence in the national standard "Qualitative PCR Method for Detecting Internal Standard Genes in Maize for Transgenic Plants and Their Product Components" (Announcement No. 1861 of the Ministry of Agriculture and Rural Affairs of the People's Republic of China-3-2012) (Table 7).

[0161] Table 7 Primer / probe information for standard gene zSSIIb

[0162]

[0163] The copy numbers of the standard products are 40000, 8000, 1600, 320, and 64. The copy numbers and transgenic content of the test samples are calculated based on the standard curve. The calculation formula is: transgenic content = LD005 copy number / zSSIIb copy number × 100%. See the standard curve and amplification curve for details. Figure 7 and Figure 8 ,The statistical results are shown in Tables 8 and 9.

[0164] The results of two repeated experiments showed that the standard curve amplification efficiency of the transgenic maize LD05 transformant-specific quantitative PCR method was 91.887% and 92.777%, the slope was -3.533 and -3.508, and the R 2 were 0.998 and 1.000, respectively, both meeting the requirements of the quantitative standard (Table 8, Figure 8 ); the deviations of the determination results of 5%, 2% and 0.5% samples were 4.00%, 9.25% and 4.00%, and the RSDr were 4.62%, 4.85% and 2.72%, respectively, which met the requirements of the quantitative standards (Table 9).

[0165] The results showed that the established LD05-specific quantitative PCR method can be used to determine the content of LD05 components in transgenic corn in transgenic samples.

[0166] Table 8 Quantitative PCR results of transgenic corn LD05

[0167]

[0168] Note: The standard curve formula is y=ax+b, where the Ct value is used as the y-axis and the logarithm of the copy number is used as the x-axis.

[0169] Table 9 Calculation results of genetically modified ingredient content

[0170]

[0171] Example 8 Limit of Quantitation (LOQ) Detection

[0172] The genomic DNA of transgenic maize LD05 was diluted to 100 copies, 6 replicate samples were set up, and 2 replicate experiments were carried out for quantitative limit detection. The results are shown in Figure 8 and Table 10.

[0173] Table 10 Quantitative limit test results

[0174]

[0175] The experimental results showed that the deviation of the measurement results of 100 copies of samples was 4.65%, which did not exceed 25% of the standard value, and the RSDr was 10.06%, which was less than 25%, meeting the requirements of the quantitative standard, and the quantitative limit of the method was determined to be 100 copies.

[0176] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can use the technical content disclosed above to make changes or modifications to equivalent embodiments of equivalent changes without departing from the scope of the technical solution of the present invention. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A probe and primer combination, characterized in that The nucleotide sequence of the probe is 5'-TTGTCGTTTCCCGCCTTCAGTTT-3', and the nucleotide sequences of the primers are 5'-CAGCCTGAATGGCGAATGC-3' and 5'-GTGTGATTCGTTCATAAAGGTGTG-3'.

2. The probe and primer combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; The fluorescent group is FAM, TET, Any one of CY3, JOE, VIC, ROX, CY5, TAMRA or Texas; the quenching group is any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL or MGB.

3. The probe and primer combination according to claim 2, characterized in that: The combination of the fluorescent group and the quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA or VIC / BHQ2.

4. The probe and primer combination according to claim 3, characterized in that: The fluorescent group is FAM; the quenching group is BHQ1.

5. A detection kit, characterized in that: The detection kit comprises the probe and primer combination according to any one of claims 1 to 4 and a standard; Wherein, the standard is an LD05 genomic DNA sample with a concentration of not less than 16 copies / μL.

6. The kit according to claim 5, characterized in that: The standard substances are LD05 genomic DNA with six concentrations of 20,000 copies / μL, 4,000 copies / μL, 800 copies / μL, 160 copies / μL, 32 copies / μL and 16 copies / μL.

7. Real-time PCR detection method, characterized in that: Real-time PCR detection is performed using the detection kit according to any one of claims 5 to 6, wherein the final concentration of primers in the PCR reaction system is 0.4 μM, and the final concentration of the probe is 0.2 μM.

8. Use of the probe and primer combination according to any one of claims 1 to 4, the detection kit according to any one of claims 5 to 6, and the detection method according to claim 7 in quantitative detection of LD05 samples; in, The LD05 sample contains a nucleic acid molecule with a sequence shown in SEQ ID NO.1.

Images